ID: 1106706658

View in Genome Browser
Species Human (GRCh38)
Location 13:32287741-32287763
Sequence GTGAGCAATGCTAATACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106706658 Original CRISPR GTGAGCAATGCTAATACTGC TGG Intronic
900805893 1:4768204-4768226 GTGAGCAGTACTAGTGCTGCAGG + Intronic
901226276 1:7614597-7614619 GTGAGGAATGTTAATAACGCGGG - Intronic
901521610 1:9789114-9789136 GTGAACAATGCTGCTAATGCTGG + Intronic
909174085 1:72333421-72333443 GTCAGCAATGTTAATATTCCAGG - Intergenic
910864852 1:91779049-91779071 GTGAGCAATGGTGAGAGTGCTGG + Intronic
911810154 1:102265820-102265842 CAGAGCATTGCTAATAATGCTGG + Intergenic
912542351 1:110426571-110426593 GTTGGCATTGCTAATACTGGGGG - Intergenic
915583442 1:156830046-156830068 GAGAGCAATGCTTAGACAGCGGG - Intronic
916881004 1:169019393-169019415 GTGAGGAATCTTAATCCTGCAGG - Intergenic
917972147 1:180215458-180215480 GTGAGCCATGATTATACTACTGG + Intergenic
919994629 1:202737384-202737406 GTTGCCGATGCTAATACTGCTGG + Intronic
920448845 1:206041704-206041726 GTGAGGAATGCTATGATTGCAGG + Intronic
922608203 1:226904345-226904367 GTGAGCAGTGCTAAATATGCAGG - Intronic
924792478 1:247265764-247265786 GTGAGCCAAGCTCATACTACTGG - Intergenic
1064670579 10:17709725-17709747 CTGGGCAATCCTAACACTGCTGG - Intronic
1070063591 10:73010800-73010822 GTGAGCCATGTTTATACTGCTGG + Intronic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1080693722 11:34582622-34582644 TGGAGAAATGCTAATAATGCAGG - Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1107245086 13:38284200-38284222 GTCAGAAATGCAAATACTGTTGG - Intergenic
1107489935 13:40872084-40872106 GTGAGCCATGCTTATACCACTGG - Intergenic
1109857390 13:68149458-68149480 GTGAGCAATATGAGTACTGCTGG + Intergenic
1111400988 13:87734752-87734774 ATCAGCAATGCTAATATAGCTGG + Intergenic
1113195115 13:107794364-107794386 CTGAGCAATTCTAATAGTACCGG - Intronic
1114355431 14:21903052-21903074 CTGAGCAATGGAAACACTGCAGG - Intergenic
1117485491 14:56192691-56192713 GTGAGCGATGAGAAAACTGCGGG - Intronic
1121771387 14:96545429-96545451 GTCACCAATGCTAACGCTGCTGG - Intronic
1122213807 14:100190372-100190394 GTGAGCAATGATGATGCCGCAGG - Intergenic
1122411020 14:101526259-101526281 GTGAGCATTCCTGGTACTGCTGG + Intergenic
1125952023 15:43760333-43760355 GTGAGCAATGATCATGCCGCTGG + Intronic
1128023182 15:64411367-64411389 GTGAGGGATGCTAATAATGGGGG + Intronic
1129302537 15:74633828-74633850 CTGAGAAATGCTAATACTCTAGG - Intronic
1132511203 16:342457-342479 GTGAGCATTGCTACCACAGCAGG - Intronic
1135941000 16:26821876-26821898 CTGAGTAATGCTGATGCTGCTGG + Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1149551334 17:57542430-57542452 GTGACCAATGCTAAGGCTGTGGG - Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151451638 17:74201605-74201627 GTGCTCAATGCTAACATTGCAGG - Intergenic
1154336682 18:13471563-13471585 GAGAGTAATGCTGATGCTGCTGG + Intronic
1155908933 18:31486703-31486725 GCGGGCATTGCTAAGACTGCCGG - Intergenic
1157743612 18:50115416-50115438 GTGAGGAATGCAAGTTCTGCAGG - Intronic
925312273 2:2893445-2893467 GTAATCAATGATAATAATGCAGG - Intergenic
929045867 2:37788637-37788659 GTGAGCAATAGAAATACTACTGG + Intergenic
929216445 2:39418615-39418637 GTGATCAAAGTTAACACTGCCGG + Intronic
930920754 2:56750744-56750766 GTCAGCAATGGTAATCTTGCTGG - Intergenic
934872945 2:97884723-97884745 GTAAGTAATGCTACTCCTGCTGG + Intronic
936974736 2:118207756-118207778 CAGAGCAATGCAGATACTGCTGG + Intergenic
942337108 2:174900446-174900468 GTGAGCTATGATCATACTCCAGG + Intronic
943027165 2:182643650-182643672 AAGAGCAATGCTAATAGTTCTGG - Intergenic
947226584 2:227846332-227846354 GTGAGCTATGATCACACTGCTGG - Intergenic
1169171860 20:3471484-3471506 GCGAGCAATGCCAGCACTGCGGG + Exonic
1171557968 20:26095546-26095568 GTCAGCAATGCTACTACAGGGGG - Intergenic
1173026209 20:39309811-39309833 CTGAGTGATGCTAATGCTGCTGG + Intergenic
1173155405 20:40604453-40604475 GTGAGCAATAATAATCCTACTGG + Intergenic
1175526722 20:59639339-59639361 GTGGGAAATGCTCATCCTGCAGG - Intronic
1175877146 20:62235748-62235770 CTGAGAAATGCTCATCCTGCAGG - Intronic
1177189199 21:17831040-17831062 GTCAGCTATGCAAATACTGCAGG + Intergenic
1181300116 22:21873906-21873928 GTGAATAATGCTGATGCTGCTGG - Intergenic
949409927 3:3752738-3752760 ATTAGCAATGCTAATCCTGGAGG - Intronic
950975154 3:17233623-17233645 GTAGGCAATGATAATACTGTAGG + Intronic
952172480 3:30823304-30823326 GTGAGAAGTGATAATACTCCAGG - Intronic
952285190 3:31961535-31961557 GTTAATAATGCTAATAATGCTGG + Intronic
955444422 3:58994275-58994297 GTGAGCAATGAGAGCACTGCAGG - Intronic
962536087 3:136329790-136329812 TTGGGCACTGCTTATACTGCTGG + Intronic
962930288 3:140029672-140029694 ATGAGAAATGCTTATACAGCAGG + Intronic
970320954 4:14874930-14874952 GTGAGAAATGCTATAACTCCTGG + Intergenic
975457483 4:74609269-74609291 GTGAGCAAAGGTATGACTGCAGG - Intergenic
976501856 4:85799760-85799782 GTGATCAAAGTTAATACTACTGG + Intronic
981812114 4:148787918-148787940 GTGTTCAATGCAAATTCTGCTGG - Intergenic
990856667 5:60274893-60274915 GTCACAGATGCTAATACTGCTGG - Intronic
991035609 5:62124562-62124584 CTGAGCAATGGTGATGCTGCGGG - Intergenic
991243654 5:64486421-64486443 GTGAACAATGCCAACACTCCTGG - Intergenic
993058761 5:83013913-83013935 GTAAGAAATTCTTATACTGCTGG + Intergenic
994087035 5:95770433-95770455 GTGACCACTGCTAAGAATGCAGG + Intronic
996087818 5:119322265-119322287 GTGAGCACTGCTGATGGTGCTGG - Intronic
998601078 5:143585699-143585721 ATGAGAAATGCTAAGATTGCTGG + Intergenic
1000169593 5:158689127-158689149 GTGAGCAATTCTATTTCAGCAGG + Intergenic
1007212707 6:40208349-40208371 CTGAGCGATGCTGATGCTGCTGG - Intergenic
1010622503 6:78093528-78093550 GTTAGCAATGCTTATACCTCAGG - Intergenic
1011609423 6:89136018-89136040 GTGGGCAATAAGAATACTGCTGG + Intergenic
1017784300 6:157742088-157742110 GTTAGCAGTGCTATTACTGCTGG - Intronic
1019652026 7:2165040-2165062 GTGGGCAATACAAATACGGCTGG + Intronic
1024201048 7:47106046-47106068 GTGAGCAGTGCTCACACAGCTGG + Intergenic
1026583585 7:71637789-71637811 GTGAGCAGTGCTAATATTGCTGG + Intronic
1031388356 7:121181136-121181158 GTGAGAGATGATCATACTGCAGG + Intronic
1035327559 7:158074798-158074820 ACGAGCAATGCTGATCCTGCTGG - Intronic
1038072347 8:24031019-24031041 GTGAGCATTGCTGAGACTGGGGG + Intergenic
1043006814 8:74830095-74830117 GTAAGCAATGCCAATCCTTCAGG + Intronic
1058115068 9:101076119-101076141 GTGAGTAATGCAAATTCTCCAGG + Intronic
1058127058 9:101207322-101207344 GAGGGCAATAATAATACTGCAGG - Intronic
1060211345 9:121712383-121712405 GGGAGCAATGCTTATGCAGCAGG + Intronic
1186845889 X:13530719-13530741 ATTAGCAATGCAAATCCTGCTGG + Intergenic
1187420684 X:19131067-19131089 TTGAGCAATGCTGATGCTGCTGG + Intergenic
1196639923 X:118047014-118047036 GTGAGGAATGCAAATACAGCAGG + Intronic
1198087027 X:133291595-133291617 GTGATCAATGCCTATATTGCAGG - Intergenic
1199070794 X:143473046-143473068 GTGTGTATTGCTAATTCTGCTGG + Intergenic
1199240998 X:145547348-145547370 TTGAGTGATGCTGATACTGCAGG + Intergenic
1200829699 Y:7678744-7678766 CTGTGCACAGCTAATACTGCTGG + Intergenic