ID: 1106692831

View in Genome Browser
Species Human (GRCh38)
Location 13:32136864-32136886
Sequence TCCTCAGGCCTTGTACCCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106692825_1106692831 23 Left 1106692825 13:32136818-32136840 CCTGGTTTGTTGAAATATAAATG 0: 1
1: 0
2: 3
3: 52
4: 391
Right 1106692831 13:32136864-32136886 TCCTCAGGCCTTGTACCCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 146
1106692826_1106692831 -2 Left 1106692826 13:32136843-32136865 CCTGTGACCTCCTCTCCTTTCTC 0: 1
1: 0
2: 6
3: 89
4: 776
Right 1106692831 13:32136864-32136886 TCCTCAGGCCTTGTACCCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 146
1106692828_1106692831 -9 Left 1106692828 13:32136850-32136872 CCTCCTCTCCTTTCTCCTCAGGC 0: 1
1: 0
2: 14
3: 140
4: 1044
Right 1106692831 13:32136864-32136886 TCCTCAGGCCTTGTACCCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106692831 Original CRISPR TCCTCAGGCCTTGTACCCCC TGG Exonic
900100918 1:961678-961700 CCCTCAGGCCTTGGACCAGCTGG + Exonic
901770721 1:11529219-11529241 TCCTGAACCCTCGTACCCCCGGG + Intronic
902719572 1:18295146-18295168 TCATCAGGACTTCTGCCCCCAGG + Intronic
903033833 1:20481745-20481767 CTCTCAGGCCGTGCACCCCCAGG + Intergenic
906232110 1:44172560-44172582 TCCTGAGGCCCTGTGGCCCCAGG + Intergenic
909218774 1:72927434-72927456 TCCTCAAGCCTTTTACTCCTAGG + Intergenic
909521496 1:76573801-76573823 TCCTCTGGCCTTGTACTTCTAGG + Intronic
912437569 1:109672564-109672586 GCCTCAGGCCTTGTCCAGCCTGG + Intronic
914385615 1:147167042-147167064 TCCTAAGCCATTGTATCCCCTGG + Intronic
922772266 1:228192295-228192317 TCCACAGGCCATGTGCCCGCAGG - Intergenic
924588230 1:245378551-245378573 TCCCCAGACCTTGTTCCCTCAGG + Intronic
1063156429 10:3383433-3383455 TGCTCAGGCCATGTTTCCCCCGG - Intergenic
1064931592 10:20634461-20634483 TCCTCAATCCTTCCACCCCCAGG - Intergenic
1069829233 10:71272372-71272394 TCCACAGGCCTGGGACCCCCAGG - Intronic
1070887912 10:79921096-79921118 TCCCCAGGCCCGGGACCCCCAGG - Intergenic
1072043936 10:91635976-91635998 TGCTCAGACTTTGTAACCCCTGG - Intergenic
1072624551 10:97102761-97102783 CCCCCAGGCCTTGTGCTCCCTGG - Intronic
1073061588 10:100736706-100736728 TCCTAGGGCCTTGTCCCCACTGG + Intronic
1076710930 10:132333749-132333771 TCCTCAGGCTGTGTGCCCACAGG + Intronic
1077378701 11:2217823-2217845 TCCTCATGCCCTGTGCCCACTGG + Intergenic
1078000627 11:7492110-7492132 TCCCCAGGATTTTTACCCCCTGG - Intronic
1081631861 11:44694762-44694784 CCCTCAGTCCTTGTCCCCACTGG + Intergenic
1083029713 11:59581090-59581112 TCATCAGACTTTGTATCCCCAGG + Intronic
1083324261 11:61865566-61865588 TCCTCAGCCCTTGCACTCCCTGG + Intronic
1084589117 11:70079845-70079867 TGGTCAGGCCTTGCACCCCTTGG + Intronic
1084941769 11:72616914-72616936 GCCTGAGGCCCTGTAGCCCCTGG - Intronic
1085297273 11:75438309-75438331 TCCCCCGGCCTTGTCCCCCAGGG + Intronic
1085318643 11:75561442-75561464 TCCTCAATCCTTGTCACCCCTGG - Intergenic
1085996451 11:81920935-81920957 TTCTCAGCCCTTGAACCCCAGGG + Intergenic
1088893217 11:114060204-114060226 TCCGGAGGCTTTGTACCGCCAGG + Intronic
1090240869 11:125180730-125180752 CCCTCAGGCCATGTGGCCCCAGG - Intronic
1090845265 11:130524917-130524939 TCCTCAGGCATTCTGCCCTCTGG - Intergenic
1091332092 11:134737788-134737810 TCCTCAGGACTTGCAGGCCCAGG + Intergenic
1091343532 11:134837910-134837932 ACCTCAGGCCATGAAGCCCCTGG - Intergenic
1091719286 12:2800971-2800993 GCCTCAGGCCTTGTTCTTCCTGG + Intronic
1092103526 12:5904688-5904710 TCCTCTAGCCTTGCTCCCCCTGG + Intronic
1101892649 12:108730981-108731003 TCCCCAGGCCTGGAGCCCCCGGG + Intronic
1102303124 12:111785260-111785282 TTCTCAGGCCTTGGAGACCCTGG + Exonic
1103630089 12:122253012-122253034 TCCTCAGGCCCTGGACCCTCAGG - Intronic
1103907491 12:124335073-124335095 TCTCCAGGCCTGGTGCCCCCAGG + Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106566208 13:30886734-30886756 TTCCCAGGCCATGTACCCACTGG - Intergenic
1106692831 13:32136864-32136886 TCCTCAGGCCTTGTACCCCCTGG + Exonic
1114363120 14:21997912-21997934 TCCTCAGGCCTTGAGCATCCAGG + Intergenic
1115854697 14:37618329-37618351 TGCTCAGGCCTTGAACCTTCTGG + Intronic
1118250293 14:64153558-64153580 TCCTCAGTCCTCATTCCCCCAGG + Intronic
1118255980 14:64206151-64206173 TCCTCTTGCTCTGTACCCCCTGG + Intronic
1119287013 14:73463500-73463522 TCCTAAGGCCTTGGTTCCCCAGG + Intronic
1121338054 14:93089174-93089196 TCCTCAGGTCTTGGGGCCCCTGG - Intronic
1121625608 14:95383641-95383663 TCCTCAGGCCTTGTCCTGCGAGG + Intergenic
1122877028 14:104672262-104672284 TCCCCAGCCCCTGTACCCCCAGG - Intergenic
1124177824 15:27442481-27442503 TCCCCAGGGCTTGTGCCGCCCGG - Intronic
1127977524 15:64009153-64009175 TTGTCCAGCCTTGTACCCCCAGG + Intronic
1129035530 15:72646443-72646465 TCCTCAGGTCTCCTGCCCCCTGG + Intergenic
1129214354 15:74090773-74090795 TCCTCAGGTCTCCTGCCCCCTGG - Intergenic
1129731496 15:77935123-77935145 TCCTCAGGTCTCCTGCCCCCTGG - Intergenic
1134339970 16:13335837-13335859 TGCTTCTGCCTTGTACCCCCTGG + Intergenic
1135606984 16:23834023-23834045 TCCACAGCCCTTGCATCCCCAGG + Intergenic
1138294221 16:55873010-55873032 TCCTCAGTCCTTGGACCACATGG + Intronic
1139670759 16:68491312-68491334 TCCTCAGGCTGTGGACTCCCTGG + Intergenic
1141428265 16:83957392-83957414 TCCTCGGGCCTGGTTGCCCCAGG - Intronic
1143570981 17:7758448-7758470 TCTTCAGGGCTTGTCCCCTCTGG + Intronic
1143611808 17:8022220-8022242 CCCTCAGGCCTTGTTTCCACTGG - Intergenic
1144772999 17:17770067-17770089 ATCACAGGCCTTGTACCGCCTGG - Intronic
1151540082 17:74760293-74760315 TCCTCTTGCCTTGTTCTCCCTGG - Intronic
1152717130 17:81905552-81905574 TCCTCAGCCCAGGTACCTCCTGG + Intronic
1158938771 18:62388159-62388181 TCTTCAGGCCTGGTCCCTCCTGG + Exonic
1159890922 18:73952505-73952527 TCCTCATGCCTTCAAACCCCTGG + Intergenic
1161473735 19:4473454-4473476 CCCTCAGGCCTGGGATCCCCAGG - Intronic
1162575467 19:11496474-11496496 TCCTCAGGCCCAGGACTCCCAGG + Intronic
1163168828 19:15516803-15516825 TCTTCAGGCCACGTACCCCATGG - Intronic
1163546271 19:17943010-17943032 ACCTCAGGGCTTGTGCCCCGCGG + Intronic
1165235879 19:34421164-34421186 CCCCCAGGCCATGGACCCCCAGG - Intronic
925342294 2:3145926-3145948 GCCTCAGGCCGTGTGCCACCAGG - Intergenic
926408897 2:12581546-12581568 TCCTTGGGCAGTGTACCCCCCGG + Intergenic
926439221 2:12870171-12870193 TCCTCAGTCCTTGTGCCCCAGGG + Intergenic
927718985 2:25371199-25371221 TCTTCAGGCCCTGTTCCCCTGGG + Intergenic
929831813 2:45353169-45353191 TCCCCAGGCCTGGTGCTCCCAGG + Intergenic
930631830 2:53761510-53761532 TCCTCAGGCCTTCAAACTCCAGG + Intronic
932142762 2:69294246-69294268 TCCTGAGGCCTTGGACCTCTGGG + Intergenic
934026183 2:88003283-88003305 TCCTCAGGCCTCGGTCCCCACGG + Intergenic
934054198 2:88238463-88238485 TACTTACGCCCTGTACCCCCAGG + Intergenic
934976801 2:98808605-98808627 TCCCCAGGACATCTACCCCCAGG + Intronic
936228254 2:110677983-110678005 TCCTCTGGCCATGGACACCCCGG - Exonic
936251926 2:110873998-110874020 GCCTCAGGTCTTGTACCCAGAGG - Intronic
944190773 2:197001183-197001205 TCCTCAGGTCTTGGGCCCCCAGG + Intronic
948855380 2:240727873-240727895 TCCTCAGGCCTGGTGCTCACAGG + Intronic
1168995393 20:2129245-2129267 TCCTCAGTCCATGTAAACCCTGG + Intronic
1170606098 20:17876029-17876051 TCCTCATGCCTGCTTCCCCCTGG - Intergenic
1171275571 20:23854323-23854345 TCCTCAGGCCTTGCACAACTTGG + Intergenic
1172621124 20:36319384-36319406 TCCTCAGTCCTTGAACACACAGG - Intronic
1172761810 20:37328503-37328525 CCCTCAGGCCTAATATCCCCAGG - Intergenic
1172869520 20:38127031-38127053 TCCTCAGGCCTCTTTCCCACTGG - Intronic
1174239001 20:49117835-49117857 TCTTCAGGCCACGTACCCCATGG - Exonic
1176095479 20:63342084-63342106 CCTTCAGGCCTTCTACACCCGGG - Intergenic
1178923952 21:36760017-36760039 TCTTCAGGGCTTTTACCTCCTGG - Intronic
1179463243 21:41551984-41552006 TCCTGAGGCCTGGGTCCCCCAGG - Intergenic
1179610899 21:42549230-42549252 TCCTCAGGCCTGGCCGCCCCTGG - Intronic
1183779652 22:39990572-39990594 TCCCCAGGCCTTCCACCCTCCGG - Intergenic
1184275340 22:43406579-43406601 TCCTCAGCCCGTGTGCCCCTCGG + Intergenic
1184620201 22:45671519-45671541 TCCACAGGCCCCTTACCCCCCGG + Intergenic
950414114 3:12858580-12858602 TCCTCAGGCCTGGCATCCACTGG + Intronic
952193798 3:31051359-31051381 TCCTCAGGCCATGAACTCCTGGG + Intergenic
954394813 3:50287880-50287902 TTCTCAGGCCTTGCTCCCCCAGG - Exonic
954633262 3:52058054-52058076 TCCACAGGCCCAGGACCCCCAGG - Intergenic
954810108 3:53242320-53242342 TCCTCAGGACATGCACCCCCAGG - Intronic
955925082 3:63996441-63996463 TCATCAGTCCTTGTGCCCCTGGG - Exonic
958157245 3:89770967-89770989 TGCACAGGCCCTGTACCCCTTGG - Intergenic
960946612 3:122971118-122971140 TCCTCAGGCCTGGCACTTCCAGG - Intronic
961318611 3:126057207-126057229 TCCTGTGGCCATGAACCCCCTGG - Intronic
962515440 3:136145756-136145778 TCCTCAGGTATTGTAACCACTGG + Exonic
966925639 3:184642965-184642987 TCCCCAGGCCTAGGACTCCCAGG - Intronic
967852585 3:194093415-194093437 TCCTCAGGCTTTCTGCCCCATGG + Intergenic
978617438 4:110611418-110611440 TCCTCCGGCCCTGGACTCCCTGG + Intergenic
982197930 4:152935230-152935252 TCCTCAGTCCCTGAACTCCCAGG - Intergenic
986273737 5:6255869-6255891 TCCTCAGACCATGGACTCCCAGG + Intergenic
988410637 5:30881323-30881345 TCCTCAGGCATTGCAGCTCCTGG - Intergenic
993262123 5:85671422-85671444 TCATTAAGCCTTTTACCCCCAGG + Intergenic
996800800 5:127400617-127400639 TCTTCAGGCCTTTTACTCCTAGG + Intronic
1006412575 6:33883130-33883152 TCCTCTGGCCATGGACACCCCGG + Intergenic
1007176719 6:39902289-39902311 GCCTCAGGCCAGGTAACCCCAGG + Exonic
1007724484 6:43906789-43906811 TCCTCAGGCCATGATCCCTCAGG - Intergenic
1012271335 6:97215841-97215863 TCCTAAGGCCTATTTCCCCCTGG - Intronic
1012363041 6:98407080-98407102 TTCAGAGGCCTTGTACCTCCGGG - Intergenic
1018063278 6:160107202-160107224 TCCTCAGGCATTCTACCCAGGGG + Intronic
1019521721 7:1463675-1463697 GCCTCAGGCCATGTCCTCCCTGG - Intergenic
1020133002 7:5570076-5570098 ACCCCAGGCCTTGCTCCCCCGGG + Intergenic
1023850948 7:44150023-44150045 TCCTGAGGCCTTGAAGCCCTTGG + Exonic
1026102275 7:67393094-67393116 TCCTCAGGGCTTTTCCTCCCTGG - Intergenic
1029194291 7:98793942-98793964 ACTTCTGGCCTTGTACCCCAAGG + Intergenic
1032013309 7:128360545-128360567 TCCCGAGGCCCTGTGCCCCCTGG - Intronic
1034536265 7:151727744-151727766 CCTTCAGGCCCTGTATCCCCTGG + Intronic
1035155160 7:156906251-156906273 TGCTCAGGCCTGGAACCCCTGGG - Intergenic
1036938274 8:13026395-13026417 TCCTCTTGCCCTCTACCCCCGGG + Exonic
1037598638 8:20374806-20374828 TCCTCAGGGCTGGGACCTCCAGG + Intergenic
1039608151 8:38899948-38899970 TCCCCAGGCCTTGTGGCCTCCGG + Intergenic
1046430181 8:114114265-114114287 TCCTGAGGCCTTAAAACCCCAGG + Intergenic
1052118778 9:24682396-24682418 TTCTCATGCCTTGTAACCTCTGG + Intergenic
1056699550 9:88890913-88890935 TACTCAGGCCCTGTCGCCCCTGG - Intergenic
1056812430 9:89775094-89775116 TCCTCATTCCTAGCACCCCCGGG + Intergenic
1056822205 9:89851207-89851229 TGCTCAGGCCCTGTACACCTTGG - Intergenic
1057089337 9:92242669-92242691 TCCTCAGACCTTGAACCGTCTGG + Intronic
1058071932 9:100610102-100610124 TCCTCTGGCCTTGGGCCTCCAGG - Intergenic
1058166898 9:101630003-101630025 TCCTTATGCCTTGAACCCCCGGG + Intronic
1059779899 9:117515381-117515403 TCCTCAGCCCTTGAATCACCTGG - Intergenic
1061405567 9:130391471-130391493 CCCTCAGGCCTTTTAGCACCAGG - Intronic
1062087810 9:134657735-134657757 CCGTCAGGCCTGGCACCCCCGGG - Intronic
1062167337 9:135114539-135114561 TCCTAAACCCCTGTACCCCCAGG - Intronic
1186457061 X:9718085-9718107 TCCTCAGCCCTTCTGCCCACAGG - Exonic
1191138843 X:57094566-57094588 TCCTCAGGCTTAGTCCCTCCTGG - Intergenic
1192358762 X:70425620-70425642 TCCTCAATCCTTGGAGCCCCTGG + Intronic
1192804220 X:74495397-74495419 CCCACAGGCCTTTTACCCTCTGG + Intronic
1200251664 X:154557337-154557359 TCCTGTGGCCTTGTCCCCGCGGG + Intronic
1200253871 X:154569021-154569043 TCCTGTGGCCTTGTCCCCGCGGG + Intergenic
1200263898 X:154635387-154635409 TCCTGTGGCCTTGTCCCCGCGGG - Intergenic
1200266103 X:154647079-154647101 TCCTGTGGCCTTGTCCCCGCGGG - Intergenic