ID: 1106690950

View in Genome Browser
Species Human (GRCh38)
Location 13:32115781-32115803
Sequence CACTAGAGGGAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 0, 2: 0, 3: 58, 4: 560}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106690950_1106690955 -2 Left 1106690950 13:32115781-32115803 CCAGCCTCCTTCTCCCTCTAGTG 0: 1
1: 0
2: 0
3: 58
4: 560
Right 1106690955 13:32115802-32115824 TGATCTGACCTAAGAACCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106690950 Original CRISPR CACTAGAGGGAGAAGGAGGC TGG (reversed) Intronic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900667969 1:3828356-3828378 CACAGGAGGCGGAAGGAGGCAGG - Intronic
900829982 1:4959055-4959077 CACCAGAGGCCGGAGGAGGCCGG - Intergenic
900966230 1:5960632-5960654 CATGACAGGTAGAAGGAGGCTGG + Intronic
901063081 1:6482449-6482471 GACAGGAGGGAGGAGGAGGCCGG + Intronic
901251480 1:7783630-7783652 CATTAGAGGGAGGGAGAGGCGGG - Intergenic
901881451 1:12196404-12196426 CACTGGAGTGGGAATGAGGCTGG - Intronic
902018490 1:13327661-13327683 CATGAGAGGGAGAGGGAGACGGG - Intergenic
902179907 1:14679974-14679996 GACAAGAGGGAGAAGGTGGCTGG + Intronic
902655776 1:17867039-17867061 CACAGGAGGCAGAAGAAGGCTGG - Intergenic
902762284 1:18590028-18590050 CACCAGGAGGAGAAGGAGGAGGG - Intergenic
903363561 1:22792368-22792390 CAGTTGAGGGAGAAGGAGGGGGG + Intronic
903638146 1:24834793-24834815 CATGAGAGGGAGAGGGAGACGGG + Intronic
903848900 1:26294673-26294695 CCCAAGTGTGAGAAGGAGGCAGG + Intronic
904432611 1:30474555-30474577 CACTAAGGTGAGGAGGAGGCAGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
906059847 1:42941372-42941394 CACTAGAGTGAACAGGAGGAGGG - Intronic
906263922 1:44414062-44414084 CACTTAAGGGAGAAGGCTGCTGG + Intronic
906400935 1:45504166-45504188 CACTTTAGGGAGGCGGAGGCGGG + Intronic
907303528 1:53502190-53502212 GAAGAGAGGGACAAGGAGGCGGG + Intergenic
907531979 1:55108365-55108387 CACTATAGTGAGAAGCAAGCAGG + Intronic
907831040 1:58064513-58064535 CCCTAGAGGACGAAGGAGGAAGG + Intronic
907901536 1:58746012-58746034 CAGCAGAGGGAGAAAGAGCCAGG - Intergenic
908238418 1:62169131-62169153 CACCAGAGGGGGCGGGAGGCTGG - Intergenic
910094468 1:83505247-83505269 CTCTGGAAGGAGGAGGAGGCAGG - Intergenic
910120211 1:83779841-83779863 CAAGAGAGGGAGAGGGAGACAGG + Intergenic
910353273 1:86324331-86324353 CACAAGGCGGAGAAGGAGGTGGG + Intergenic
910530043 1:88225518-88225540 TACTAGAGGGATAAAGGGGCTGG - Intergenic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
911101513 1:94099315-94099337 CTCTGGAGGCTGAAGGAGGCAGG + Intronic
911531665 1:99050950-99050972 TACTAGAGGGAGGAGGAAGACGG - Intergenic
911581996 1:99644752-99644774 AGCTAGACAGAGAAGGAGGCTGG + Intergenic
911952243 1:104189288-104189310 CTCGAGAGGGACAAGGAGACAGG + Intergenic
912258538 1:108085650-108085672 CACCAGTGGAAGAAAGAGGCTGG + Intergenic
912314459 1:108654402-108654424 CTCTAAAGGGAGATGGAGGAGGG + Intronic
912481476 1:109984994-109985016 CGCCAGAGGGGGAAAGAGGCGGG + Exonic
913411957 1:118561961-118561983 CACCAGAGGCTGGAGGAGGCAGG + Intergenic
914454564 1:147823828-147823850 TCCTAGAGGGAGACTGAGGCAGG - Intergenic
914985650 1:152455072-152455094 AGCTAGAGAGAGAAGGGGGCAGG - Intergenic
915171632 1:153982175-153982197 CCCTAGAGGGAGAAGGGCACAGG + Exonic
915200084 1:154220878-154220900 CGCGAGAGGGAAAAGGAGGGAGG + Exonic
915246403 1:154558785-154558807 CACGTGAGGGGGACGGAGGCGGG - Intronic
915252982 1:154603680-154603702 CACTGGAGGGTGATGGAGCCAGG + Intronic
915555314 1:156657857-156657879 CACGAGAAAGGGAAGGAGGCCGG - Intronic
915770480 1:158417122-158417144 CAATTGAAGGAGTAGGAGGCTGG + Intergenic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916264136 1:162873260-162873282 CAATGTAGGGAGAAGGAGCCAGG - Intergenic
916616377 1:166445531-166445553 CACTAGAAGAAGAAGAAGGAAGG + Intergenic
916839349 1:168583997-168584019 ACCCAGAGGAAGAAGGAGGCTGG + Intergenic
917736809 1:177928985-177929007 CACTGGAGTGAGAGGGAGGAGGG - Intronic
917817568 1:178725724-178725746 CCCAAGAGGGAGAGCGAGGCGGG - Intronic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
919074594 1:192798047-192798069 AACAAGAGGGAGAGGGAGGGAGG - Intergenic
919555837 1:199051795-199051817 TACTAGGGGGAGAAGTAGGGAGG + Intergenic
919787359 1:201268151-201268173 CACTAGTGGGAGAAGGAAATGGG + Intergenic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
919844474 1:201632727-201632749 CCCTCGTGTGAGAAGGAGGCAGG - Intronic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
920017406 1:202924412-202924434 TACCAGAGGGATAAGGAGGAAGG - Intronic
920035828 1:203064809-203064831 CACAAGTGAGAGAAGCAGGCTGG - Intronic
921650975 1:217677700-217677722 TACTAGAAGTAGAAGGAGGGAGG - Intronic
922113322 1:222584274-222584296 CATTGGAGGGAAAAGGAGGAAGG - Exonic
924298640 1:242614289-242614311 CTCTGGAGGGAGACTGAGGCTGG - Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063453644 10:6168176-6168198 GACTAGAGGTAGTGGGAGGCTGG + Intronic
1064131823 10:12716435-12716457 CACTAGACGGAACAGTAGGCAGG - Intronic
1065087187 10:22190413-22190435 CTACAGAGGGGGAAGGAGGCAGG - Intergenic
1065156010 10:22870860-22870882 CTCTGGAGGGTGAAGGAGGGAGG - Intergenic
1065299501 10:24308513-24308535 CACTGAATGGAGAAGAAGGCAGG + Intronic
1066085156 10:31969107-31969129 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1067066723 10:43108097-43108119 CACTTTAGGGAGACCGAGGCGGG + Intronic
1067455333 10:46415067-46415089 CAATGGAGGGAGAAAGTGGCTGG + Intergenic
1067631871 10:47969568-47969590 CAATGGAGGGAGAAAGTGGCTGG - Intergenic
1068865063 10:61886320-61886342 CACAAGAGTGAGAAGGTGTCAGG - Intergenic
1069341853 10:67419504-67419526 TACTAGAGGGTGAAGTGGGCTGG - Intronic
1070309504 10:75262982-75263004 GACTGGAGGGACAAGGAGCCAGG - Intergenic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070381112 10:75881332-75881354 CACAATAGGGATAATGAGGCAGG + Intronic
1070791010 10:79189360-79189382 CATCAGAGGCAGAAGGAAGCTGG - Intronic
1071032712 10:81204226-81204248 CACAAGAGAAAGATGGAGGCCGG - Intergenic
1071097588 10:81996679-81996701 GGCTAGAGGAAGGAGGAGGCAGG + Intronic
1071150046 10:82623299-82623321 GACTTGATGGAGAAGCAGGCTGG - Intronic
1071923119 10:90374043-90374065 CACTAGAGGAAGGTGGAGGAGGG - Intergenic
1073036674 10:100568660-100568682 CACTAGAGGGAGAGCTTGGCTGG - Intergenic
1073538310 10:104297448-104297470 AACCAGAGGGAGAAGGAGAGAGG + Intronic
1073998716 10:109345638-109345660 CCCTGGAGGGAGCAGGAGACAGG + Intergenic
1076241768 10:128914033-128914055 GAGTAGAGGGAGAACGGGGCAGG + Intergenic
1076255693 10:129022755-129022777 CCCTAGAGGGGGGAGGGGGCGGG - Intergenic
1077043334 11:534081-534103 CTCTAGAGGAAGCAGGAGACAGG + Intronic
1077382328 11:2249937-2249959 CACTAGAGGGAGGAGGCTGAGGG + Intergenic
1078181626 11:9016557-9016579 GCCTGAAGGGAGAAGGAGGCAGG + Intergenic
1078894348 11:15584815-15584837 AACATGAGGGAGAAGAAGGCAGG + Intergenic
1081562102 11:44227148-44227170 GACTAGGGGGAGAAGGGGGAAGG - Intronic
1081710414 11:45212413-45212435 TACAAAAGGGAGAAGGAGGGAGG - Intronic
1081811744 11:45918034-45918056 GACTTGAGGGAGTAGGGGGCCGG - Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083691184 11:64409802-64409824 AACCAGAGAGAGAAGGAGGCGGG - Intergenic
1083709510 11:64539376-64539398 AACCAGAGGCAGCAGGAGGCTGG + Intergenic
1083964605 11:66035747-66035769 CAACAGAGGGCGAAGGAGTCAGG - Intergenic
1085107195 11:73855374-73855396 AACTAGAGGTAGAGGGAGGTGGG - Intronic
1085211532 11:74784454-74784476 CAGTAGAGGGAGAAGGTGTGTGG + Intronic
1085256609 11:75177116-75177138 CACCATAGGGAGGAGGAGGAGGG + Intronic
1085276208 11:75301881-75301903 CCCAGGAGGGGGAAGGAGGCAGG + Intronic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088779945 11:113124206-113124228 CTCTAGACTGAGAAGGAGGAAGG + Intronic
1089120424 11:116130628-116130650 CAGTAGAGAAAGGAGGAGGCAGG - Intergenic
1089290279 11:117433480-117433502 CAGTAGAGGGAGAGGAGGGCTGG + Intronic
1089432439 11:118435715-118435737 CAGTAGAGCGAGGAGGTGGCAGG + Intergenic
1089905427 11:122033147-122033169 CACGAGAGAGTGAAGGAAGCAGG + Intergenic
1090283381 11:125477774-125477796 CCCTGGAGGCAGAAGGAGCCAGG - Intronic
1090465548 11:126929982-126930004 CACTTGAGGGAGGAGGAAGGAGG + Intronic
1090982732 11:131737748-131737770 CCCTGGAGTGAGCAGGAGGCAGG + Intronic
1091288233 11:134421073-134421095 CACCAGAGGGAGAGGCAGGGAGG - Intergenic
1091378405 12:41281-41303 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1091843504 12:3637156-3637178 CACTGAAGGGAGGAGCAGGCAGG + Intronic
1091866761 12:3845135-3845157 CACCAAAGGGAAAAGGGGGCTGG - Intronic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1093115035 12:15198708-15198730 TTCTAGAAGGTGAAGGAGGCAGG - Intronic
1093516329 12:19990808-19990830 CTTAAGAGGGAGAGGGAGGCAGG + Intergenic
1096031303 12:48417730-48417752 TACTAGAGGGAGAGGGAGGGAGG - Intergenic
1096428223 12:51522030-51522052 CATTACAGTGAGGAGGAGGCTGG + Intergenic
1097145514 12:56936903-56936925 AACAAGAGGGAGGAGGAGGCAGG - Intergenic
1097194300 12:57235326-57235348 CACGTGGGGGAGGAGGAGGCAGG - Exonic
1097222934 12:57461237-57461259 CAGTAGAGGGAGAAGGCGGGCGG + Intronic
1097983158 12:65754956-65754978 CTCAGGAGGGAGAAGGGGGCGGG + Intergenic
1098137342 12:67416556-67416578 AACTAGAAGGAAAAGGAGGGAGG - Intergenic
1098144412 12:67484216-67484238 CACTAGAGGTTAAAGGAAGCTGG - Intergenic
1098203973 12:68086384-68086406 CTCTCCTGGGAGAAGGAGGCAGG + Intergenic
1099973795 12:89525776-89525798 ACCTGGAGGGAGATGGAGGCAGG - Intronic
1100263884 12:92957795-92957817 CAATGGAGGGAGAAGGGGGAGGG - Intergenic
1100570924 12:95842348-95842370 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1100716588 12:97312661-97312683 CATTAGTGGGAGGAGGTGGCTGG + Intergenic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102222295 12:111202674-111202696 CATTGGAGGGGGCAGGAGGCGGG + Intronic
1102288323 12:111677954-111677976 CACTAAAAAGAGAATGAGGCCGG + Intronic
1102787984 12:115619757-115619779 GACTCGAGTGAGAAGGAGCCTGG - Intergenic
1103569264 12:121833614-121833636 AATTTGAGGGAGCAGGAGGCTGG + Intergenic
1103954964 12:124571006-124571028 CAACAGAGGGGGAAGGAGGCAGG + Intergenic
1104062198 12:125277978-125278000 CACAACTGGGAGAAGCAGGCTGG - Intronic
1104632685 12:130417569-130417591 CACTAGATGGTGAAGGAGGGAGG + Intronic
1105446583 13:20462222-20462244 GCCTGGTGGGAGAAGGAGGCAGG + Intronic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1106927113 13:34624366-34624388 CACTAAAAGGAGAAGAAGACGGG + Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1107908416 13:45083071-45083093 CAACAGAGGGAGAAGAAGCCAGG - Intergenic
1108259725 13:48644490-48644512 CACTAGTGGTAGAGAGAGGCAGG - Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1109302542 13:60604183-60604205 TACTAGAGGGGGAAGGAGGGAGG + Intergenic
1109443150 13:62400449-62400471 GACTAGAGGGATAAGGAGGAGGG - Intergenic
1110233525 13:73192253-73192275 CCGGAGAGTGAGAAGGAGGCAGG - Intergenic
1110356503 13:74573802-74573824 CACCAGCGGGAGAAGAAAGCAGG - Intergenic
1111182412 13:84686584-84686606 CACAGGAGAAAGAAGGAGGCTGG - Intergenic
1112486924 13:99828195-99828217 CTATAGAGGGGAAAGGAGGCAGG + Intronic
1113343991 13:109455834-109455856 CATCGGAGGGAGAAGAAGGCAGG - Intergenic
1113641763 13:111962708-111962730 GACTTGAAGGAGGAGGAGGCTGG + Intergenic
1114557401 14:23569928-23569950 GACTAGAGGGAGGAGGTGGAAGG - Intronic
1114719448 14:24864927-24864949 CAGTAGAGAGAGAAGGTGGCGGG - Intronic
1117462043 14:55954994-55955016 TCCTAAAGGAAGAAGGAGGCTGG + Intergenic
1118309436 14:64681849-64681871 CCCAAGAGGAAGAGGGAGGCTGG + Intergenic
1118341418 14:64896653-64896675 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1118400200 14:65372711-65372733 TACTAAAGAAAGAAGGAGGCCGG - Intergenic
1118769455 14:68932281-68932303 CACGGGAGAGAGATGGAGGCTGG - Intronic
1118975357 14:70671708-70671730 AACGAGTGGGGGAAGGAGGCAGG - Exonic
1119187629 14:72654102-72654124 CACTGTAGGAAGGAGGAGGCTGG - Intronic
1120015629 14:79470216-79470238 CACAAGGGGGAGATGAAGGCAGG + Intronic
1120265133 14:82239058-82239080 CAATAGGGGGAGAAGCAGGAAGG + Intergenic
1120847419 14:89138760-89138782 CACTAGAAGGTGGAGGGGGCTGG + Intronic
1121449129 14:93996582-93996604 CCAGAGAGGGTGAAGGAGGCAGG - Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1124013840 15:25860433-25860455 GAATAGAAGGAGGAGGAGGCTGG - Intronic
1124466241 15:29942339-29942361 CACTAGGTGGAGATGAAGGCCGG + Intronic
1124926852 15:34078363-34078385 CAATAGAGGTAGGAGGAGGGTGG + Intergenic
1125651036 15:41318064-41318086 TATTAGAGGGAGAGAGAGGCTGG + Intronic
1126096359 15:45093627-45093649 CATTTGAGGGAGGAGGAGGCTGG - Exonic
1127568528 15:60216883-60216905 CATTAGAGGCAGGAAGAGGCAGG - Intergenic
1128073134 15:64809732-64809754 AACTAGAGGGTTAATGAGGCCGG + Intergenic
1128391156 15:67183536-67183558 CAGTAGTGGGAATAGGAGGCAGG + Intronic
1128566642 15:68705112-68705134 CATTACTGGGAGAAGGAGACGGG - Intronic
1129653457 15:77507525-77507547 CAGTAGAGGGACAAGGAAGTGGG + Intergenic
1132034586 15:98471686-98471708 AACTAGAGGGAGAGGGAAACAGG - Intronic
1132535045 16:474631-474653 CAGTAGTGGGAGAAGGAGGGAGG - Intronic
1132610630 16:814208-814230 CAGGAGAGTGGGAAGGAGGCCGG + Intergenic
1132647945 16:1007702-1007724 CAGGAGTGGGAGAAGGATGCGGG - Intergenic
1133559807 16:6940744-6940766 CACTAGCGGGACATGGTGGCGGG - Intronic
1133961260 16:10495550-10495572 AAAAAGAGGGAGAAGGAGGGAGG - Intergenic
1135612466 16:23880369-23880391 AAGGAGGGGGAGAAGGAGGCAGG - Intronic
1136145604 16:28314682-28314704 GATTAGAGGGAGAAGGGGCCAGG + Intronic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137840625 16:51637474-51637496 CAAGAGAGGGAGAAGAAGGAGGG + Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138229007 16:55324297-55324319 GGCAAGAGGGAGAAGGAGGAGGG - Exonic
1138520268 16:57567154-57567176 CGCTATAGGCAGAAGGAGGGAGG + Intronic
1138626980 16:58260229-58260251 CATGAGAGGGAGAAGGGGTCAGG + Intronic
1138862377 16:60774308-60774330 CAAAAGAGGGAGAAAGCGGCCGG + Intergenic
1139015446 16:62684180-62684202 CACTGGAGGGAGACTGAGGAGGG + Intergenic
1139378559 16:66515962-66515984 CACTGGAGGGAGACAGAGGCTGG - Intronic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139515381 16:67449622-67449644 CACTGGAGAGAGTAGGTGGCTGG - Intronic
1139654390 16:68378529-68378551 GACTGCAGGGAGAAGGAGGCAGG - Intronic
1140639569 16:76956640-76956662 TACTGGAGTGAGAAGGAAGCTGG - Intergenic
1141267651 16:82511476-82511498 CACAAGAGGAAGATGTAGGCTGG - Intergenic
1141659718 16:85435428-85435450 CAGTCGAGGGAGAGGGAGGGAGG - Intergenic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142189547 16:88711614-88711636 CCCTAGAGGGAGAAGCAGCAGGG - Exonic
1142703001 17:1675810-1675832 CACCTGTGGGACAAGGAGGCTGG + Exonic
1142756755 17:2021034-2021056 CACGAGATGGAGAAGCAGGGAGG + Intronic
1143684656 17:8504218-8504240 CACAAGGGTGAGAAGAAGGCTGG - Intronic
1143890873 17:10101490-10101512 CACAAGAGTGACCAGGAGGCAGG + Intronic
1144155216 17:12493821-12493843 CACGGGAGAAAGAAGGAGGCCGG - Intergenic
1145733480 17:27211414-27211436 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1145773777 17:27512132-27512154 CACTACAGGGAGAAAGAGCAGGG - Intronic
1145868615 17:28256321-28256343 CGCTGGGGGGAGGAGGAGGCTGG - Intergenic
1145897208 17:28466100-28466122 TCCTGGAGGGAAAAGGAGGCAGG + Intronic
1146238359 17:31188800-31188822 CACAGGAGGAAGATGGAGGCTGG - Intronic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1147164054 17:38584157-38584179 CGATAGAGAGAGACGGAGGCAGG + Intronic
1148618499 17:49017014-49017036 CCCTGTAGGGATAAGGAGGCGGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149013545 17:51882789-51882811 CCCTAGAGAGGGAAGGAGGATGG - Intronic
1149974931 17:61256076-61256098 CAGTAGAGGCTGATGGAGGCTGG - Intronic
1150118050 17:62572254-62572276 CAGTAGAGGAAGAAGGAGAAGGG + Intronic
1151190605 17:72395076-72395098 CAGTAGAGGGAGAAACAGGAAGG + Intergenic
1151200239 17:72462617-72462639 CACGAGGAGGAGAGGGAGGCTGG - Intergenic
1151393080 17:73801087-73801109 CACTGGAGGTGGGAGGAGGCTGG + Intergenic
1151491440 17:74434020-74434042 CCCTGGAGAGAGAAGGAGGGAGG + Intronic
1151759643 17:76093310-76093332 CACTGGAGGGAGAAGGCCCCAGG + Intronic
1151883518 17:76909733-76909755 GAGTAGTGGGAGAAGGAGGCTGG + Intronic
1151997338 17:77618319-77618341 CAACTGGGGGAGAAGGAGGCAGG - Intergenic
1152033765 17:77859268-77859290 GAAGAGAGGGAGAGGGAGGCAGG + Intergenic
1152226452 17:79095056-79095078 CACTTCAGGGAGATGGAGCCGGG + Intronic
1152516120 17:80825914-80825936 AAGTAGACGGAGACGGAGGCTGG + Intronic
1152762877 17:82118584-82118606 CACTCTAGGGAGGTGGAGGCAGG + Intronic
1153475380 18:5493656-5493678 TACTAGAGGGAGTAGGAGAGTGG - Intronic
1154073469 18:11176946-11176968 CAGGAGAGGAGGAAGGAGGCAGG - Intergenic
1154262751 18:12851745-12851767 TACTAGAGGGGGAAGAAGGAAGG - Intronic
1154515324 18:15157905-15157927 TGCTAGAGGGAGAGGAAGGCAGG - Intergenic
1155081856 18:22418356-22418378 CACCAAAGGGATAAGGGGGCAGG - Intergenic
1155108449 18:22689900-22689922 CACTGCAGGGAGCAGGAAGCAGG + Intergenic
1155440448 18:25856641-25856663 CACTAGTGGGAGGAGGAGCAAGG - Intergenic
1155635264 18:27945598-27945620 CATGAGAGGGAAAAGGAGCCTGG + Intergenic
1157244426 18:46040894-46040916 CAGGAGAGGGAGAAGGAGCTGGG + Intronic
1157405565 18:47419762-47419784 CACTAGATGGAGAAGGTGCTGGG + Intergenic
1157558193 18:48627346-48627368 CAATAGAGGGAGAAGGAAATGGG + Intronic
1157591053 18:48836618-48836640 CCCTAGAGGGGCAAGGAAGCAGG + Intronic
1158739198 18:60120364-60120386 CATTAGAGGGAGATGGGGGATGG - Intergenic
1158972986 18:62685703-62685725 AGATAGAGGGAGAAGGAAGCCGG - Intergenic
1159201230 18:65187692-65187714 TGCTAGAGGGAGAGGGAGGGAGG - Intergenic
1159672523 18:71239346-71239368 CACCAGAGGGAGAGCCAGGCAGG + Intergenic
1160401782 18:78616022-78616044 CACTAGAGGGGAAGGGAGGGTGG + Intergenic
1160591308 18:79946073-79946095 GACGAGACGGAGGAGGAGGCGGG + Intronic
1160894160 19:1395000-1395022 CCCTGGACGGAGATGGAGGCAGG - Intronic
1161884350 19:6982280-6982302 TACTAGAGGGAGAGGGTGGGAGG + Intergenic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162126038 19:8499956-8499978 CACTAAATGGAGAAGTAGGGAGG - Intronic
1162343328 19:10105583-10105605 TACAAGAGGGAGAAAGAGACAGG + Intergenic
1162477424 19:10908929-10908951 CAGGAGAGGGAGCAGGAAGCCGG - Intronic
1162797891 19:13096009-13096031 CCCTTGAGGGAGGAGGGGGCTGG - Exonic
1164066272 19:21720372-21720394 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG + Intergenic
1165159196 19:33805876-33805898 CACTCCGGGGAGAAGGAGCCAGG - Intronic
1165761407 19:38323450-38323472 CACTTGAGGCAGGAGGAAGCGGG + Intronic
1165925220 19:39321911-39321933 AACTGGAGCAAGAAGGAGGCAGG - Intergenic
1166197692 19:41217833-41217855 CAGTAGAGGCAGGAGAAGGCAGG + Intergenic
1166384436 19:42372471-42372493 GACTGGAGAGAGAAGGTGGCGGG - Intronic
1166432687 19:42740572-42740594 AACAGGAGGGACAAGGAGGCAGG - Intronic
1166435795 19:42765769-42765791 AACAGGAGGGACAAGGAGGCAGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167693493 19:51001288-51001310 CTCTGGAGGAAGGAGGAGGCTGG + Intronic
925517134 2:4695409-4695431 CAAAAGTGGGAGAAGGGGGCAGG + Intergenic
925589225 2:5493498-5493520 CAAGTGAGGGAGAAGGGGGCCGG - Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
925912385 2:8582362-8582384 CAGTGGAGGGGGAAAGAGGCTGG - Intergenic
926206552 2:10838055-10838077 CACTCCAGGGAGAATAAGGCAGG + Intergenic
926332650 2:11838075-11838097 CACTAAAGGGAGGAGGAGTGGGG + Intergenic
927435392 2:23061841-23061863 CACTAGATAAAGAAGGAGTCAGG + Intergenic
927695481 2:25236830-25236852 CACTAGCTGGAGAAGCAGGCGGG + Intronic
927812364 2:26187265-26187287 CAATAGAGGGAGTAGGTGTCCGG - Exonic
928574684 2:32642912-32642934 CACTTAGGGGAGATGGAGGCAGG - Intronic
928731752 2:34239934-34239956 CAAAAGAGGAAGAAGCAGGCAGG + Intergenic
929066651 2:37982509-37982531 CACCAGAGGGAGGAAGAGACTGG - Intronic
929269490 2:39958228-39958250 CCCTAGAGGGAGAAAGATGGAGG + Intergenic
929275065 2:40016034-40016056 TACTAGAGGGGGAAGGAGGGAGG + Intergenic
929429043 2:41871353-41871375 CACTGGAGGGAGGAGGGGGCTGG - Intergenic
929722004 2:44379068-44379090 GACTAGAGGAAGAAGGAGAATGG - Intronic
930794449 2:55373351-55373373 CACTAGGGGGATGAGGAGGTTGG - Intronic
932806343 2:74786560-74786582 TACTAGAGGGGGAAAGAGTCGGG - Intergenic
932837402 2:75050453-75050475 CTCTGGATGGGGAAGGAGGCGGG - Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
934484916 2:94697649-94697671 CACTTGAGGGAGGATGAGTCTGG + Intergenic
934592002 2:95561993-95562015 CAGTAGAGAGGGAAGGTGGCTGG - Intergenic
934658428 2:96130033-96130055 AAGCAGAGGGAGAAGAAGGCAGG + Intronic
934704116 2:96464374-96464396 CACTGGTGGCAGGAGGAGGCAGG - Intergenic
934731777 2:96663385-96663407 CAGTGGAGGGAGGAGGGGGCAGG + Intergenic
935187321 2:100745879-100745901 CACTGGAAGAAGAAGGAAGCTGG + Intergenic
935347674 2:102123929-102123951 AACAAGAGGGAGAAGGAGAGAGG + Intronic
935601900 2:104930684-104930706 CATTAGATGTACAAGGAGGCAGG + Intergenic
935882917 2:107584355-107584377 CACTGGAGAAAGATGGAGGCCGG + Intergenic
936060616 2:109293470-109293492 CAGTGGAGAGAGAAGGGGGCAGG - Intronic
937155480 2:119715854-119715876 CCCCAGAGGGAGAAGCAGACGGG + Intergenic
938364134 2:130720591-130720613 CACTAGGAGGAGCAGGAGGCAGG + Intergenic
938383321 2:130848636-130848658 CACTGGAGGGAGGAAGAGACAGG - Intronic
938565547 2:132515216-132515238 CACTAGAAGGAGACTTAGGCTGG - Intronic
938823614 2:134982742-134982764 CTCTGGAGTGAGAAGGAGACAGG + Intronic
939587662 2:144025274-144025296 TACTAGGAGTAGAAGGAGGCAGG - Intronic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940283520 2:152011059-152011081 AACTAGAGGGAGACAGAGGTAGG + Intronic
940365405 2:152843497-152843519 CACTATAGAGAGAGGGTGGCAGG - Intergenic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
942318943 2:174718997-174719019 CACTAGAGGAGGGATGAGGCGGG - Intergenic
942494455 2:176525135-176525157 GACTAGAGGGAGCAGCATGCAGG + Intergenic
943489629 2:188534481-188534503 TACCAGAGGGAGAAGGAAGGAGG + Intronic
943513553 2:188856678-188856700 CACGAGAGAAAGATGGAGGCTGG + Intergenic
943931406 2:193858275-193858297 TGCTATAGGGAGAGGGAGGCTGG - Intergenic
944410800 2:199440327-199440349 CCCTGGGGGGAGTAGGAGGCTGG - Intronic
944599042 2:201284649-201284671 CATGAGAGGGAGAGGGAGACGGG + Intronic
944641129 2:201727154-201727176 CACAAGAGGCAGAAAGAGCCAGG + Intronic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
945606833 2:211943652-211943674 AAGTAGAGGGGGAAAGAGGCAGG - Intronic
945970609 2:216227528-216227550 CATGAGAGGGAGAGGGAGACGGG + Intergenic
946389721 2:219408305-219408327 GGCTAGGAGGAGAAGGAGGCTGG - Intergenic
946524676 2:220505546-220505568 CAAGAGAGGGAGAGAGAGGCAGG + Intergenic
946980160 2:225204417-225204439 CATTAAAGGGAGAAGGAAGGAGG - Intergenic
947738656 2:232474463-232474485 CTCCACAGGGAGAAGGAAGCTGG + Intergenic
948601193 2:239108281-239108303 CCCTAGAAGGAGACGGAAGCTGG + Intronic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
1169190910 20:3658803-3658825 CTTTGGAGGAAGAAGGAGGCAGG + Intergenic
1169697831 20:8410935-8410957 CACCAGAGGCTGAAAGAGGCAGG + Intronic
1170204717 20:13785410-13785432 CAGTAGAGGCCGAAAGAGGCAGG - Intronic
1170841613 20:19928765-19928787 CACAAGAGGGAGAGGAAGGCAGG - Intronic
1171079071 20:22159656-22159678 CACTAGAGAGAGAGGGAGGAGGG - Intergenic
1172617389 20:36298292-36298314 CACTAGATGCTGAAGCAGGCAGG + Intergenic
1172699565 20:36844772-36844794 CACTATGGGGAGACCGAGGCGGG + Intronic
1172789514 20:37493141-37493163 CCCTGGTGGGAGAAGGTGGCTGG + Intronic
1173019394 20:39254411-39254433 CACGAGAAGAAGAAGGAGGGAGG - Intergenic
1173338257 20:42130764-42130786 AACTAGAGGGAGCAGGTGGGTGG + Intronic
1173469476 20:43311669-43311691 CACAAAAGAGAGAAGGAGGGGGG + Intergenic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1175065435 20:56282425-56282447 CCCCAGAAGGAGAGGGAGGCTGG - Intergenic
1175183840 20:57166666-57166688 CACTAGAGGCTGGAAGAGGCTGG + Intergenic
1175477112 20:59284567-59284589 CACTGGCTAGAGAAGGAGGCTGG - Intergenic
1176067817 20:63208179-63208201 GACTAGAGGGAGAAGCAGAAAGG + Intronic
1177121109 21:17138113-17138135 TACTAAAGGGAGGAGGAGGAAGG + Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1179008825 21:37537578-37537600 CCCTGGAGTGAGCAGGAGGCTGG - Intergenic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179179959 21:39036508-39036530 CACTAGAAGGTGGAGGAGGTAGG + Intergenic
1179482111 21:41685117-41685139 TACAAGAGGGAGATGGAGGGAGG - Intergenic
1179521215 21:41946474-41946496 CAGGAGGGGGAGAAAGAGGCGGG - Intronic
1179791641 21:43759339-43759361 AACTAAAGAGAGAATGAGGCTGG - Exonic
1180629752 22:17220232-17220254 CAGTAGAGGGGGCAGGAGGTAGG + Intronic
1181277101 22:21694161-21694183 GACTAGAGGGTGAAGGGAGCTGG - Intronic
1181431095 22:22882387-22882409 CAGTAGAGGGAGGAGGAGCCTGG - Intronic
1181463412 22:23098338-23098360 CACTAGATGGAGGAGTAAGCAGG - Intronic
1181821950 22:25483332-25483354 CAGGAGAGGGAGCAGCAGGCTGG - Intergenic
1181829488 22:25548353-25548375 TAAAAGAGGGAGAAGGAGGGAGG + Intergenic
1183068334 22:35379185-35379207 CACTGGAGAGAGAAAGAGACTGG + Intergenic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1183871892 22:40746367-40746389 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1184061098 22:42082081-42082103 CCCTAGATGGAGCAGGAAGCAGG + Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
950122750 3:10492678-10492700 CCCCAGAGGGAGAAGGAAGCGGG - Intronic
950158804 3:10743635-10743657 CCCTAGAGGGAGACTGAGGCTGG + Intergenic
950358200 3:12429419-12429441 CTCAAGAGGAAGGAGGAGGCTGG + Intronic
951636716 3:24786814-24786836 CAGTAAAGGGAGAAGGAAACAGG - Intergenic
951802822 3:26615380-26615402 AGTTAGAGGGAGAAGGAGGAGGG + Intergenic
952224176 3:31357240-31357262 CACAAGAGGGTGATGAAGGCTGG + Intergenic
953666061 3:44927497-44927519 CACCAGAGGAGGAAGGAGGAGGG + Intronic
954431143 3:50471441-50471463 CAGAAGAGGAAGAAGGAAGCTGG - Intronic
954911460 3:54114263-54114285 AACTCCAAGGAGAAGGAGGCTGG + Intergenic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955641402 3:61089386-61089408 CACTGGAGGAAGAAGGAATCGGG - Intronic
956068835 3:65426047-65426069 CAGCAGAGGGAGAAGGAGTAAGG + Intronic
957305343 3:78450831-78450853 CAAGAGAGGGAGAAGGTGTCAGG + Intergenic
957595779 3:82263803-82263825 GACTAGAAGGAGGAGGAGGGAGG + Intergenic
959144938 3:102533183-102533205 GACTACATGGAGAAGGAGGGAGG - Intergenic
959226463 3:103594693-103594715 CACGAGAGGAAGATGTAGGCTGG + Intergenic
959252422 3:103965661-103965683 CACTCCAGGGAGAAGAAGGCAGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
960052819 3:113254088-113254110 CACCAGAGGAAGAAGCAGCCAGG - Intronic
960088599 3:113616308-113616330 CATTAGTGGGAGAAGGAGCATGG + Intronic
960389513 3:117059550-117059572 CACTTGAGGGAGATGTGGGCAGG + Intronic
961058389 3:123808125-123808147 CAGTGAAGGGTGAAGGAGGCTGG - Intronic
961284646 3:125791314-125791336 GTCTAGAGGGATGAGGAGGCAGG + Intergenic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961959673 3:130841705-130841727 CTCTGCAGGGAGAAGGAAGCAGG + Intergenic
963538012 3:146552384-146552406 CACTTAATGGAGAAGGAGGCTGG + Intergenic
964074497 3:152676770-152676792 AACTAGAGGGAGAATGATGGTGG + Intergenic
964213653 3:154255352-154255374 TACGAGATGGAGAAAGAGGCTGG + Exonic
964667409 3:159189511-159189533 CACTAGAGGGAGATGGTGACAGG + Intronic
964699240 3:159545408-159545430 CACTAGAGAAAGATGTAGGCTGG - Intronic
965614991 3:170585067-170585089 CACAGGAGAGAGAAGGAGGGTGG + Intronic
966111103 3:176402530-176402552 CACTGGAGGGAGAAGGTTGATGG + Intergenic
966449797 3:180045236-180045258 CACTTGAAGGAGAAGAAGGAAGG - Intergenic
967280448 3:187817407-187817429 TACTAGAGGGGAAAGGAGGGGGG - Intergenic
967822967 3:193855264-193855286 CAATAGTGGGAGAAGGATGCAGG - Intergenic
967942509 3:194777052-194777074 CACTGGAGGGAGAGGGCTGCGGG + Intergenic
968609593 4:1551026-1551048 CGCTAGAGGGAAACTGAGGCTGG + Intergenic
968808520 4:2789801-2789823 CAGGAGAGGGAGGATGAGGCAGG + Intergenic
969268147 4:6079404-6079426 AGGTAGAGGGAGATGGAGGCAGG + Intronic
969699575 4:8760798-8760820 CACCACAGGGAGAAGCAGGGAGG - Intergenic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970293862 4:14606667-14606689 CACTTGAGGGAGGAGGTTGCCGG + Intergenic
970320183 4:14867800-14867822 TACTAGAGGGAGAAGGTGGAAGG + Intergenic
970570742 4:17379885-17379907 CGCTAGAGGGAGAGGGAGTCTGG - Intergenic
970641884 4:18075975-18075997 CACTAGAGGGAGACTGAGCGTGG + Intergenic
971501805 4:27326294-27326316 CTCAAGAGGGGGAAGGAGGGAGG + Intergenic
973000566 4:44943854-44943876 GACTTGAGGTAGAACGAGGCTGG + Intergenic
973548801 4:52010477-52010499 CACTAGAAGGAGGAGGAGTGTGG - Intronic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
977186201 4:93940405-93940427 TACTAGAGGGTGAAGGAAGGTGG - Intergenic
977319329 4:95491576-95491598 CACTAGCGGGTGAAGGAATCAGG - Intronic
978833337 4:113116322-113116344 CAAAAGAGGGAGAGGAAGGCAGG - Intronic
978872307 4:113594125-113594147 AACAAGAGAGAGAAGGAGGAAGG + Intronic
979185485 4:117786289-117786311 TACTAAAGGGAGAGGGAGGAAGG - Intergenic
979302790 4:119106694-119106716 CACTAGGAGGAGAAGGATGGAGG - Intergenic
979551172 4:121992537-121992559 CACAAGAGGGAGAAGGAAGGTGG - Intergenic
979676935 4:123419784-123419806 CACTAGAGGTGGAAGGATGATGG + Intergenic
981360925 4:143844876-143844898 AACTAGAGGGATAAGAAAGCTGG - Intergenic
981371663 4:143965867-143965889 AACTAGAGGGATAAGAAAGCTGG - Intergenic
981471001 4:145134778-145134800 CACCAAAGGGAAAAGGGGGCTGG + Exonic
981653083 4:147081078-147081100 AAGTAGAGGGATGAGGAGGCTGG - Intergenic
981729765 4:147885065-147885087 CAGTAGAGGGTGAAGGAGTGGGG + Intronic
981846186 4:149172632-149172654 CACTAGAGAGAGATGGAACCTGG - Intergenic
982264068 4:153522406-153522428 CACTAGGGGAAGGAGGAGACCGG + Intronic
982277139 4:153647561-153647583 CACTCAAGGGGGAAGGAGGCTGG + Intergenic
982893851 4:160891728-160891750 TACTAGAGGGAGAGGAAGGAAGG + Intergenic
983493701 4:168418803-168418825 AGCTAGAGGGCTAAGGAGGCTGG - Intronic
983698319 4:170560030-170560052 CTCTTGAGGAAAAAGGAGGCTGG + Intergenic
984718912 4:182952281-182952303 CAATAGAGGGAGAGCGTGGCAGG - Intergenic
984730049 4:183059651-183059673 CTCTAGTGGGAGAGGGAGTCGGG - Intergenic
984831247 4:183976548-183976570 TACTAGAGGGGGAGGGAGGGAGG + Intronic
984881812 4:184416204-184416226 TACTAGAGGGAGGCTGAGGCGGG + Intronic
984916968 4:184733857-184733879 CACTAGACTGAGGAGGAAGCCGG + Intronic
985548271 5:520741-520763 CCCTGGAAGGAGAGGGAGGCGGG - Intronic
986253214 5:6080147-6080169 CACTCCAGGCAGAAGGAGGTGGG + Intergenic
986428412 5:7657260-7657282 CACTGGAGGGCTGAGGAGGCAGG + Intronic
986454162 5:7899042-7899064 CAAGAGAGGGAGCAAGAGGCAGG + Intronic
986719294 5:10549633-10549655 CACCAGAGGCTGGAGGAGGCAGG - Intergenic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988437279 5:31191149-31191171 GACTGGAGGATGAAGGAGGCAGG + Intergenic
989633960 5:43514986-43515008 CCCTAGAGGAATAAGGTGGCAGG + Exonic
990740250 5:58905149-58905171 CACTGGAGGGAGAAAGTAGCTGG - Intergenic
991965433 5:72086019-72086041 CACTAGAAAGAGAAAGAGCCTGG + Intergenic
993302277 5:86225956-86225978 AAGTAGGGGGATAAGGAGGCAGG + Intergenic
994228045 5:97276971-97276993 CACTGGATTGAGAAGCAGGCAGG - Intergenic
994845047 5:104977978-104978000 CACTTGAGAGTGAAAGAGGCTGG + Intergenic
995438161 5:112160685-112160707 CACCAAAGGGAGGAGGAGCCTGG - Intronic
995541391 5:113189674-113189696 CACTTGAGCAAGCAGGAGGCTGG + Intronic
996016346 5:118538145-118538167 CACAGGAGGAAGATGGAGGCTGG + Intergenic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
996899982 5:128533497-128533519 TACCAGAGGGAGAGGGAGACAGG + Intronic
997308804 5:132862282-132862304 CACTAAAGGTTGAAGGAGGCTGG + Exonic
997580871 5:135016098-135016120 CACTGGAGAGAGAAGAAGTCAGG - Intergenic
999157892 5:149471606-149471628 CACTAGAGAGAAGAGGAGGGAGG + Intergenic
999658768 5:153836301-153836323 CACAAGAGACAGAAGGAAGCTGG - Intergenic
999973871 5:156891752-156891774 CATCATAGGGAGAATGAGGCTGG - Intergenic
1000040278 5:157480120-157480142 CATTAGAGGGAGAATGAGAGGGG + Exonic
1001574751 5:172755954-172755976 TACAAGAGGGAGAGGGAGGAAGG + Intergenic
1001959401 5:175871325-175871347 GAATGGAGGGAGAAGGAGACGGG + Intronic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002298099 5:178242288-178242310 GAGGAGAGGGGGAAGGAGGCAGG - Intronic
1002434884 5:179225154-179225176 CATGAGAGGGAGGAGGAGCCTGG - Intronic
1002568690 5:180128222-180128244 CACCCCAGGGAGAGGGAGGCTGG - Intronic
1003178400 6:3771436-3771458 CACTAGGGGCAGAAAGAAGCCGG - Intergenic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1004340809 6:14805892-14805914 AACTAGAAGAAGAAGGGGGCAGG + Intergenic
1004889762 6:20089350-20089372 CACTGGAGAGAAGAGGAGGCTGG - Intergenic
1005837032 6:29717921-29717943 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006388646 6:33746263-33746285 CACGGGAGGGGGCAGGAGGCCGG - Intronic
1006517494 6:34553042-34553064 AGCTAGAGGGAGAAGGAGGGGGG + Intronic
1007239784 6:40416725-40416747 CCCTAGCAGGAGAAGGAGGAAGG - Intronic
1007449516 6:41932340-41932362 CACTAGTGGGAAAGGGAGGTGGG - Exonic
1008010879 6:46466449-46466471 CACTAGAAGTCCAAGGAGGCAGG + Intronic
1008926785 6:56895989-56896011 CATGAGAGGGAGAGGGAGACGGG + Intronic
1009519483 6:64663657-64663679 CACTAAGGGGAGAAGTTGGCTGG - Intronic
1009972599 6:70640913-70640935 CAGTAGAGGGGTAAGGAGGCAGG - Intergenic
1010198737 6:73264434-73264456 CAGTACAGGAACAAGGAGGCAGG + Intronic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1011502540 6:88006922-88006944 CCCTGGAGGGAGGAGGAGCCTGG - Intergenic
1012728620 6:102850077-102850099 CACTAGAGGGAGGCCTAGGCGGG + Intergenic
1012839894 6:104316853-104316875 CACTTGAGGTAGAATGAGGTGGG + Intergenic
1014391516 6:120871724-120871746 AAGTAGAGTGGGAAGGAGGCTGG + Intergenic
1014422158 6:121260000-121260022 GCCTAGTGGGAGAAGAAGGCTGG - Intronic
1014764408 6:125390099-125390121 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1016740588 6:147524634-147524656 CTCCACAGGGAGAAGGAGGTAGG - Intronic
1017586939 6:155936875-155936897 AAATAGAGAGAGAAGGAGGAGGG + Intergenic
1018800334 6:167217223-167217245 CATTAGGGAGAGAAGGAAGCTGG - Intergenic
1018812764 6:167309284-167309306 CACTAGGAAGAGAAGGAAGCTGG + Intronic
1019764911 7:2843396-2843418 CACTTGAGGGAGACCAAGGCAGG + Intronic
1019853672 7:3583820-3583842 CACTGGAGAAAGAAGGTGGCAGG + Intronic
1021085483 7:16417630-16417652 CACTAGAGGGAGGAGGGAGGGGG + Intronic
1021659426 7:22905037-22905059 AACAAGAGAGAGAAGGAGGGAGG + Intergenic
1021842171 7:24729657-24729679 GACTGGAGGTAGAAGGAGCCTGG + Intronic
1022443691 7:30453039-30453061 CACTGGAGGGAGGGGGTGGCAGG + Exonic
1023253308 7:38288789-38288811 CACTAGAGTGAGGAAGAGGAAGG - Intergenic
1024431381 7:49291981-49292003 CACGAGAGGGAGATGAAGGCTGG + Intergenic
1025065940 7:55856146-55856168 TACTAGAGGGTGAGGGAGGGAGG - Intronic
1026597090 7:71742475-71742497 TACTAGAGGGGGAGGGAGGGAGG - Intergenic
1027565306 7:79784590-79784612 TTCTAGAGGGAGATAGAGGCTGG - Intergenic
1027785667 7:82576356-82576378 CTCAAGAGGGAGACTGAGGCGGG - Intergenic
1027807864 7:82852451-82852473 CACTAGAGAAAGATGAAGGCCGG - Intronic
1028121461 7:87059842-87059864 CGCTAGAGGGCGAGAGAGGCTGG + Intergenic
1028623038 7:92845549-92845571 CCCTTGAAGGTGAAGGAGGCTGG - Intergenic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029543093 7:101196099-101196121 CACTGCAGGGAGAGGGAGACAGG + Exonic
1029599123 7:101553571-101553593 CAAGAGAGTGAGAAGGTGGCTGG + Intronic
1029737379 7:102472392-102472414 CTCTAGTGGGAGAAGGTGTCTGG + Intronic
1029860326 7:103564541-103564563 CACTTGAGGCAGAAAGAGGGGGG + Intronic
1030014998 7:105210382-105210404 CAAGAGAGGAAGAAGGAGGGAGG - Intronic
1030188822 7:106790725-106790747 CTCTAGGAGGAGGAGGAGGCTGG - Intergenic
1031537149 7:122948959-122948981 AACAAGAGGGAGAGGGAGGGAGG - Intergenic
1032548482 7:132762862-132762884 CAGTAGAGGAAGAAGATGGCAGG - Intergenic
1033068526 7:138179994-138180016 GACAAGTAGGAGAAGGAGGCTGG - Intergenic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033498876 7:141927428-141927450 CAATAAAGGGAGAAGGATGAAGG + Exonic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1034238215 7:149589278-149589300 CACTGGAGGAAGAAGGATGCTGG - Intergenic
1034724668 7:153324499-153324521 CCATAGAGGGGGAGGGAGGCAGG - Intergenic
1034995293 7:155573115-155573137 CACTTGAGGGAGGCCGAGGCAGG + Intergenic
1035321267 7:158030693-158030715 CACCAGAGGCTGGAGGAGGCAGG + Intronic
1035907434 8:3528396-3528418 CACTCGTGGGGGAAGGAGGATGG + Intronic
1035945518 8:3957129-3957151 AAGTAGGGGGAGAAAGAGGCAGG - Intronic
1036116784 8:5967697-5967719 CACTTGAAGGAGAAAGAGGAGGG - Intergenic
1036628905 8:10496598-10496620 ACCTGGAGGGAGGAGGAGGCTGG + Intergenic
1037951279 8:23019888-23019910 CCCCAGAGGGAGGAGCAGGCAGG + Intronic
1038998959 8:32958355-32958377 TACTAGAGGGAAAAGGATGGGGG - Intergenic
1039345371 8:36698122-36698144 CACTAGTAGGAGAAAGAGGCGGG + Intergenic
1039583333 8:38684743-38684765 CACTAGAAAGAGAAAGAGGTTGG - Intergenic
1039918238 8:41875318-41875340 AACTGGAGGCAGGAGGAGGCAGG + Intronic
1039938271 8:42066940-42066962 AAGTGGTGGGAGAAGGAGGCAGG + Intergenic
1040300129 8:46183651-46183673 CACCAGAGGGACATAGAGGCAGG - Intergenic
1040363268 8:46687575-46687597 TACTAGAGGGTGAGGGAGGGAGG + Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1044928305 8:97228098-97228120 CACTCAAGGGAGAAGAAGGTGGG + Intergenic
1046324311 8:112620725-112620747 CACAAGATGCAGTAGGAGGCGGG - Intronic
1047401820 8:124554595-124554617 GACTTGAGGATGAAGGAGGCAGG + Intronic
1048178348 8:132172692-132172714 CCCTGGAGGGAGAGGCAGGCAGG + Exonic
1048284448 8:133130913-133130935 CACTGGAGGAAGAAAGAGGAGGG + Intronic
1049288502 8:141789351-141789373 CCCCAGAGGGGGATGGAGGCTGG + Intergenic
1049416762 8:142498948-142498970 CAAGAGAGGGAGAGAGAGGCTGG - Intronic
1050937827 9:11421176-11421198 CACTAGCAAGAGAAGGAGGTAGG + Intergenic
1051567967 9:18522137-18522159 TACTAGAGGGAGGAGGAGAGAGG + Intronic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053024708 9:34720066-34720088 CACTAGGAGGAGGAGGTGGCAGG - Intergenic
1053277140 9:36791639-36791661 CACTAGAGAGAAAAGGTGCCAGG - Intergenic
1053653403 9:40191845-40191867 CACTAGAGATAGAAGCAGGCTGG - Intergenic
1053672879 9:40386714-40386736 CACTTGAGGGAGGATGAGTCTGG - Intergenic
1053903805 9:42821135-42821157 CACTAGAGATAGAAGCAGGCTGG - Intergenic
1053922693 9:43013095-43013117 CACTTGAGGGAGGATGAGTCTGG - Intergenic
1054383990 9:64526778-64526800 CACTTGAGGGAGGATGAGTCTGG - Intergenic
1054511746 9:65989569-65989591 CACTTGAGGGAGGATGAGTCTGG + Intergenic
1054531181 9:66184373-66184395 CACTAGAGATAGAAGCAGGCTGG + Intergenic
1054999065 9:71427751-71427773 TAGTAGAGGGAGGAGGAGGCAGG + Intronic
1056507978 9:87275406-87275428 CACTAGAGCAGGAGGGAGGCAGG + Intergenic
1056554455 9:87677158-87677180 CAATAAATGGAGAAGGAGGGAGG - Intronic
1057851936 9:98572668-98572690 CCTGAGAGTGAGAAGGAGGCAGG + Intronic
1057897479 9:98921391-98921413 GACTAGAGGGGGAAAAAGGCCGG - Intergenic
1058060225 9:100487462-100487484 CTTTAGAGAGAGAAGGAGGCTGG - Intronic
1058646390 9:107135132-107135154 CACTAGATGGGGAGGGAGGTAGG - Intergenic
1059058821 9:111014018-111014040 GAATGGAGGGAGCAGGAGGCTGG - Intronic
1059094503 9:111398562-111398584 TACAAGAGGGAGCAGGCGGCAGG + Intronic
1060469750 9:123938627-123938649 CACGTGAGGGAGAAGCAAGCAGG - Intergenic
1061905442 9:133694373-133694395 TGCGAGAGGGAGAAGGAAGCCGG + Intronic
1062070395 9:134552325-134552347 CGCTAGAGGGGGAACGAGGGAGG + Intergenic
1062083473 9:134636703-134636725 TGCTAGAGGGACAAGGAGACAGG + Intergenic
1062371661 9:136242398-136242420 GACCAGTGGGAGAAGGCGGCTGG + Intronic
1185673640 X:1831190-1831212 CCCTGGAGGCAGGAGGAGGCAGG + Intergenic
1185957695 X:4510005-4510027 TATTAGAGGGAGAGGGAGGGGGG - Intergenic
1187131371 X:16506409-16506431 CACTTGAGGGGCAAGGAAGCTGG - Intergenic
1187210237 X:17223094-17223116 AACTTGAGGGAGAAAGTGGCAGG - Intergenic
1187492035 X:19761135-19761157 CAGGAGAGGGAGAAGGAGAGAGG + Intronic
1187719690 X:22137967-22137989 CACTAGAGGGATGAGGGAGCGGG - Intronic
1187778175 X:22787466-22787488 TACTAGAGGGTGGAGGAGGGGGG + Intergenic
1188392708 X:29640784-29640806 CACTATTGGGAAAAGGAAGCAGG - Intronic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1188481063 X:30637483-30637505 CTCTAGAGGGAGATGTAGACAGG - Intergenic
1188676098 X:32941647-32941669 TACTAGAAGGGGAAGGAGGGAGG + Intronic
1188781111 X:34286558-34286580 CACTGAAGAAAGAAGGAGGCTGG + Intergenic
1190178069 X:48167747-48167769 CACCAGAGGGAGAAGGTGCCAGG + Intergenic
1190180080 X:48184680-48184702 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190184034 X:48219391-48219413 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190189961 X:48268840-48268862 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190193097 X:48293900-48293922 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190197188 X:48329533-48329555 CACCAGAGGGAGAGGGTGCCAGG + Intergenic
1190199070 X:48344879-48344901 CACCAGAGGGAGAGGGTGCCTGG - Intergenic
1190204895 X:48394778-48394800 CACCAGAGGGAGAGGGTGCCTGG + Intergenic
1190205641 X:48400625-48400647 CACCAGAGGGAGAGGGTGCCTGG - Intergenic
1190659602 X:52642513-52642535 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190663925 X:52679911-52679933 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190665829 X:52695349-52695371 CACCAGAGGGAGAGGGTGCCTGG - Intronic
1190673589 X:52763061-52763083 CACCAGAGGGAGAGGGTGCCTGG + Intronic
1190675497 X:52778511-52778533 CACCAGAGGGAGAGGGTGCCAGG - Intronic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190726787 X:53195117-53195139 CACCAGGGAGGGAAGGAGGCGGG - Intronic
1192432830 X:71124307-71124329 CATCAAAGGGAGAGGGAGGCCGG - Exonic
1192800666 X:74462055-74462077 CACTGGAGGGAAGAGGAGGCAGG - Intronic
1193333975 X:80265700-80265722 CCCTAGAGAGTGAAAGAGGCTGG - Intergenic
1193568524 X:83111303-83111325 CACAAGAGAAAGATGGAGGCCGG + Intergenic
1195701867 X:107711769-107711791 CTCTGGAGGGCCAAGGAGGCAGG + Intergenic
1196028149 X:111064444-111064466 TACTAGAGGGGGAGGGAGGGAGG - Intronic
1196035157 X:111135995-111136017 CACTTTAGGTAGAAGGTGGCAGG + Intronic
1196124222 X:112082347-112082369 AAGGAGAGGGAGAAGGAGGGAGG + Exonic
1198052653 X:132963672-132963694 CACTAGAGAGACATGGAGGGAGG - Intergenic
1198448619 X:136743655-136743677 CACGAGTTGAAGAAGGAGGCTGG - Exonic
1198546861 X:137701579-137701601 CACTAGAGGGGGAAATTGGCTGG + Intergenic
1198758669 X:140008160-140008182 CACTAGAGGGTGAGGGAGAAGGG - Intergenic
1201065783 Y:10092837-10092859 GACTAGAGGGGGAAAGAGGGAGG + Intergenic
1201480971 Y:14439174-14439196 CACTGGAGGAAGATGTAGGCTGG + Intergenic
1201741124 Y:17325531-17325553 GAATAGAGGGAGAGGGAGGGAGG + Intergenic
1201909424 Y:19119322-19119344 CACCAGAGGCAGAATGAAGCTGG - Intergenic