ID: 1106703544

View in Genome Browser
Species Human (GRCh38)
Location 13:32255899-32255921
Sequence CTCTGGAAGTTATACAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 3, 3: 5, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106703536_1106703544 25 Left 1106703536 13:32255851-32255873 CCTAATGTTTGCTCTTCAGTTAA 0: 1
1: 0
2: 0
3: 21
4: 249
Right 1106703544 13:32255899-32255921 CTCTGGAAGTTATACAAGGGAGG 0: 1
1: 0
2: 3
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106703544 Original CRISPR CTCTGGAAGTTATACAAGGG AGG Intronic
908754136 1:67452419-67452441 TTATGGAAGTTAGACAAGAGAGG + Intergenic
910804450 1:91176715-91176737 CCCTGGAAGTTTTGCAAGGCAGG + Intergenic
915798853 1:158766783-158766805 CTCTGGAGGTGAGAGAAGGGAGG - Intergenic
917231630 1:172844005-172844027 CTCTGGAAGATGGACTAGGGAGG + Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924555998 1:245119056-245119078 CTCTGGCTGTTATGCGAGGGTGG + Intronic
1064057570 10:12110729-12110751 CTCCAGAACTTATTCAAGGGAGG + Intronic
1068927741 10:62557494-62557516 CTTTGGAAGTTGTAAAAAGGTGG - Intronic
1071973490 10:90931515-90931537 CTCTGGCATTTATACAAATGAGG + Intergenic
1072990045 10:100184452-100184474 CCCTGGAAATTATAAAAAGGAGG + Intronic
1073112430 10:101070567-101070589 CTCTGGAAGTCCAGCAAGGGAGG - Intergenic
1075605468 10:123802198-123802220 CTCTTGAAGTTCGCCAAGGGTGG + Intronic
1076906719 10:133366199-133366221 CTCTGGACGCTAAGCAAGGGCGG + Intronic
1079793384 11:24767849-24767871 GTATGGAAGTTAGAGAAGGGAGG - Intronic
1086659053 11:89392011-89392033 CTCTGGAAATTATCCCAGGTCGG - Intronic
1087969426 11:104461198-104461220 CTTTGGAAGTGAGACAAGCGTGG - Intergenic
1088143410 11:106646329-106646351 CTCTGGAACTTATATAGGAGAGG - Intergenic
1090521545 11:127485150-127485172 CTTTGGTAGATATAGAAGGGAGG + Intergenic
1095473823 12:42565234-42565256 CTCTGGAAGTTTTAAAACAGGGG + Intronic
1097345475 12:58487472-58487494 CTCTGGAATTTCTATAAAGGAGG + Intergenic
1102122405 12:110451850-110451872 CTCTAGAAGCTAAACCAGGGAGG + Intergenic
1102600302 12:114024824-114024846 CCCTGGAAGTCATAAAAGGAGGG - Intergenic
1106703544 13:32255899-32255921 CTCTGGAAGTTATACAAGGGAGG + Intronic
1106820849 13:33463085-33463107 CTCTGGAAGTGATGCAGGGTAGG + Intergenic
1109374760 13:61477535-61477557 CTCTGGAAGGGAAAAAAGGGAGG + Intergenic
1110436775 13:75484638-75484660 CTCTGCAAGTGATACAATGGTGG - Intergenic
1112067699 13:95812348-95812370 CTGTAGTATTTATACAAGGGTGG - Intronic
1112229261 13:97571331-97571353 CTCTGGAAGTTCTCAAAGTGAGG - Intergenic
1112698927 13:101981674-101981696 CCCTCGAAATTATACTAGGGTGG + Intronic
1113584651 13:111456914-111456936 CGCTGGAGGTTCTGCAAGGGAGG - Intergenic
1114349037 14:21829652-21829674 GTCTGGAAGTTATAGAAGGGTGG + Intergenic
1114353280 14:21878339-21878361 GTCTGGAAGTTATAGAAGGGTGG + Intergenic
1114359102 14:21950232-21950254 GTCTGGAAGTTATAGAAGGGTGG + Intergenic
1129234866 15:74218003-74218025 CTCTGGAAGTTCCAGAAGGCAGG - Intergenic
1130011563 15:80156583-80156605 CTCTTGAAGTTAGACAAATGCGG + Intronic
1135591780 16:23710375-23710397 CTCTGGATGTGATATAGGGGAGG - Intronic
1136050075 16:27643989-27644011 CTCTGGAAGATGGACTAGGGAGG - Intronic
1138098434 16:54232026-54232048 ATCTGGATGTTTTATAAGGGTGG + Intergenic
1138317031 16:56078988-56079010 CTGTGGAAGTGGTACCAGGGAGG - Intergenic
1144381219 17:14700721-14700743 TTTTGGAAGTTACACAAGGAAGG + Intergenic
1147717381 17:42517523-42517545 TTCTGGAAGTTGCACAAAGGAGG - Intronic
1149582524 17:57761191-57761213 CTCGGGAAGTTCCCCAAGGGTGG + Intergenic
1157332654 18:46714781-46714803 CTCTGGGGGTGATACAAAGGAGG - Intronic
1157909098 18:51598269-51598291 CATTGAAAGTTATACAAGGGAGG + Intergenic
1168510438 19:56969260-56969282 CTCTAGAATTTCTACATGGGAGG + Intergenic
1168535757 19:57168192-57168214 CCCTGCAAGTTATGCAAGTGAGG + Intergenic
1168601426 19:57721860-57721882 CTCTGGAGGTCATACCATGGGGG + Intronic
925179754 2:1809462-1809484 CTCTGAAAGTTATACAATGAAGG - Intronic
926544770 2:14226018-14226040 CTCTAGAAGTTGGACAAGGCTGG - Intergenic
926599987 2:14832138-14832160 CTCTGGGAATTAGAGAAGGGTGG - Intergenic
928155132 2:28869836-28869858 CTCTGGAAGTTGAACAAGAAGGG + Exonic
940113231 2:150178639-150178661 TTCAGGAAGTTATGCAATGGTGG + Intergenic
945867162 2:215189294-215189316 CTCTGAAAGTTACATAAGGCTGG - Intergenic
946196684 2:218036297-218036319 CTCTGGACTTTACACAAAGGAGG + Intronic
946799863 2:223402740-223402762 AGCTGGAAGATATACAGGGGGGG - Intergenic
948434277 2:237942562-237942584 CTTTGGAAGTTCGACATGGGTGG - Intergenic
1169641709 20:7759478-7759500 CCCTGGAAGTTCTAGAAGGACGG - Intergenic
1175475429 20:59270005-59270027 CTCTGGAAGCTTAACAAAGGAGG - Intergenic
1178582087 21:33846020-33846042 CCCTGGGAGGTAGACAAGGGGGG - Intronic
1182638457 22:31748395-31748417 TTCTGGATGTTATTAAAGGGAGG - Intronic
1183788051 22:40043191-40043213 ATCAGGAAGTGAAACAAGGGCGG + Exonic
949810020 3:7997145-7997167 CTCTGGTACCTATACATGGGAGG - Intergenic
951578954 3:24141976-24141998 TTCTGGCAGATATACCAGGGTGG + Intronic
956406769 3:68935978-68936000 TTCTGGATGTTATACAAATGAGG - Intergenic
959420165 3:106118842-106118864 CACTGGAAAATATACAAGCGGGG - Intergenic
960263243 3:115591792-115591814 CTCTGAAAGTTTTACAAAGTAGG - Intergenic
964731408 3:159870392-159870414 CTTTGTAAGTTATACCTGGGAGG - Intronic
965370664 3:167857990-167858012 CTCTGGAAGTTTTAAAGTGGAGG + Intergenic
966296778 3:178432830-178432852 CTCTGCAAGCTATACAAGCATGG - Intronic
969737746 4:9002276-9002298 CTCTGGAAGGTTTTCCAGGGCGG + Intergenic
974810738 4:66942689-66942711 CACTGGAAATCATACAAGGTAGG + Intergenic
977324345 4:95555908-95555930 CTCCAGAGGTTATACTAGGGTGG - Intergenic
984193773 4:176634482-176634504 TCCTGGAAGTTGTACTAGGGAGG - Intergenic
984402380 4:179282884-179282906 TTCTGGAAGCTATAGAAGTGTGG + Intergenic
988312325 5:29576180-29576202 CTGTGGAAGTTACACAACGTAGG + Intergenic
989033763 5:37147932-37147954 CTCTGGATTTTATACTAGGATGG - Intronic
996502857 5:124236014-124236036 CTCTGCAAGTTATAGAGAGGAGG - Intergenic
1001264055 5:170259464-170259486 CTTGGGAAATTAGACAAGGGAGG + Intronic
1001804947 5:174575983-174576005 CTCTGTAAGTTTTAGAAGTGGGG + Intergenic
1004870389 6:19898298-19898320 CTGGGGAAGTTTTACAAAGGAGG + Intergenic
1007867669 6:44990734-44990756 CTGTAGAAGTTATTCAAGTGAGG - Intronic
1008456774 6:51720239-51720261 CTCTGGAAGGTTTGCAAGAGTGG - Intronic
1011482945 6:87813288-87813310 CTCTGGAAGTGCTACTCGGGTGG - Intergenic
1019174470 6:170153252-170153274 CTCTGGAAGTTCTGCAGGAGTGG - Intergenic
1031012756 7:116540910-116540932 CTGTGGAATTATTACAAGGGGGG - Intronic
1032192401 7:129772471-129772493 TTCTGGAAGCCACACAAGGGAGG + Intergenic
1034027756 7:147725595-147725617 CTCTGAAATTTGAACAAGGGAGG + Intronic
1039105031 8:33981001-33981023 CTATAGAATTTATAGAAGGGAGG + Intergenic
1039648712 8:39316576-39316598 TTCTGGAAATTAGACAAGTGAGG - Intergenic
1040122611 8:43699848-43699870 CTCTGGGACTTATACAAGGAAGG - Intergenic
1045000517 8:97874268-97874290 CTCTGGAAGTTGGAAAAGGCAGG - Intronic
1045750669 8:105480575-105480597 TTATTGAACTTATACAAGGGTGG + Intronic
1048825075 8:138416524-138416546 CTCTGGAACTTATACAGAGAAGG - Intronic
1050753002 9:8963295-8963317 ATCAGGAAGTAATACATGGGAGG + Intronic
1052792504 9:32889106-32889128 CTCTGGAAGTGAAACAAAGCAGG + Intergenic
1058144967 9:101400385-101400407 CTCTGGCAGTTTTTCAAGTGGGG + Intronic
1060907043 9:127316049-127316071 CTCTGGAAGCTACAAAAGGGAGG + Intronic
1189322021 X:40092494-40092516 CTCTGGGAGGAATAAAAGGGAGG - Intronic
1193746430 X:85288116-85288138 CTCTGGAACTCATTTAAGGGAGG + Intronic
1196919519 X:120571445-120571467 TTCTGGAAATTACTCAAGGGCGG + Intronic
1198788968 X:140321377-140321399 AAGTGGAATTTATACAAGGGAGG + Intergenic