ID: 1106705597

View in Genome Browser
Species Human (GRCh38)
Location 13:32275742-32275764
Sequence CATCATTTGCAGTTTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106705597_1106705603 24 Left 1106705597 13:32275742-32275764 CCCAGCTCAAACTGCAAATGATG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1106705603 13:32275789-32275811 CTCTGGCTGACGGTAATTCATGG 0: 1
1: 0
2: 0
3: 2
4: 56
1106705597_1106705602 14 Left 1106705597 13:32275742-32275764 CCCAGCTCAAACTGCAAATGATG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1106705602 13:32275779-32275801 TCAAAACAGTCTCTGGCTGACGG 0: 1
1: 0
2: 1
3: 15
4: 183
1106705597_1106705601 7 Left 1106705597 13:32275742-32275764 CCCAGCTCAAACTGCAAATGATG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1106705601 13:32275772-32275794 GGGATAATCAAAACAGTCTCTGG 0: 1
1: 0
2: 3
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106705597 Original CRISPR CATCATTTGCAGTTTGAGCT GGG (reversed) Intronic
906333713 1:44909757-44909779 CTTAATTTGCAGTTTGGGATGGG - Intronic
906896902 1:49784448-49784470 CATCATTTGTGGTTTGAGGAAGG - Intronic
911194558 1:94980544-94980566 CATCTTCTTCAGTTTGAGTTGGG + Exonic
912160596 1:106980290-106980312 CATCATTTGCAATGTGATATAGG + Intergenic
914425373 1:147571151-147571173 CAGCATTTGCAGTGTGTGATCGG + Intronic
917531778 1:175842338-175842360 GATCAATTGCAATTTGTGCTGGG + Intergenic
920429474 1:205907820-205907842 CTTCATTTGCTGTTTGCCCTTGG + Intergenic
924747495 1:246849945-246849967 CAACATTTTCACTTTTAGCTGGG + Exonic
1063667843 10:8075515-8075537 CATCAGCTGCAGTTTGCGCCTGG - Intergenic
1065128759 10:22599774-22599796 CAGCTTTTGTGGTTTGAGCTAGG - Intronic
1065187041 10:23178553-23178575 CATCATTTTAAATTTGAGCAGGG + Intergenic
1066153861 10:32653729-32653751 CAACATTTGTAATTTGAGATGGG - Intronic
1067899852 10:50228322-50228344 CAGCATTTGCAATTTGAGTGGGG + Intronic
1067973058 10:50992920-50992942 GATCATTTGCTGTCTGAGTTTGG + Intronic
1069180044 10:65347615-65347637 TATGATTTTCAGTATGAGCTTGG - Intergenic
1069197244 10:65568004-65568026 CATAATTTTTAGTTTGGGCTGGG - Intergenic
1070807286 10:79278007-79278029 GGTCATTTGCAGTCAGAGCTCGG + Intronic
1072748506 10:97959068-97959090 CAGCCTTTGCAGTTAGACCTGGG + Intronic
1074088180 10:110224524-110224546 CATCATTGACATTTTGATCTGGG - Intronic
1074437179 10:113444094-113444116 CATCATTTAGAGGTTGTGCTTGG + Intergenic
1074800401 10:116994778-116994800 CATCATTTACAATTTGATTTTGG - Intronic
1075688993 10:124383015-124383037 CATCATGTGAAGTTGGTGCTAGG + Intergenic
1077746543 11:4913495-4913517 TAGTATTTGCAGTTTGGGCTTGG - Intronic
1080183371 11:29450089-29450111 CATCATTTGCTGCATCAGCTTGG + Intergenic
1081188485 11:40074744-40074766 CATTATTTGCAGTTTGACCAGGG - Intergenic
1081500755 11:43664292-43664314 TCTCATTTGCAGTTTGAGTAAGG + Intronic
1085170736 11:74447645-74447667 CAGCATTTTCATTTTGTGCTGGG + Intergenic
1085314204 11:75534435-75534457 CATCATTTGCCTTTTTTGCTGGG - Intergenic
1085996954 11:81929431-81929453 CATCCTTAGAAGTCTGAGCTCGG + Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1087921366 11:103870442-103870464 TAACTTTTGCAGTTTGAGGTGGG + Intergenic
1088319205 11:108537675-108537697 AATAATTTGCAATATGAGCTTGG + Intronic
1088545765 11:110957213-110957235 CCTCATTAGCAGCTTGTGCTAGG - Intergenic
1091030525 11:132183366-132183388 CATCGTTTCCACTTTGTGCTTGG + Intronic
1091030586 11:132184041-132184063 CATCGTTTCCAGTTTGTGCTTGG - Intronic
1092044952 12:5425083-5425105 CATTATTTGCATTCTGAACTGGG + Intergenic
1092566244 12:9668656-9668678 CATCATTTCTAGTTTGTCCTAGG - Intronic
1093067551 12:14674282-14674304 AAACATTTGCAGTTTGATTTGGG - Intronic
1097144083 12:56927832-56927854 CATCATTTGCAGTCTGGGTCAGG + Intronic
1097589752 12:61560347-61560369 CAACATTTACAGTTTGAGAAAGG + Intergenic
1098188142 12:67920431-67920453 CATTATTTGCATTTTTATCTTGG - Intergenic
1101602867 12:106225553-106225575 CATCATTTGCATTTATAGGTGGG + Intergenic
1104867169 12:131963339-131963361 CAAGGTTTGCAGTTTGAGTTAGG + Intronic
1105667224 13:22573908-22573930 CCTCATTTGCTGTCTGAGGTTGG - Intergenic
1106705597 13:32275742-32275764 CATCATTTGCAGTTTGAGCTGGG - Intronic
1110617993 13:77562500-77562522 AATGAAGTGCAGTTTGAGCTGGG - Intronic
1111609754 13:90588353-90588375 CTTCATTTGCAGTTAGAGAAGGG - Intergenic
1112676960 13:101712874-101712896 CATCCTTTGCAGACTGACCTGGG + Exonic
1120474137 14:84966177-84966199 CATCATTTCCTGTTTGCGATTGG - Intergenic
1121077573 14:91082094-91082116 CATCTTTTGGAGTTGGAGATTGG + Intronic
1121773242 14:96571571-96571593 CAGCAGTTGAAGTTTTAGCTTGG + Intergenic
1126218816 15:46188113-46188135 CATAGTTCGCAGTTTGAGATAGG - Intergenic
1128390684 15:67180589-67180611 CATCATCTGCAGACTGAGCCTGG - Intronic
1129764160 15:78150326-78150348 CATCATTTGCTATGTGACCTTGG - Intronic
1131614975 15:94006599-94006621 AATCAATTGCAGTTTTAGGTTGG - Intergenic
1132234685 15:100210480-100210502 CCTCATTTGCTGTTTGACCTCGG - Intronic
1134511154 16:14848241-14848263 CAGCATTTCCAGCTTTAGCTCGG + Intronic
1134698797 16:16246737-16246759 CAGCATTTCCAGCTTTAGCTCGG + Intronic
1134721632 16:16387422-16387444 CATCATGTCCATTTTGAGATGGG - Exonic
1134945794 16:18324453-18324475 CATCATGTCCATTTTGAGATGGG + Exonic
1134973037 16:18547936-18547958 CAGCATTTCCAGCTTTAGCTCGG - Intronic
1140571113 16:76107384-76107406 CGTGATTGGCAGCTTGAGCTGGG + Intergenic
1151135488 17:71942593-71942615 CTTCAGTTGCAGTTTGTGCTGGG + Intergenic
1152169606 17:78735628-78735650 GATCATTTGCACTTAGAGGTGGG + Intronic
1156389884 18:36640472-36640494 CTTAAATTGCAGTTTGATCTTGG - Intronic
1156891966 18:42200905-42200927 TATAGTTTGCAGTTTAAGCTAGG + Intergenic
1161751332 19:6099334-6099356 CTTCATTTGCAATTTTGGCTGGG + Intronic
1162349082 19:10137999-10138021 CCTCTGTTGCAGGTTGAGCTCGG - Exonic
928526259 2:32144588-32144610 AATAATTTGCTGTTTCAGCTGGG + Intronic
933195407 2:79383716-79383738 CATCATATCCAATTTGACCTTGG + Intronic
933592270 2:84246209-84246231 CATCTCTTGCTGTTTGAGCTGGG - Intergenic
935151635 2:100442094-100442116 CATTCTTAGCAGTTTGAGATTGG - Intergenic
935925202 2:108060722-108060744 CTTAATTTGCAGTGTGACCTTGG + Intergenic
936478320 2:112861236-112861258 CATAATTTGTAGTTTGATTTTGG - Intergenic
941118569 2:161501620-161501642 CAACATTTTCACTTTTAGCTGGG + Intronic
942204163 2:173602899-173602921 CAGTATTTGCATTTTGAACTGGG + Intergenic
944349782 2:198713304-198713326 CAGCATTTGCATTTTGGGCCAGG - Intergenic
946227336 2:218270924-218270946 GATAATTAGCAGTTTGACCTTGG + Intronic
946807777 2:223488961-223488983 GATGATTTACAGTTTGAGTTTGG - Intergenic
1169166914 20:3431989-3432011 CATCTTTTTCTGTTTGAGCTGGG + Intergenic
1170067325 20:12327066-12327088 TATGATTTGCAGTTTTATCTTGG + Intergenic
1171021498 20:21588301-21588323 CACCATTGACAGTTTGGGCTGGG - Intergenic
1174181255 20:48676423-48676445 CATCACTTGCAGTGTGACCGAGG + Intronic
1181864739 22:25846264-25846286 CACCATCTGCAGCTTGATCTGGG - Exonic
1181965401 22:26653065-26653087 CATCCTTTGCAGTTCATGCTTGG - Intergenic
1183560195 22:38566555-38566577 CATTCTTTGCTGTTTTAGCTTGG - Intronic
1184583275 22:45431056-45431078 CAGCATTTGCAGTGAGTGCTGGG + Exonic
952375193 3:32761310-32761332 CAACATTGGCATTTTGAGTTGGG - Intronic
956059070 3:65331528-65331550 CATCATTGAAAGTTAGAGCTGGG - Intergenic
956487103 3:69734470-69734492 CATCTTTTGCAGTTAAGGCTTGG + Intergenic
957421695 3:79979623-79979645 ACTCAGTTGCAGTTTCAGCTTGG - Intergenic
960860629 3:122149126-122149148 AATCATATGCATTTTGAGCTGGG - Intergenic
960887447 3:122410564-122410586 TCTCATTTACAGTTTGACCTTGG + Exonic
964405680 3:156346534-156346556 CATGATTTGCACTTTAATCTTGG - Intronic
964625947 3:158760146-158760168 CATCATTGGCAGTGTGGGCTGGG + Intronic
968858506 4:3147848-3147870 CATCAGTTTCAGTTTGAGTTTGG + Intronic
969999386 4:11349429-11349451 CATCATTTGAAGTGTGACCTAGG + Intergenic
978120900 4:105078278-105078300 CTTTATTTGCACTTTGAACTTGG - Intergenic
979827961 4:125263551-125263573 CTTTATTTGCAGTTTAAGCATGG - Intergenic
979973862 4:127171390-127171412 CAGCATTTGCTGTTTCATCTTGG - Intergenic
980000490 4:127481856-127481878 CAGAATTTGCAGTTACAGCTTGG - Intergenic
980158907 4:129136871-129136893 TACCATTTGGAGTTTGAACTTGG + Intergenic
983049619 4:163030694-163030716 CAACAATTGAAGTGTGAGCTGGG - Intergenic
986468335 5:8049658-8049680 CAGAATTTGCAGTTTGAGGCTGG + Intergenic
988670473 5:33375900-33375922 CATCATTAGCTGTGTGACCTGGG - Intergenic
990604741 5:57397191-57397213 CTTCATTTGGAGTTTGCGTTGGG + Intergenic
993365256 5:87027457-87027479 CTTCAGTTCCACTTTGAGCTTGG + Intergenic
995242548 5:109901446-109901468 CATCATTTTCATTTTGCACTGGG + Intergenic
998134388 5:139667081-139667103 CATCATGGGCAGGCTGAGCTGGG + Intronic
1004926839 6:20424077-20424099 CAGCTTTTACAGTTTGAGTTTGG + Intronic
1007883041 6:45188380-45188402 CATAACTTGCAGTTTGAGGTGGG - Intronic
1008413334 6:51209522-51209544 CATTATTTGCAGATTGAGAATGG - Intergenic
1014259735 6:119203104-119203126 CCTCATGGGCAGTTTGATCTTGG + Intronic
1014906428 6:127035003-127035025 CTGCATTTGCATCTTGAGCTTGG + Intergenic
1016789614 6:148054504-148054526 CATCAGCTGCAGTCTTAGCTGGG + Intergenic
1017351280 6:153444998-153445020 CATAATTTGTAGTTTGATTTTGG + Intergenic
1017895381 6:158674922-158674944 CCTCATTTACAGTTTCTGCTTGG + Intronic
1018708934 6:166483824-166483846 CATCATTTTCTGTTTGAGTGAGG - Intronic
1020473582 7:8567887-8567909 AATCATAGGCAGTCTGAGCTAGG + Intronic
1021828546 7:24578933-24578955 CATGATTTGCAGTTTGATTGAGG + Intronic
1022405981 7:30090522-30090544 TATAATTTCCAGTTTGACCTTGG - Intronic
1026130536 7:67616955-67616977 GATCAAGTGCAGTTTGACCTCGG - Intergenic
1026322457 7:69279658-69279680 GATCAAGTGCAGTTTGACCTTGG + Intergenic
1028241889 7:88431687-88431709 TAACATTTTTAGTTTGAGCTGGG + Intergenic
1032452037 7:132039992-132040014 CACCATTGGCATTTGGAGCTAGG - Intergenic
1035711147 8:1715604-1715626 CAGAACTTGCAGTGTGAGCTGGG - Intergenic
1038903966 8:31876355-31876377 CATCAATTTCTGTTTGAGGTTGG + Intronic
1041280252 8:56201184-56201206 CATCAGTGGCATTTTTAGCTTGG + Intronic
1044458268 8:92414243-92414265 CATTATTGGCATTGTGAGCTTGG + Intergenic
1044478831 8:92660856-92660878 CATCATTTGGGGTGAGAGCTGGG + Intergenic
1052596487 9:30566620-30566642 CATCATCTGAAATTTGGGCTTGG - Intergenic
1055898966 9:81212676-81212698 CAGGATTGGCACTTTGAGCTGGG + Intergenic
1057269345 9:93639986-93640008 CTTCATTTGCTGTTTGGTCTTGG + Intronic
1058468260 9:105250482-105250504 CTTTCTTTGCAGTTTGAGCAGGG - Intronic
1058949103 9:109886603-109886625 GATCATTTGCTGTGTGACCTTGG + Intronic
1061012186 9:127962242-127962264 CTTCATTTGCAATTTGATGTGGG - Intronic
1186402515 X:9272852-9272874 CCTCATTTTCAGTGTGACCTTGG - Intergenic
1186498894 X:10035024-10035046 CATCATTTCTATTTTGAGGTCGG + Intronic
1186872744 X:13788598-13788620 CATCATTTGGAGTTAGGGTTAGG + Intronic
1187202715 X:17150699-17150721 CATCATTTGCAGTTTGCATGTGG + Exonic
1187607983 X:20906850-20906872 CACAATTGGCAGTTTGGGCTGGG - Intergenic
1188528311 X:31109731-31109753 CTTCAGTTGCATTTTGAGTTGGG + Intronic
1195347419 X:103963997-103964019 CATCATTTGCCGTTTCTGATAGG - Exonic
1195360023 X:104074844-104074866 CATCATTTGCCGTTTCTGATAGG + Intergenic
1198005307 X:132488095-132488117 CATCGTTTGTAAATTGAGCTGGG - Intronic
1199443434 X:147895150-147895172 CAACATTAGCATTTGGAGCTGGG - Intergenic
1199472616 X:148211525-148211547 CATTCTTTGCTGTTTGAACTAGG + Intergenic
1201339699 Y:12921075-12921097 TATCCTTTGCAGTTTGAGGTTGG - Intergenic