ID: 1106676795

View in Genome Browser
Species Human (GRCh38)
Location 13:31968387-31968409
Sequence ATCTGTGTATAGAGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106676795_1106676799 28 Left 1106676795 13:31968387-31968409 CCAGTTTCCCTCTATACACAGAT No data
Right 1106676799 13:31968438-31968460 TCTCACTCTGCTTCTTCTCAGGG No data
1106676795_1106676798 27 Left 1106676795 13:31968387-31968409 CCAGTTTCCCTCTATACACAGAT No data
Right 1106676798 13:31968437-31968459 GTCTCACTCTGCTTCTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106676795 Original CRISPR ATCTGTGTATAGAGGGAAAC TGG (reversed) Intergenic
No off target data available for this crispr