ID: 1106692423

View in Genome Browser
Species Human (GRCh38)
Location 13:32132605-32132627
Sequence CAAATGGTACAGCTTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106692418_1106692423 0 Left 1106692418 13:32132582-32132604 CCACTTTGGCACAGCCTGTGCCA 0: 1
1: 0
2: 1
3: 21
4: 205
Right 1106692423 13:32132605-32132627 CAAATGGTACAGCTTGGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106692423 Original CRISPR CAAATGGTACAGCTTGGCCC TGG Intronic
902692416 1:18118147-18118169 CAAAGGGAACAGCTTGGCAAAGG - Intronic
907929818 1:58988928-58988950 CAAAGGGAACAGCATGTCCCAGG - Intergenic
916146321 1:161743378-161743400 AAACTGATACAGCATGGCCCAGG + Intergenic
919775622 1:201192319-201192341 AAAATGGAACCGCTTGGCCATGG + Intronic
924740254 1:246790671-246790693 CAAATGCTGCAGCTTTGTCCTGG + Intergenic
924773022 1:247092757-247092779 CAAGTGTTACAGCCTAGCCCGGG - Intergenic
1064893834 10:20210967-20210989 AAACTGTTACAGCATGGCCCAGG + Intronic
1068831208 10:61497346-61497368 CAAGTGGAACAGTTTTGCCCAGG + Intergenic
1070108365 10:73458772-73458794 AAAATGGTACAGCTAAGGCCGGG + Intronic
1072636670 10:97182762-97182784 CAGATGGACCAGCTTGTCCCTGG - Intronic
1073855622 10:107670058-107670080 CAAATGTTACAGCTGGAACCTGG - Intergenic
1075712338 10:124537430-124537452 CCAATGGCACAGCTTGCTCCGGG - Intronic
1075942553 10:126404052-126404074 CAAATGGGCCTGCCTGGCCCTGG + Intergenic
1078129122 11:8597593-8597615 CAATTAGTACAGTTTGTCCCAGG + Intergenic
1080282587 11:30575569-30575591 CAAAAGGCACAGCTTGGGCTGGG - Intronic
1084620289 11:70265313-70265335 AAAATGGTAGCTCTTGGCCCTGG + Intergenic
1089494908 11:118902987-118903009 CACCTGGTCAAGCTTGGCCCGGG + Exonic
1096574868 12:52546420-52546442 CAGCTCGTCCAGCTTGGCCCGGG + Exonic
1096787047 12:54023021-54023043 CAAGTGGCCCTGCTTGGCCCAGG - Intronic
1100278513 12:93095021-93095043 CAAAGGGAACACCTTGTCCCTGG + Intergenic
1102228114 12:111243695-111243717 CAACTGTCACAGCTTGGCCCTGG + Intronic
1104525840 12:129520624-129520646 AAAATGGTGAAGCTTGGTCCAGG - Intronic
1106692423 13:32132605-32132627 CAAATGGTACAGCTTGGCCCTGG + Intronic
1107986313 13:45779562-45779584 CAAATGGCAGAGCTGGGCCTGGG - Exonic
1112744192 13:102508703-102508725 GCCAAGGTACAGCTTGGCCCAGG + Intergenic
1113797497 13:113066869-113066891 CAAAAGGACCAGCTTGGTCCAGG - Intronic
1117099280 14:52329945-52329967 TAAATGGTTCAGTGTGGCCCTGG + Intergenic
1118329738 14:64805984-64806006 GAACTGGTACAGCATGGGCCAGG - Intronic
1118577795 14:67260995-67261017 TAAATGGCACAGCTAGGGCCTGG - Intronic
1119035695 14:71228739-71228761 CAAAAGCTACAGCTGGGGCCAGG - Intergenic
1121427165 14:93860546-93860568 CCAATGGTACAGCAGGGCCTGGG - Intergenic
1121912003 14:97800224-97800246 CATCTGCTACAGGTTGGCCCCGG + Intergenic
1122099360 14:99394874-99394896 CAAAAGGCACAGCTAGGGCCAGG - Intergenic
1122175261 14:99912966-99912988 CAAATGCTGCAGCTTGACCCTGG - Intronic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1124847442 15:33305490-33305512 CAAATGGTAGACTTTTGCCCAGG + Intergenic
1125761839 15:42101913-42101935 GAAAAGATACAGCTTGACCCTGG + Intergenic
1127425918 15:58856425-58856447 TAAAAGATACAGCTTGACCCTGG - Exonic
1131141562 15:89980656-89980678 CAAATGAAACAGCTTTTCCCAGG + Intergenic
1133202901 16:4215319-4215341 CCACTGGGACAGCTTGTCCCTGG + Intronic
1133800426 16:9080809-9080831 CAAAAGGTAGATCCTGGCCCGGG + Intergenic
1139431977 16:66915595-66915617 GAAATGGTACAGGATGGGCCAGG + Intronic
1141603023 16:85137620-85137642 CACATGGGGCAGCTTCGCCCGGG - Intergenic
1142616230 17:1137335-1137357 GAAATGGTTCAGTTTAGCCCGGG - Intronic
1143204814 17:5134169-5134191 CACATGTTCCAGCCTGGCCCAGG - Intronic
1144875861 17:18396847-18396869 CACATGTTCCAGCCTGGCCCAGG - Intergenic
1145156368 17:20547573-20547595 CACATGTTCCAGCCTGGCCCAGG + Intergenic
1145250339 17:21293800-21293822 CAGATGGCACAGCCTGGGCCTGG + Intronic
1147179656 17:38676231-38676253 CAAATGATGCAGCTTGCCTCCGG + Intergenic
1147746323 17:42697065-42697087 CAAATCCTACATCTAGGCCCAGG + Intronic
1149650977 17:58276330-58276352 CCAATGGTGCAGCCTGCCCCAGG + Intronic
1150946894 17:69757186-69757208 ACAATGGTACAGCTTGTACCTGG + Intergenic
1157404760 18:47413629-47413651 CAAAAGGAACAGCATGGGCCAGG - Intergenic
1158230893 18:55253837-55253859 CAAATTGTACACTTTGGCCAGGG + Intronic
1158719902 18:59915509-59915531 CAAATGATAGACCTTGGGCCAGG - Intergenic
1159892351 18:73964557-73964579 TACATGGAACAGCTGGGCCCTGG + Intergenic
1163698817 19:18777129-18777151 CAAAAGGCACTGCTTAGCCCTGG - Intronic
1164837978 19:31370483-31370505 GGAATGGTACAGTTTGCCCCTGG - Intergenic
926045884 2:9709374-9709396 AAAATGAAGCAGCTTGGCCCAGG + Intergenic
927799470 2:26084645-26084667 CCATTGGTACAGTTTGGCCAAGG + Intronic
928298641 2:30106810-30106832 AAAATGGTACAGTTAGGGCCGGG + Intergenic
929574409 2:43042940-43042962 CAAATTCCACAGCCTGGCCCCGG - Intergenic
931378314 2:61728234-61728256 CATGTGGTACAGCTTGTTCCTGG - Intergenic
933326963 2:80850153-80850175 CTCATTGTTCAGCTTGGCCCCGG + Intergenic
934897795 2:98133546-98133568 CAAATGGTATTTCTTGGTCCTGG - Intronic
935485307 2:103646210-103646232 CACATGCTACAGCTTGGCATAGG - Intergenic
936949918 2:117967425-117967447 AAAATGGTGCAGCTCAGCCCAGG - Intronic
938553428 2:132401617-132401639 CAAAGGGTACAGCTTCTTCCTGG - Intergenic
938710253 2:133970596-133970618 AAAATGGTCAAGCTTGGGCCTGG - Intergenic
940275592 2:151937278-151937300 CCAATGGTAGAGCTTGACCCTGG - Intronic
941281419 2:163556364-163556386 AACATGGTACAGATTGGCCTTGG - Intergenic
946389730 2:219408333-219408355 CAAATAGGACAGCTCAGCCCAGG - Intergenic
1169125212 20:3122314-3122336 CAGATGGCTCAGCTGGGCCCAGG + Exonic
1169150932 20:3288791-3288813 CAGCTGGAACAGGTTGGCCCAGG - Intronic
1172293519 20:33792279-33792301 AAACTGCCACAGCTTGGCCCAGG - Intergenic
1173192794 20:40888861-40888883 CAAATGGAACAGCAAGGCACTGG + Intergenic
1174163845 20:48570772-48570794 CAAAGGGCACACCTTGGCCTGGG + Intergenic
1176070419 20:63223347-63223369 CAGAGGGAACAGCGTGGCCCTGG - Intergenic
1176919895 21:14675688-14675710 TAAATGGCCCAGCTTGGCACTGG + Intergenic
1179355250 21:40652856-40652878 CAACTGACACAGCGTGGCCCAGG - Intronic
1180867744 22:19129097-19129119 CAGATGTGACATCTTGGCCCTGG - Intergenic
1182089156 22:27582277-27582299 CAAACAGTACAGCTTGGCCTAGG + Intergenic
1183524416 22:38315134-38315156 CAGATGGTACAGCCTCGCCGAGG + Intronic
1184559559 22:45254163-45254185 AAAATGGTGCAGTTTGGGCCGGG + Intergenic
1184964943 22:47964821-47964843 CAAAATGCACAGCTTGGCCGAGG + Intergenic
950168312 3:10817698-10817720 AGAAGGGTACTGCTTGGCCCAGG + Intronic
950575571 3:13830209-13830231 CACATGGTAAAGGTGGGCCCCGG + Intronic
952591263 3:34957097-34957119 CAAATGATACATTTTGGCCTTGG + Intergenic
964212448 3:154243500-154243522 CAAATGCTACAGAATGTCCCAGG - Intronic
968705111 4:2074030-2074052 CCAATGGTCCAGCTTGGCCTGGG - Intronic
973924712 4:55725795-55725817 CAAAAGCCACAGCTTTGCCCTGG + Intergenic
987032209 5:13986414-13986436 TGATTGGTCCAGCTTGGCCCGGG - Intergenic
987069264 5:14320563-14320585 AAAATGGTCCAACATGGCCCTGG - Intronic
989223852 5:39002981-39003003 CAAATGGTACAGCTTGAAAAAGG - Intronic
990345045 5:54863520-54863542 CAAAGGGAACAGCATGGCCAAGG - Intergenic
990682913 5:58265679-58265701 CAAATGTTACAGCATTGCCCAGG - Intergenic
991725903 5:69535829-69535851 AAAATGGTACATCTTGGCGGGGG + Intronic
991869052 5:71092026-71092048 AAAATGGTACATCTTGGCCGGGG - Intergenic
995411519 5:111862565-111862587 AAAAAGATACAGCATGGCCCAGG - Intronic
998218099 5:140252805-140252827 AAAATGGGACAGCATGGCCACGG + Intronic
999647709 5:153735521-153735543 CCAATGCTACACCCTGGCCCTGG - Intronic
1001690632 5:173629975-173629997 CCTATGGCACAGCTTGGACCAGG - Intergenic
1007373088 6:41439626-41439648 CAAAGGGTTCAGCCTGGGCCAGG - Intergenic
1010050700 6:71500650-71500672 CAAATGGTACTCCCTGGGCCTGG + Intergenic
1014203860 6:118633675-118633697 CAAATAGTACAGATTGGCACTGG - Intronic
1026465606 7:70651253-70651275 TAAATGGTAAAGCTGGACCCAGG + Intronic
1029187880 7:98752583-98752605 AAAATGGTACAGTTTGGGCCGGG + Intergenic
1031754472 7:125620558-125620580 TAAATGGTTCAGCTTGGACTGGG + Intergenic
1032069614 7:128795688-128795710 TAAGTGGTATAGCTGGGCCCAGG - Intronic
1032698228 7:134356210-134356232 CTAAGAGTGCAGCTTGGCCCAGG - Intergenic
1033182945 7:139198672-139198694 CAAATGGTACATTGTGGCCACGG - Intergenic
1034198226 7:149264074-149264096 CAAAAGGGACAGATTTGCCCTGG + Intronic
1037579586 8:20236633-20236655 CCCATGCTGCAGCTTGGCCCGGG + Intergenic
1038480680 8:27899724-27899746 CAAATAGTACAGCATGGCAAGGG - Intronic
1039901168 8:41753511-41753533 CAACTGGGACAGCGTGCCCCTGG - Intronic
1047833183 8:128658309-128658331 CACCTGGTCCAGCTGGGCCCAGG - Intergenic
1051192649 9:14531654-14531676 CAAATGGTACAGTCGGTCCCAGG - Intergenic
1058825444 9:108772241-108772263 CAGATGGAAAAACTTGGCCCTGG + Intergenic
1187015097 X:15318714-15318736 CAAATCTTCCAGCGTGGCCCAGG - Intergenic
1195755046 X:108191827-108191849 GAAATGGTACAGCTGGCCCCAGG - Intronic
1200684132 Y:6245042-6245064 CAGCGGGCACAGCTTGGCCCTGG - Intergenic
1200690645 Y:6304783-6304805 CAACGGGCACAGCCTGGCCCTGG - Intergenic
1200909526 Y:8517554-8517576 CAGAAGGCACAGCCTGGCCCTGG - Intergenic
1200971184 Y:9154083-9154105 CATGTGATTCAGCTTGGCCCAGG - Intergenic
1201044627 Y:9869933-9869955 CAACGGGCACAGCCTGGCCCTGG + Intergenic
1201048503 Y:9909344-9909366 CAGCGGGCACAGCTTGGCCCTGG + Intergenic
1202115877 Y:21468425-21468447 CAGCGGGCACAGCTTGGCCCTGG + Intergenic
1202139839 Y:21710214-21710236 CATGTGATTCAGCTTGGCCCAGG + Intergenic