ID: 1106703478

View in Genome Browser
Species Human (GRCh38)
Location 13:32255267-32255289
Sequence TGCTAGTCCTACAATTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106703476_1106703478 -9 Left 1106703476 13:32255253-32255275 CCCAAACGACTCTCTGCTAGTCC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1106703478 13:32255267-32255289 TGCTAGTCCTACAATTGAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 58
1106703477_1106703478 -10 Left 1106703477 13:32255254-32255276 CCAAACGACTCTCTGCTAGTCCT 0: 1
1: 0
2: 0
3: 9
4: 52
Right 1106703478 13:32255267-32255289 TGCTAGTCCTACAATTGAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 58
1106703475_1106703478 -1 Left 1106703475 13:32255245-32255267 CCAGATTTCCCAAACGACTCTCT 0: 1
1: 0
2: 0
3: 9
4: 189
Right 1106703478 13:32255267-32255289 TGCTAGTCCTACAATTGAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106703478 Original CRISPR TGCTAGTCCTACAATTGAAG AGG Intronic
924246067 1:242086467-242086489 TGCTTGTCCAACCATTGGAGAGG - Exonic
1068610116 10:59050140-59050162 TTCTAGTACTAGAATAGAAGTGG + Intergenic
1070478963 10:76862245-76862267 TGCTTGTGCAATAATTGAAGAGG + Intergenic
1071209070 10:83317253-83317275 GGCAAGTCCTACTACTGAAGTGG + Intergenic
1071672097 10:87618414-87618436 TGCCAGTCCCACGATTGATGGGG + Intergenic
1077456657 11:2685515-2685537 CGCTAGTCCTACAGGTGCAGTGG + Intronic
1087885509 11:103477433-103477455 TGCTAATCCTATATTTGAATTGG + Intronic
1091092400 11:132784290-132784312 GGTTAGTCCTAAATTTGAAGTGG - Intronic
1092640602 12:10504690-10504712 TGATAATCCTACCATTGATGTGG - Intergenic
1093214961 12:16351312-16351334 TGCTTGTTCTAGTATTGAAGGGG - Intronic
1095314130 12:40738573-40738595 TACAAGACCTACAATTGAAAAGG + Intronic
1098915519 12:76252830-76252852 TTCAAGTGCTACACTTGAAGAGG + Intergenic
1100196565 12:92253020-92253042 TGCTAGTTCTACAACTGATTGGG - Intergenic
1101640431 12:106582774-106582796 TGCTAATGCTATAATAGAAGGGG + Intronic
1105323496 13:19348540-19348562 TGCTTTTCATACAATTGAATTGG - Intergenic
1106703478 13:32255267-32255289 TGCTAGTCCTACAATTGAAGAGG + Intronic
1111981250 13:95017827-95017849 TACTTATCCTAAAATTGAAGAGG + Intergenic
1124487016 15:30126750-30126772 TGCTAGTTCTACAATTGCCTAGG + Intergenic
1124542099 15:30595725-30595747 TGCTAGTTCTACAATTGCCTAGG + Intergenic
1124756509 15:32411572-32411594 TGCTAGTTCTACAATTGCCTAGG - Intergenic
1129508238 15:76100911-76100933 TACAAGTCCTACAATTGAACAGG - Intronic
1136487004 16:30579822-30579844 TGCTAGCCCTACTTTTGAAGAGG - Intronic
1142827247 17:2521309-2521331 TGCGGATCCTACAATTTAAGGGG + Intergenic
1144263294 17:13544382-13544404 TGCTAGTCCTTCAGCTGTAGGGG + Intronic
1155848117 18:30734546-30734568 TACTATTCCAACAATTGAAAAGG + Intergenic
1157318681 18:46617503-46617525 TGCCAGTGCTAGAAATGAAGAGG - Intronic
942937953 2:181581201-181581223 TGATAGTCGTTCAATTGAACTGG - Intronic
943408035 2:187513639-187513661 TGCTGTTCCTACAATGGAAAGGG + Intronic
943516776 2:188898393-188898415 TTATAATCCTACAACTGAAGAGG - Intergenic
944716390 2:202379585-202379607 TGCTTGGCCTAATATTGAAGTGG + Intronic
944740004 2:202602777-202602799 TTTTAGTCTTACAATAGAAGGGG + Intergenic
1172352101 20:34251114-34251136 TGCTATTAATACAATTGCAGTGG + Intronic
1183415692 22:37680694-37680716 TGCTATTACTCCAATTGAAGGGG + Intergenic
951308180 3:21092301-21092323 TGCTAACCCTGCAATTGAACAGG - Intergenic
956989987 3:74751801-74751823 TGCTACCCCCACAATGGAAGTGG - Intergenic
962305235 3:134280318-134280340 TCCTGGTGCTACAATTAAAGTGG + Intergenic
969036888 4:4261497-4261519 TGCTACTTCAAAAATTGAAGTGG + Intergenic
970844939 4:20525905-20525927 TGATAGTGTTACGATTGAAGTGG - Intronic
970939033 4:21609564-21609586 TGCTAGGACTAGATTTGAAGGGG + Intronic
981536423 4:145804976-145804998 TGCCAGTACTGCCATTGAAGAGG - Intronic
990975571 5:61558226-61558248 TCTTAGTCCTACAGTTGAATGGG - Intergenic
998385068 5:141752855-141752877 GGCTAGCCCTACCATTGGAGGGG + Intergenic
1004338426 6:14785154-14785176 TGAAAGTCCTACAATTGCTGTGG - Intergenic
1009363804 6:62842730-62842752 TATTAGTCCCAAAATTGAAGTGG + Intergenic
1021583913 7:22187643-22187665 TGCCAGTCCTTCCATTAAAGTGG - Intronic
1022417881 7:30193579-30193601 TTCAAGTCCTAAAATGGAAGCGG + Intergenic
1033014135 7:137654455-137654477 TGGTAGTGATAGAATTGAAGGGG - Intronic
1034409051 7:150928577-150928599 TGCAAGTCCTAAAAATGAAAAGG + Intergenic
1036191235 8:6671858-6671880 TGTTAGTCCTAGAATGGCAGAGG + Intergenic
1036631731 8:10520707-10520729 TCCTAGTCCAACAATGGCAGCGG + Intergenic
1041238887 8:55831831-55831853 TACTAGTACTACAATTTCAGTGG + Intergenic
1042119067 8:65464928-65464950 TGCTAGTAATACATTTGATGAGG - Intergenic
1045967919 8:108047524-108047546 TTCTATTCATTCAATTGAAGTGG + Intronic
1048370529 8:133772688-133772710 CACTAGTCCTGTAATTGAAGGGG + Intergenic
1049858471 8:144880216-144880238 TTCTATTCCTATATTTGAAGGGG - Exonic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1059383871 9:113949306-113949328 TGCAAGTCCTGTAATTCAAGGGG + Intronic
1060071208 9:120549462-120549484 ATCTAGTCAGACAATTGAAGTGG + Intronic
1186855051 X:13618336-13618358 TGCTAGTCCTGCAAGGGCAGTGG + Intronic
1195704733 X:107730553-107730575 TGCTAGTCCCTGAATTGAAATGG - Intronic
1200747990 Y:6919186-6919208 TTATAGTCCTAAAATTTAAGAGG - Intronic
1200959163 Y:8981435-8981457 TGCTATTCCCAAAAATGAAGTGG - Intergenic