ID: 1106703994

View in Genome Browser
Species Human (GRCh38)
Location 13:32261046-32261068
Sequence AGCAGCTGGGCAAAGTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106703994_1106703997 22 Left 1106703994 13:32261046-32261068 CCATCAGACTTTGCCCAGCTGCT 0: 1
1: 0
2: 1
3: 18
4: 237
Right 1106703997 13:32261091-32261113 TGTATCTGTGAAAATTGCTGTGG 0: 1
1: 0
2: 3
3: 34
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106703994 Original CRISPR AGCAGCTGGGCAAAGTCTGA TGG (reversed) Intronic
900641798 1:3691144-3691166 AGCAGGTGGGCACAGGCTGTTGG - Intronic
901006867 1:6176108-6176130 AGCCACTGGGCAAAGTGTGCTGG + Intronic
902248559 1:15138191-15138213 AGGAGATGGGCAAAGGATGAAGG - Intergenic
902516424 1:16992105-16992127 AGCATCTGGGCGAAGTCGGTGGG + Exonic
902740136 1:18432184-18432206 AGCAGATGGGCAATGTGAGAAGG - Intergenic
903515192 1:23905667-23905689 ACAAGCTGGGCAGAGGCTGATGG + Intronic
903967686 1:27100526-27100548 AGCTGAAGGGCAAAGTCTTAGGG - Exonic
904842578 1:33382741-33382763 AGCAGCTGGAGAAACGCTGATGG + Intronic
905862151 1:41358951-41358973 ATGAGCTGGGCAAAGTAGGAAGG + Intergenic
907193536 1:52668214-52668236 AATAGCTGGGGAAAGTCTGAAGG + Intronic
911157994 1:94655432-94655454 AGCAACTTGGCAACTTCTGAAGG - Intergenic
912632119 1:111254968-111254990 AGTACCTGGGCAAAGTGAGAGGG - Intergenic
913297958 1:117340059-117340081 AGCACATGGGCTAAGTCTGTAGG + Intergenic
913961339 1:143339975-143339997 AGGGGCTGGGCACAGCCTGATGG + Intergenic
914055692 1:144165548-144165570 AGGGGCTGGGCACAGCCTGATGG + Intergenic
914123454 1:144800814-144800836 AGGGGCTGGGCACAGCCTGATGG - Intergenic
915111811 1:153568679-153568701 AGCAGCTGGGCAAAATCCCGCGG - Intergenic
917453657 1:175167694-175167716 GGCAGCTGGGCCAAGGGTGATGG + Intronic
917510971 1:175669027-175669049 AGCAGCTGGGCAAGCTCCTAGGG - Intronic
918024789 1:180732899-180732921 AGCAGATGGGGAAAGCCAGAAGG + Intronic
920250098 1:204617711-204617733 GGCAGCTGGGCCAAGACAGATGG - Exonic
920506514 1:206518917-206518939 AGCAACTTGGCAGGGTCTGAAGG - Intronic
922779650 1:228241249-228241271 AGCGGCTGGGGAAGGGCTGAAGG + Intronic
923038083 1:230299565-230299587 ATAAACTGGGCAAAGTCTAAAGG + Intergenic
1062890326 10:1055156-1055178 TGCAGCAGGGCAAAGACTAAAGG - Intronic
1063435555 10:6026945-6026967 AGGTGCTGGGCAGAGTCTAAGGG - Intronic
1064168157 10:13004291-13004313 AGCAACTGGACAAATTTTGAAGG - Intronic
1065213706 10:23429753-23429775 AGCAGTTTGGCAAGGTCTGGAGG - Intergenic
1065329925 10:24585277-24585299 AGCAGCCGGAGAAATTCTGAAGG - Exonic
1067698673 10:48553257-48553279 AGCAGCTGCACAAAGGCTGGAGG + Intronic
1071328475 10:84539456-84539478 GGCAGCTGGCCAAAATGTGAAGG + Intergenic
1071384369 10:85104656-85104678 AGCACCTGGGCCCAGTCTAAGGG + Intergenic
1071722047 10:88156815-88156837 TGCAGCTGGGAAGAGTCAGAGGG - Intergenic
1075830998 10:125410882-125410904 AGCAGAGGGGGAAAGGCTGATGG + Intergenic
1077286130 11:1766831-1766853 AGCAGCTGGGCAGATTCTGAGGG - Intergenic
1077286140 11:1766870-1766892 AACAGCTGGGCGGATTCTGAGGG - Intergenic
1077383299 11:2257428-2257450 AGCAGCAGGGCCAAGGCTGTGGG - Intergenic
1077609530 11:3635906-3635928 AGAAGCTGGGAAAGGGCTGACGG - Intergenic
1078094722 11:8289722-8289744 AGCAGCTTGGCAAAGGCAGGGGG + Intergenic
1078191502 11:9095299-9095321 GGCAGCTGGGCTGAGGCTGAGGG + Intronic
1078705997 11:13744962-13744984 AGCACTTGGGCAAAGACTCAAGG + Intergenic
1079690026 11:23406325-23406347 ACCAGGTGGGCATAGGCTGAAGG - Intergenic
1080210177 11:29776870-29776892 CTCAACTGGGCAAAGTCAGAAGG + Intergenic
1080656766 11:34264465-34264487 AGTAGCTGGGCAAATTCCCATGG - Intronic
1081907669 11:46679798-46679820 AGAAGCTCGGCACAGCCTGAAGG + Intronic
1086492525 11:87369872-87369894 AGCAGCTGTGCAAGGTCACAGGG + Intergenic
1089828397 11:121300831-121300853 AGCACCTTGGCAAAGGCTGGGGG + Intronic
1090479603 11:127056482-127056504 AGCAGCTGGGGAAAGTGAGCAGG + Intergenic
1090626935 11:128616085-128616107 GGCAGCTGGGCACAGGCTGGAGG + Intergenic
1091455456 12:604155-604177 ATCAGCTCTGCAAAGTCTGCTGG + Intronic
1092178297 12:6426338-6426360 ATCAGCTGGTGAAAATCTGAAGG - Intergenic
1093291272 12:17325315-17325337 GCCAGCTGGGCAAAGACTCATGG + Intergenic
1094216775 12:27950902-27950924 AGCTGCTGGGCCAACTCTCAAGG + Intergenic
1097243253 12:57590913-57590935 AGAAACTGGGCAAAGCCGGAAGG + Intergenic
1097263190 12:57731097-57731119 AATTGCTGGGCCAAGTCTGATGG - Intronic
1099576820 12:84392955-84392977 AGCAGCTGGAGAAAGGCAGAAGG + Intergenic
1100377835 12:94033881-94033903 AACAGCTGGTCAAAGTCTGTAGG + Intergenic
1101368859 12:104105556-104105578 AGAATCTGGGCTAAGTCTCAGGG - Exonic
1103154041 12:118667950-118667972 AGCAGCAGGGACAAGTCAGAGGG - Intergenic
1103238393 12:119393880-119393902 AGGTGCTGGTTAAAGTCTGATGG - Intronic
1103317612 12:120069152-120069174 AGAGGCTGGGAAAAGTCTAAAGG + Intronic
1103326569 12:120125276-120125298 AGCAGCTGGGTAGGGTCTGGAGG + Intergenic
1104444556 12:128823230-128823252 AGCAGGTGGGCCAAGACTGGAGG - Intronic
1104612743 12:130242819-130242841 ACCAGCTGGGCAAAGGTTGGAGG - Intergenic
1105614599 13:22000499-22000521 AGCAGATGGGCGAAGCCAGAGGG - Intergenic
1106703994 13:32261046-32261068 AGCAGCTGGGCAAAGTCTGATGG - Intronic
1106790207 13:33147437-33147459 AGCCGCTCAGCAAAGACTGAGGG + Intronic
1106814454 13:33391798-33391820 TGAAGCAGGGCAAACTCTGAAGG - Intergenic
1107274359 13:38660972-38660994 CTGAGCTGAGCAAAGTCTGAAGG - Intergenic
1107566515 13:41610874-41610896 AACAGCTGGGGAATGTCCGAGGG + Intronic
1111761295 13:92468865-92468887 AACAGCAAGGCAAAGACTGAAGG - Intronic
1113867663 13:113538328-113538350 GGCAGGTGGGCAGAGTCAGAGGG - Intronic
1114482801 14:23045922-23045944 AGCAGGTGGGGAAGGTATGAGGG + Intergenic
1115576158 14:34714355-34714377 AGCAGCAGGGCAGGGCCTGACGG + Intronic
1116441830 14:44962659-44962681 AGCAGCTGGTCTGAGTCTGGAGG + Exonic
1117154796 14:52927809-52927831 AGCCACTGTGCAAAGTTTGAAGG - Intronic
1117480887 14:56143449-56143471 ATCAGCTGGTGAAAGTCTAAGGG - Intronic
1121044945 14:90780963-90780985 AGCAGCTGGCCAGACTCTGAGGG - Intronic
1121485701 14:94312795-94312817 GGGAGGTGGGCACAGTCTGATGG + Intronic
1121879497 14:97487355-97487377 AGCAGCTGGGAAAAGTCCAGAGG + Intergenic
1122342150 14:101035421-101035443 AGCAGCTGCCCACTGTCTGAAGG - Intergenic
1122976713 14:105173886-105173908 TGCAGCTGGCCACAGACTGAGGG - Intronic
1127055513 15:55127071-55127093 GACATCTTGGCAAAGTCTGAAGG + Intergenic
1129200430 15:73995184-73995206 AGCAGTTGGGCAAGGTGAGAAGG + Intronic
1129456784 15:75680268-75680290 GGCAGCTGAGCCCAGTCTGAAGG + Intronic
1131031992 15:89194208-89194230 AGCAACTGGGCCAAGTGTGGTGG + Intronic
1133018506 16:2955722-2955744 AGCAGCAGGTCAAAGTCAGGAGG + Intergenic
1133928512 16:10213200-10213222 AGCAGCTGGCCACGGTCAGAGGG - Intergenic
1134857158 16:17529850-17529872 AGCAGCTGGGAAAAGTCATTTGG + Intergenic
1135247409 16:20868961-20868983 AGCAGCTGGGCTGAGACTGAGGG - Intronic
1137303537 16:47178201-47178223 AGCAGCTGGGCTCTGCCTGATGG + Intronic
1139267892 16:65656849-65656871 TCCAGCTGGGCAATGTCTTAGGG - Intergenic
1139910433 16:70394324-70394346 AGCAGCTGGGCAAGGAGTGAGGG - Intronic
1140662191 16:77198423-77198445 AGCAATGGGGCAAGGTCTGAGGG + Exonic
1142293855 16:89206656-89206678 AGCATCTTGGCCAAGTGTGATGG - Intergenic
1143027683 17:3950817-3950839 ACCAGCTGGGAAAAGCCAGAAGG + Intronic
1144517387 17:15928156-15928178 AGCAGTTGAGCAAGGCCTGAGGG + Intergenic
1144704885 17:17361879-17361901 AGCAGCTGTGCAGCGTCAGAGGG - Intergenic
1145124189 17:20286774-20286796 AGGAGCTAGGCAAGGTCTGTGGG - Intronic
1147788572 17:42998353-42998375 ATCAGCGTGGCAAAGCCTGAAGG + Intronic
1147921672 17:43920977-43920999 AGCAGATGGGGAAAGCCAGAAGG - Intergenic
1148078166 17:44951587-44951609 AGCAGCTGGGCTGAGTGTGGTGG + Intergenic
1148457028 17:47816592-47816614 TGCAGGTGGGCATAGTCTGTGGG + Exonic
1148791996 17:50178380-50178402 TGCAGCTGGGCCAAGTCTCCCGG - Intergenic
1148823994 17:50378677-50378699 AGCAGGTGGGCAGAGCCAGAGGG + Exonic
1150330012 17:64286915-64286937 AGCTCCTGGGCAAAGGCTCAGGG - Intergenic
1151466443 17:74288857-74288879 AGCAGCTGGGGAAATGCGGAGGG + Intronic
1151484149 17:74387999-74388021 AGCAGCAGCGCAGAGTCAGAAGG - Intergenic
1152507333 17:80758758-80758780 AGCCTCTGGGCAGAGTCTAAAGG - Intronic
1152521585 17:80859689-80859711 AGCAGCTGGCCGAAGTCCGGGGG - Intronic
1153594880 18:6715465-6715487 AGCAGATGAGCAAAGGCTGGAGG - Intergenic
1153777600 18:8467326-8467348 TGCAGCTGGGCTAAGTGTGTGGG + Intergenic
1156469791 18:37370130-37370152 GGAAGCTGGGAACAGTCTGAGGG - Intronic
1156676196 18:39529706-39529728 AGCAGATGGGGAAAGTCAGAAGG - Intergenic
1156888725 18:42165516-42165538 AGAATCTGGGCAAAAACTGAGGG - Intergenic
1157576039 18:48744123-48744145 AGTGTCTGGGCACAGTCTGAAGG - Intronic
1160482277 18:79252667-79252689 ACCAGCTGAGCAAACTGTGAGGG - Intronic
1163364531 19:16868697-16868719 AGCAGCCTGGGAAAGCCTGAAGG + Intronic
1164813578 19:31177110-31177132 TGCTGCTGGGAAAAGTCTGCTGG - Intergenic
1164938634 19:32233864-32233886 AGGAGCTGGGCAGAGGCTGTTGG - Intergenic
1165419221 19:35714828-35714850 AGGAGCTGGGCAAAGGTAGAAGG - Exonic
1165766227 19:38352834-38352856 AACAGATGGGCAAAGCCTCAAGG + Intronic
1168390330 19:56001803-56001825 AGCAGCTTGTCATTGTCTGAGGG - Intronic
1168439440 19:56351317-56351339 ACCACCTGTGCAAAGTGTGAAGG + Intronic
1202695175 1_KI270712v1_random:118225-118247 AGGGGCTGGGCACAGCCTGATGG + Intergenic
925710658 2:6736511-6736533 AGTAGATGGGTAAAGTCTGTTGG - Intergenic
927266752 2:21161182-21161204 ATGAGCTGAGCAAAGCCTGATGG - Intergenic
928726415 2:34179044-34179066 AGCAGATGGGCAAAGTTCAAAGG + Intergenic
929712608 2:44280066-44280088 AGCTGCTGGGCTAAGTGTCAAGG - Intronic
930015171 2:46965062-46965084 AGCTGCTGTGCAAAGTCAAAAGG + Intronic
932279488 2:70477681-70477703 AGCAGCTGGGAAAAGACAAAGGG - Intronic
932734459 2:74244884-74244906 GGCACCTGGGCAAAGCCAGAGGG + Intronic
934276343 2:91575274-91575296 AGGGGCTGGGCACAGCCTGATGG + Intergenic
934970307 2:98758112-98758134 AGCGGGTGGGAAAAGCCTGAAGG - Intergenic
938405058 2:131027908-131027930 AGCAGCTGGGCAAAGGGGGCTGG - Intronic
939818883 2:146930987-146931009 AGCAGATGGGGGAAGTCAGAAGG - Intergenic
942327624 2:174788932-174788954 AGCAGATGGGGGAAGTCAGAAGG - Intergenic
943420687 2:187664584-187664606 AGGAGGTGAGCAAAGGCTGATGG + Intergenic
1173138031 20:40457584-40457606 AGCAGGTAGGCAAAGGCTCAGGG + Intergenic
1173586359 20:44186383-44186405 AGCAGCGGTGCCAAGTATGAGGG - Exonic
1173608885 20:44352214-44352236 AGCTGCAGGGCAAGGTCTGAGGG - Intergenic
1174899229 20:54480851-54480873 AGGAGCTGAGAAAAGGCTGAAGG - Intronic
1175133327 20:56805851-56805873 GGCAGCTGGGCACAGACCGATGG + Intergenic
1175240363 20:57543100-57543122 AGCACCTGGGCATAATCTGTGGG + Intergenic
1175359390 20:58396368-58396390 CCCAGATGGGCAAAGGCTGAAGG - Intronic
1177277579 21:18933346-18933368 AGTACATGGGCAAAGTCTAAAGG + Intergenic
1178390292 21:32192449-32192471 AGGAGCTTGGCAAATTCTGCTGG + Intergenic
1181276505 22:21690419-21690441 AACAGCTGGGCAAAGGCAGCTGG + Intronic
1182321691 22:29481867-29481889 AGCTGCTGGGCACAGCCTCAGGG - Intronic
1182724284 22:32430193-32430215 ATCAGATGGTCAGAGTCTGAAGG + Intronic
1183987934 22:41579513-41579535 AGCAGCTATGCCCAGTCTGAGGG + Intronic
1184694796 22:46133314-46133336 GGCAGCTGGGCACAGCCTGAAGG + Intergenic
950404295 3:12795034-12795056 AGCAGCTGGGCAAAGTTTTGAGG - Intergenic
950630106 3:14276639-14276661 TGCAGCTGGGCAGAGTGTGCTGG + Intergenic
953501076 3:43435210-43435232 AGAAGCTGGGCAAAGTGGGCTGG + Intronic
953791539 3:45951491-45951513 AGAGGCTGAGCAAAGGCTGAGGG + Intronic
954857546 3:53659332-53659354 AGGAGCTGTGCAAAGGCTAAAGG - Intronic
955627370 3:60932673-60932695 AGCAACTATGGAAAGTCTGAAGG - Intronic
955939633 3:64135167-64135189 CTCAGCTGTGCTAAGTCTGAGGG - Intronic
961348206 3:126278593-126278615 TGCAGCTGGGAAAGGCCTGAGGG + Intergenic
962325981 3:134432561-134432583 TGCAGAGGGGCAAAGTCTGAGGG + Intergenic
965093879 3:164197271-164197293 AGCAGTTGGGCAAAGACTATGGG - Intergenic
967868898 3:194213236-194213258 AGCAGCTGGGTGGAGTCTGTTGG + Intergenic
968286585 3:197512594-197512616 AGCAGCAGGGCACAGTGTAATGG + Intronic
969366071 4:6694826-6694848 AGCAGGTAGGCAGAGTCTGGTGG - Intronic
969625674 4:8304132-8304154 AAGAGCTGGGCAAAGGCTCAGGG + Intronic
969663734 4:8545161-8545183 AGCAGCTGGGAAAAGTCCTAAGG - Intergenic
970134985 4:12912589-12912611 AACAGCAGAGCACAGTCTGAAGG + Intergenic
970646342 4:18125472-18125494 AGCCCCTGGACATAGTCTGAAGG - Intergenic
971474097 4:27056362-27056384 AGCAGCTGAACAAATTCTCAGGG - Intergenic
974819493 4:67047411-67047433 AGCATCTGGTCAATGTCTTAAGG - Intergenic
976865285 4:89718166-89718188 AGCAGCTAGCCAAAGTTTGAGGG - Intergenic
977708737 4:100100304-100100326 AGAAGCTGGGAAAAGATTGAGGG - Intergenic
980471263 4:133255201-133255223 AGCAGCTGGGAACAGGATGAAGG - Intergenic
981766731 4:148259284-148259306 ACCATCTGGTCTAAGTCTGATGG + Intronic
982890475 4:160843082-160843104 ACCATCTGGGAAGAGTCTGATGG + Intergenic
986217479 5:5733071-5733093 AGCAGTTTGGCAATTTCTGAAGG - Intergenic
988878385 5:35473315-35473337 AGCAGCTGAACAAAGTTTGGAGG - Intergenic
988938354 5:36114287-36114309 AGAAGCTGGGGATAGTTTGAAGG - Intronic
988943522 5:36170413-36170435 AGCTGCTTAGCAAAGTCTGCAGG - Exonic
991225292 5:64263515-64263537 AACAGCTAAGCAAAATCTGAAGG - Intronic
991986186 5:72289092-72289114 AACAGCTGGGCCAAGGCAGATGG - Intronic
992705402 5:79386451-79386473 AGAAGCTGGGAAAGGTGTGATGG + Intronic
993262429 5:85675901-85675923 GGAAGCTGGGCAGAGTCCGAGGG - Intergenic
996075815 5:119192418-119192440 AGCAGCTGGAAAAAGTTTCAGGG - Intronic
996977925 5:129457529-129457551 AGCAGCTGGGAAAAATATGTTGG - Intergenic
998174239 5:139891723-139891745 AGAAGATGGGCAGGGTCTGAGGG + Intronic
1000682983 5:164209913-164209935 AGAAGCTGGACAAAGCCTGGTGG + Intergenic
1001006373 5:168054280-168054302 AGCAGCAGGGTGAAGGCTGATGG + Intronic
1002628382 5:180550017-180550039 TGAAGCTTGGCAATGTCTGAAGG - Exonic
1003460597 6:6324519-6324541 GGCACTTGGGCAAAGTCTGGAGG + Intergenic
1003527108 6:6907481-6907503 AGAAGCTCTGCAAATTCTGAAGG - Intergenic
1005245647 6:23881453-23881475 AGCAGTAGGTCAAAGTATGAAGG - Intergenic
1005417400 6:25614919-25614941 AGGAGCTGGTCAAATTTTGATGG + Intronic
1006368276 6:33628738-33628760 AGCAGGTGGGCAGAGCCGGAAGG + Intronic
1007478149 6:42132929-42132951 AGGAGCTAGGCCAGGTCTGAGGG - Intronic
1007555497 6:42762283-42762305 CAGAGCTGGGCAAACTCTGAGGG + Intronic
1008869672 6:56258334-56258356 AGTAGCTGGGCAGAGGCTGAAGG - Intronic
1010532127 6:76981389-76981411 AGCAGCTGGGAAATACCTGAAGG - Intergenic
1010790996 6:80065150-80065172 AGCAGCCGGAGAAATTCTGAAGG - Intergenic
1011641868 6:89423499-89423521 GGCAGCTAGGCAAGGCCTGAGGG - Intergenic
1015155696 6:130093222-130093244 AGAAACTGGGCAAAGTGTGAAGG + Intronic
1019223030 6:170489914-170489936 AGCAGCTGGGTGAAGACTAAAGG - Intergenic
1020140153 7:5607437-5607459 AGCAGCTGCGAGAAGACTGAGGG + Intergenic
1021059682 7:16095843-16095865 AGGAGCTGGCCAAGGACTGAAGG - Intronic
1021931336 7:25584279-25584301 AGCAGATGGGAAAACTGTGATGG - Intergenic
1022529749 7:31059597-31059619 AGCAGCTTGGGAGAGTCTGGAGG + Intronic
1023091688 7:36623824-36623846 AGAAGCTGGGAAAAGTCTGGTGG - Intronic
1024830301 7:53446323-53446345 AGCCGTTTGGCAAAGACTGAGGG - Intergenic
1028284190 7:88974925-88974947 AGAAGCTGGGAAAAGTCAGGGGG - Intronic
1031586751 7:123539644-123539666 AGCAACTGGGAAAAGACTGAAGG + Exonic
1032070886 7:128806014-128806036 TGCAACTGGGCACAGTCTGCTGG + Intronic
1033271386 7:139935970-139935992 AGCAGATGGGCAAGCTCTGGTGG - Intronic
1034256955 7:149729929-149729951 AGCAGCTTTGGAAAGTCTGCTGG - Intronic
1034330804 7:150280551-150280573 AGAAGATGGGCAAGCTCTGAAGG + Intronic
1034637288 7:152577345-152577367 AGAAGCTGGCCACAGTATGAGGG + Intergenic
1034667239 7:152829298-152829320 AGAAGATGGGCAAGCTCTGAAGG - Intronic
1034807785 7:154103877-154103899 AGCCTCTGGCCACAGTCTGAAGG + Intronic
1034873692 7:154706199-154706221 AGCAGCTGGGCCAAGGCAGGCGG - Intronic
1036743910 8:11390694-11390716 AGAGGCTGGGCAAAGGCAGAGGG + Intronic
1039702005 8:39971546-39971568 AGAATCTGGGCAAAGTCAAATGG + Intronic
1040433409 8:47366188-47366210 AGCAGCTGAACAGAGGCTGAAGG + Intronic
1041962465 8:63634096-63634118 AGCAGCTGTGCTAATTCTAAAGG - Intergenic
1042530532 8:69810310-69810332 AGCAGCAGGGCAAAGCAAGATGG + Intronic
1043014648 8:74922973-74922995 AGCAAGTGGACAAAATCTGAGGG + Intergenic
1043581568 8:81721297-81721319 AGGGGCGGGGCAAAGCCTGAGGG + Exonic
1044090514 8:87994692-87994714 ATCAGCTGGGCAAAGTTTGCCGG - Intergenic
1046289598 8:112139434-112139456 AGCAGATGGCCACAGTCAGATGG - Intergenic
1048204569 8:132405048-132405070 ACAATCTGGGCAAAGTGTGAGGG + Intronic
1049408768 8:142463273-142463295 ACCAGCTGGGCACAGGCTGCTGG + Intronic
1049450691 8:142659931-142659953 AACAGATGTGCAAGGTCTGAGGG + Intronic
1049460949 8:142727512-142727534 AGCAGCAGGTCCAAGTCCGAGGG - Exonic
1050289451 9:4138975-4138997 AGAAGCAGAGCAAAGGCTGAAGG + Intronic
1053886631 9:42649196-42649218 GGCATCTGGGCAAGGTCTGCTGG + Intergenic
1054225650 9:62456646-62456668 GGCATCTGGGCAAGGTCTGCTGG + Intergenic
1056762673 9:89426157-89426179 TGCAGCTGGGCTGAGTCTGAGGG - Intronic
1056922635 9:90805161-90805183 GGCAGCTGGCCAAAGGCAGATGG + Intronic
1057082174 9:92181274-92181296 AGCAGGTAGGCAAAGTGTGCTGG + Intergenic
1057196546 9:93118838-93118860 ACCAACTGGGCAGAGTGTGATGG - Intergenic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1058211813 9:102178045-102178067 AGCAGCAGGGCTAAGCCTCAAGG + Intergenic
1059409516 9:114123395-114123417 AGCATCTGGGCCTTGTCTGAAGG - Intergenic
1059472123 9:114513418-114513440 ACCAGGTGGGCAAAGTGGGAAGG + Intergenic
1059813730 9:117887525-117887547 TGCAGCTGGGAAAAGTATAAGGG - Intergenic
1060411307 9:123402287-123402309 ACTTTCTGGGCAAAGTCTGAGGG + Intronic
1185949573 X:4416511-4416533 AGCAGCTGAGCAACGTAAGAAGG - Intergenic
1186123373 X:6386294-6386316 AGAAGCTTGTCAAAGCCTGAGGG + Intergenic
1189608315 X:42703836-42703858 AGCAGCTCTGCAAACTATGAGGG - Intergenic
1191001315 X:55662631-55662653 GGCCACTGGGCAAAGTCTGGTGG - Intergenic
1191031826 X:55981898-55981920 AGCAGCTAAGCTAAGTTTGAGGG + Intergenic
1192219373 X:69186777-69186799 AGCACTGGAGCAAAGTCTGAGGG + Intergenic
1195708853 X:107758220-107758242 CACTGCTGGGCAAAGTGTGATGG - Intronic
1195801962 X:108722713-108722735 ATCAGCTGGGCAAAGACACAAGG + Intronic
1196108349 X:111919633-111919655 AGCAGCTGGGCAAAATTATAAGG + Intronic
1196809388 X:119616700-119616722 AGCAGCTGCACTAAGTCTAAAGG - Intronic
1198257444 X:134936759-134936781 AGCAGCTGAACAAGGTCAGAAGG + Intergenic
1201605094 Y:15775328-15775350 AGAAGCTTGTCAAAGCCTGAGGG + Intergenic