ID: 1106704847

View in Genome Browser
Species Human (GRCh38)
Location 13:32269401-32269423
Sequence GGCCAATCAGCCAGGCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1307
Summary {0: 1, 1: 1, 2: 9, 3: 145, 4: 1151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106704842_1106704847 2 Left 1106704842 13:32269376-32269398 CCTGCTTAGTAACCCTTAAGAAT 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1106704847 13:32269401-32269423 GGCCAATCAGCCAGGCACAGTGG 0: 1
1: 1
2: 9
3: 145
4: 1151
1106704841_1106704847 5 Left 1106704841 13:32269373-32269395 CCTCCTGCTTAGTAACCCTTAAG 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1106704847 13:32269401-32269423 GGCCAATCAGCCAGGCACAGTGG 0: 1
1: 1
2: 9
3: 145
4: 1151
1106704844_1106704847 -10 Left 1106704844 13:32269388-32269410 CCCTTAAGAATCAGGCCAATCAG 0: 1
1: 0
2: 0
3: 13
4: 123
Right 1106704847 13:32269401-32269423 GGCCAATCAGCCAGGCACAGTGG 0: 1
1: 1
2: 9
3: 145
4: 1151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106704847 Original CRISPR GGCCAATCAGCCAGGCACAG TGG Intronic