ID: 1106708983

View in Genome Browser
Species Human (GRCh38)
Location 13:32311413-32311435
Sequence GCCAGCCGCAGCCACCATCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106708983_1106708988 -3 Left 1106708983 13:32311413-32311435 CCGTGATGGTGGCTGCGGCTGGC 0: 1
1: 0
2: 3
3: 17
4: 197
Right 1106708988 13:32311433-32311455 GGCTGGCCTCCGCAGGGCCCGGG 0: 1
1: 0
2: 3
3: 47
4: 427
1106708983_1106708985 -10 Left 1106708983 13:32311413-32311435 CCGTGATGGTGGCTGCGGCTGGC 0: 1
1: 0
2: 3
3: 17
4: 197
Right 1106708985 13:32311426-32311448 TGCGGCTGGCTGGCCTCCGCAGG 0: 1
1: 0
2: 0
3: 13
4: 162
1106708983_1106708987 -4 Left 1106708983 13:32311413-32311435 CCGTGATGGTGGCTGCGGCTGGC 0: 1
1: 0
2: 3
3: 17
4: 197
Right 1106708987 13:32311432-32311454 TGGCTGGCCTCCGCAGGGCCCGG 0: 1
1: 0
2: 1
3: 20
4: 262
1106708983_1106708986 -9 Left 1106708983 13:32311413-32311435 CCGTGATGGTGGCTGCGGCTGGC 0: 1
1: 0
2: 3
3: 17
4: 197
Right 1106708986 13:32311427-32311449 GCGGCTGGCTGGCCTCCGCAGGG 0: 1
1: 0
2: 1
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106708983 Original CRISPR GCCAGCCGCAGCCACCATCA CGG (reversed) Exonic
900601836 1:3506059-3506081 TCCACCCGCTGCCACCACCATGG + Intronic
900922399 1:5681747-5681769 CCCAGCCCCACCCACCCTCAAGG + Intergenic
901024931 1:6274129-6274151 GGGAGCAGCAGGCACCATCATGG + Intronic
901840336 1:11950221-11950243 GCCAGCCTGGGCCACCATCTGGG - Intronic
902620631 1:17648704-17648726 GGGAGCCGCAGCCACCTTCGAGG - Intronic
902628545 1:17690785-17690807 GCCAGCCCCAGCCACCATGCTGG + Intronic
902719358 1:18293808-18293830 GCCACCCGCTGCCACCAGCAAGG + Intronic
903796648 1:25934012-25934034 GCTAGCCGAAGCCACCTTCCAGG - Intergenic
904248100 1:29202523-29202545 GACAGCCACAGCCACATTCATGG + Intronic
904378608 1:30096677-30096699 GCCAGCCACAGCTACCATATGGG + Intergenic
906208860 1:44001194-44001216 GCCAGCCACAGCCACGCCCAAGG + Exonic
906298151 1:44661819-44661841 ACCAGCCGCCACCACCACCAGGG + Intronic
911298618 1:96147962-96147984 GCCAGCAGCAGCAACCCTCTTGG + Intergenic
912003125 1:104859672-104859694 GCCTACCGCTGCCACCACCAGGG - Intergenic
912828534 1:112929248-112929270 CCCAGCCCCAGCCTCCATCTGGG + Exonic
914755093 1:150557927-150557949 CCCAGCTGCAGGCACCAGCAGGG - Exonic
917810506 1:178653664-178653686 ACCAACAGCAGCCACCATCCAGG + Intergenic
920097738 1:203497581-203497603 GCCAGCCGCAGCCTCCAGGAGGG - Intronic
922786076 1:228282924-228282946 CACAGCCCCAGCCACCATCTGGG - Intronic
922861168 1:228818146-228818168 CCCTGCTGCAGCCACCATGATGG - Intergenic
924627299 1:245706177-245706199 TCCAGCCGCATCTACCATCCAGG + Intronic
924757289 1:246952951-246952973 GCCAGTCTCAGCCACAATGAAGG + Intronic
1062797243 10:353755-353777 CCCAGCCGCTGCTTCCATCAAGG - Intronic
1065082101 10:22139149-22139171 GCCAGCAGCAGCAACCCTCTCGG + Intergenic
1067430666 10:46241353-46241375 CCCTGCCACTGCCACCATCAGGG + Intergenic
1068702732 10:60037138-60037160 CCCAGCTGAAGCCACCATTATGG + Intronic
1068754383 10:60634615-60634637 GCCAGCAGCAGCAACCAGCTCGG + Intronic
1075106210 10:119541966-119541988 GCCAGCCTGAGCCACGATCTCGG - Intronic
1076479475 10:130775466-130775488 GCCACCCGAGGCCACCTTCATGG + Intergenic
1077252923 11:1568560-1568582 TCCTGCGGCAGCCACCACCATGG + Intronic
1080317866 11:30970641-30970663 TCCACCTGCAGCCACCATCTGGG + Intronic
1081070914 11:38607176-38607198 GGGAGCCGCCGCCACCATCCTGG + Intergenic
1081390636 11:42524778-42524800 GCCTGCCACAGCCACTATGAAGG + Intergenic
1081989052 11:47327851-47327873 CCCAGGCTCAGCCACCATCATGG - Intronic
1082999791 11:59280800-59280822 GCCAGCAGCAGAAACCAACACGG + Intergenic
1083922747 11:65789305-65789327 GCCACCCGCTGGCACCATCCAGG + Intronic
1084155513 11:67310720-67310742 GCCAGCCCCAGCCTCGATCGCGG + Intronic
1084601705 11:70149702-70149724 GCCCGCAGCTGCCACCTTCATGG + Exonic
1089813750 11:121153559-121153581 GGCAGCCACAGCTACCCTCACGG - Intronic
1091591178 12:1843736-1843758 GCCAGCCCCAGCCCCCATTCTGG - Intronic
1091788300 12:3256382-3256404 GGCAGTCGCAGCCAGCATGACGG + Intronic
1092831898 12:12452474-12452496 GCCCGACCCAGCCACGATCAAGG - Intronic
1100422858 12:94454596-94454618 GCCAGCAGCAGCAACCCACACGG + Intronic
1101715601 12:107309322-107309344 GGCAGCCTCAGCCACCCCCAAGG - Intergenic
1102130816 12:110527435-110527457 GCCTGCCACAGCCAGTATCACGG + Intronic
1102732247 12:115121864-115121886 GCCAGCCCCAGCTTCCAGCAAGG - Intergenic
1104975533 12:132550358-132550380 GCCAGAAGGAGCCACCATCACGG - Intronic
1106602454 13:31199853-31199875 ACCAGCCGCAGCCGCCAGCCCGG + Intergenic
1106708983 13:32311413-32311435 GCCAGCCGCAGCCACCATCACGG - Exonic
1108694306 13:52889270-52889292 GCCTGCCCCAACCACCATCTTGG + Intergenic
1111871040 13:93832608-93832630 GCCAGCAGCAGCCTCCCTCATGG - Intronic
1112321728 13:98414000-98414022 GCCAGCCAAAGCCACCATGAAGG - Intronic
1112836702 13:103523562-103523584 ACCATCAGCAGCCACCAACATGG + Intergenic
1113438073 13:110308061-110308083 CCCAGCAGCAGCCACCTGCATGG - Exonic
1113893635 13:113749382-113749404 GCCAGCCGCAGCCATCCCCGAGG - Intergenic
1113951912 13:114076714-114076736 GGCAGCCGCGGCCACCAGGAAGG - Intronic
1114643176 14:24238231-24238253 TCCTGCCCCTGCCACCATCATGG - Exonic
1118761133 14:68880795-68880817 GCCAGCCCCACCCACCTCCATGG + Exonic
1119002587 14:70896029-70896051 GCAAGAAGCAGCCATCATCATGG + Intergenic
1119325636 14:73758521-73758543 CCCAGCCGCAGCTGCCAACAGGG + Intronic
1120365318 14:83561398-83561420 GGCAGCCGCAGCCACCGTGCTGG - Intergenic
1121624780 14:95375693-95375715 TGCAGCAGCAGCCACCACCATGG + Intergenic
1122271986 14:100572446-100572468 GCCAGCCCCACCCTCCCTCAGGG + Intronic
1122373361 14:101241933-101241955 GCCAGCCCCTGCCACCTTCTCGG + Intergenic
1124118348 15:26867673-26867695 GACACCCGTTGCCACCATCACGG + Intronic
1124820699 15:33043697-33043719 CCCAACTGCAGCCAGCATCATGG - Intronic
1130894590 15:88160262-88160284 GCCAGCCAGAGCCACACTCAAGG + Intronic
1132605374 16:791556-791578 GCCAGCCGCAGAGCCCTTCAGGG - Intronic
1133334051 16:4995265-4995287 GCCAGCATCTGCCACCCTCATGG + Intronic
1134290518 16:12900737-12900759 CCCAGCCTCAGCCACCCTCCCGG - Intergenic
1135821507 16:25690852-25690874 GCCAGCCACAGCAGCCAACAAGG + Intergenic
1137573215 16:49579953-49579975 CCCAGCCACTGCCACCACCATGG + Intronic
1138661031 16:58516858-58516880 GTCTGCAGCAGGCACCATCACGG - Exonic
1139848478 16:69936571-69936593 CCCACCAGCAGCCACCATCAAGG - Intronic
1141204925 16:81926169-81926191 GCCAGCTGGAGTCAACATCATGG + Intronic
1142423429 16:89987458-89987480 GCCAGCCACAGGTTCCATCAGGG + Intergenic
1142738601 17:1917454-1917476 CCGAGCCGCAGCCACCCTGACGG - Intergenic
1143452347 17:7043468-7043490 CCCAGCCCCAGCCCCCATCCGGG + Exonic
1143524305 17:7463319-7463341 GCCAGCCATGGCCACCACCACGG - Exonic
1144772688 17:17768791-17768813 ACCAGCCGCAGCCGCCACCTTGG - Intronic
1144849592 17:18237379-18237401 AGCAGCCCCAGCCACCACCAAGG - Intronic
1145242600 17:21248561-21248583 ACCACCCGCAGCCCCCATGATGG + Intronic
1147455965 17:40538353-40538375 GGCAGCCACAGCCACCCTCCAGG - Intergenic
1148680954 17:49473177-49473199 GCCAGCAGTGGCCACCACCAGGG - Intronic
1148769064 17:50056498-50056520 GCCGCCGGCCGCCACCATCAAGG - Exonic
1149328359 17:55556000-55556022 GCCAGGAGCAGCCACCCGCAGGG - Intergenic
1150131552 17:62671932-62671954 GTCAGCCTCAGCCACCAGTAGGG - Intronic
1150868488 17:68879445-68879467 ACGGGCTGCAGCCACCATCAAGG - Intronic
1151539750 17:74758921-74758943 GCCAGCCCCAGCCTCCACCCAGG + Intronic
1151812556 17:76453039-76453061 CCCAGCCGCAGCCCCCGTCCCGG - Exonic
1152783344 17:82236053-82236075 CCCAGCCCCAGCCGCCGTCAGGG - Exonic
1153331589 18:3880031-3880053 GGCAGCCGCAGCCATCACCACGG - Exonic
1154177313 18:12093891-12093913 TCCAGCCGCAACCTCCGTCAGGG - Exonic
1154346743 18:13548826-13548848 CCCTGCTGCAGCCAGCATCATGG + Intronic
1155749183 18:29398888-29398910 GGAAGCAGCAGCCACCATCTTGG - Intergenic
1156295333 18:35784198-35784220 GTCAGCCACAGCCAGCACCATGG - Intergenic
1156303025 18:35852043-35852065 GTCAGCCACAGCCACCATCATGG + Intergenic
1157726211 18:49966057-49966079 ACCATCCTCAGCCCCCATCAGGG - Intronic
1160239806 18:77114985-77115007 GGAAGCTGCATCCACCATCAGGG - Intronic
1160864991 19:1252493-1252515 GCCAGCCCCAGCCTCCCTCCTGG - Intronic
1160872679 19:1284279-1284301 GCCTGCCTCAGCCACCACCTGGG + Intergenic
1160927981 19:1556099-1556121 GCCCGCCGCGGCCACCATCTGGG - Exonic
1160969038 19:1759337-1759359 CCTACCCGCTGCCACCATCAAGG + Intronic
1161480997 19:4510617-4510639 GGAAGCCGCAGCCACTACCAAGG - Exonic
1161818451 19:6515063-6515085 TCCAGCCGCATCCAACATCTTGG + Intergenic
1162322484 19:9978467-9978489 GCCTGCCTCAGCCTCCATCATGG + Intronic
1162550663 19:11356698-11356720 CCCAGCCGCAGCCTCCATCCTGG - Intronic
1162995104 19:14329733-14329755 GCCTCCCACAGCAACCATCAGGG + Intergenic
1163275920 19:16284083-16284105 GCCAGGCACAGCCAAAATCACGG - Intergenic
1163396563 19:17066631-17066653 GCAAGCAGCAGCCACCAGCTGGG - Intronic
1164147143 19:22518966-22518988 GCCTCCCCCAGCCACCACCAGGG - Intronic
1164159489 19:22617363-22617385 GCCTCCCCCAGCCACCACCAGGG + Intergenic
1165153062 19:33772145-33772167 GCCAGCTGCGGCGACCATCCCGG + Exonic
1165420038 19:35718014-35718036 GCCCGCCGCCGCCGCCATCTTGG - Exonic
1167897697 19:52594435-52594457 GCCTGCCTCAGCCTCCATCCAGG + Intronic
926916994 2:17901667-17901689 CCCAGCCTCACCCACCACCATGG - Intronic
928088281 2:28359081-28359103 GCCACCCCCAGCCACCAGAAAGG - Intergenic
928595944 2:32858862-32858884 GCCAGCAGCAGCAACCCTCTCGG - Intergenic
933767095 2:85717406-85717428 GCCCCCCGCAGCCTCCCTCATGG + Intergenic
935311080 2:101784096-101784118 CTCAGCCGCAGCCACCATGGTGG + Intronic
935922691 2:108032576-108032598 GCCAGCAGCAGCAACCTGCAGGG + Intergenic
937289464 2:120773521-120773543 GGCAGCCGCAGACAGCATCAGGG - Intronic
938083366 2:128382045-128382067 GCCAGCCCCGGTCAGCATCAAGG - Intergenic
941043383 2:160648113-160648135 GCCTGCCGCTGCCATCAGCAAGG - Intergenic
941525697 2:166603937-166603959 GCCAGCAGCAGATACCAACATGG - Intergenic
942103542 2:172610399-172610421 GCCAGCACCAGCCACCATGGTGG + Intergenic
943179569 2:184525218-184525240 CCCAAATGCAGCCACCATCATGG + Intergenic
947759382 2:232592666-232592688 CCCACCCTCAGCCACCAGCACGG - Intergenic
947818878 2:233057212-233057234 GCAAGCCCCAGGCCCCATCAGGG - Intergenic
948712061 2:239831403-239831425 GTCAGCCGCAGCAGCCATCGAGG - Intergenic
948865425 2:240772511-240772533 TCCAGCCCCAGCCAGCATGAGGG - Intronic
1169034556 20:2438919-2438941 GCCAGCGTCAACCACCAGCAAGG - Intergenic
1171278752 20:23879614-23879636 CCCGGCCACGGCCACCATCAAGG + Exonic
1172094933 20:32455979-32456001 ACCAGCCACAGCCACCACCCTGG + Intronic
1175818253 20:61894981-61895003 CACAGCCACAGCCATCATCACGG + Exonic
1175889421 20:62309750-62309772 ACCAGCTGCAGCCGCCAGCAAGG + Exonic
1176108505 20:63400648-63400670 GGAAGCTGCAGCCACCGTCACGG + Intergenic
1176379334 21:6104013-6104035 GCCAGCTCCGGCCACCAGCAGGG + Intergenic
1178425730 21:32477500-32477522 TGCAGCCCCAGCCACCATCCGGG - Intronic
1179613453 21:42566769-42566791 GGCAGCAGCTGCCACCATGAGGG - Intronic
1179744139 21:43434224-43434246 GCCAGCTCCGGCCACCAGCAGGG - Intergenic
1181009990 22:20034631-20034653 TACAGCCGCAGCCACCCCCAGGG - Intronic
1184820053 22:46903387-46903409 GCCAGCCGGAGCAGCCATCAGGG - Intronic
952137256 3:30437191-30437213 GCCAGCAGCAAGCACCAGCAGGG - Intergenic
954157470 3:48694501-48694523 GACATCAGCAGCCACCAGCATGG - Intronic
955046985 3:55369869-55369891 GCCAGCCACAGCCACCAGACTGG + Intergenic
959491815 3:106999153-106999175 GCCAGCAGCAGCAACCAGCTGGG + Intergenic
960662735 3:120078795-120078817 GCCAGCCTCAGCCTCCCTCTGGG + Intronic
961033896 3:123629110-123629132 GCCAGCCACAGCCCTCTTCAGGG - Intronic
961825835 3:129598578-129598600 CCCAGCCCCAGCGCCCATCATGG - Intronic
962251540 3:133839008-133839030 GCCAGACGCAGCCACAAACCAGG + Intronic
963034918 3:141017625-141017647 GCCAGCAGCAGCTACCAGCTTGG + Intergenic
963708845 3:148722678-148722700 GCCATCCGCAGTCATCAACATGG + Intronic
963904484 3:150762732-150762754 CCCGGCCGCCGCCACCATCTCGG - Exonic
968062747 3:195738750-195738772 CCCAGCTGCTGCCACCAGCAGGG + Intronic
968584318 4:1409052-1409074 GCCAGCCCCCGCCCCCATCAGGG - Intergenic
968918995 4:3512866-3512888 GCCAGCCCCAGCCACCCTGACGG + Exonic
969056664 4:4406825-4406847 CCCAACCCCAGGCACCATCAGGG + Intronic
969425441 4:7121400-7121422 GCCAGCCACGGCCACAGTCAGGG + Intergenic
969429264 4:7144802-7144824 GGCAGACCCAGCCACCAGCAGGG - Intergenic
969664762 4:8550866-8550888 GCCAGCTGCAGCCACTATCAAGG + Intergenic
969850157 4:9949676-9949698 GCTAGCAGCTGCCACCATGAGGG - Intronic
970193121 4:13533557-13533579 GCCAGCCACAGCCACTCCCAGGG + Intergenic
970959775 4:21858020-21858042 GGCAGCTCCAGGCACCATCACGG - Intronic
972629761 4:40833032-40833054 TCCAGCCTCAACCACCATCAAGG + Intronic
976174692 4:82338988-82339010 GCCAGCAGCAGCAACCCTCTTGG - Intergenic
984293961 4:177830422-177830444 GCCAGCAGCAGCAACCAGCTGGG + Intronic
984801541 4:183721450-183721472 GCCAGCTGCTGCCAACACCACGG - Intergenic
986063754 5:4216011-4216033 GCACCCCACAGCCACCATCATGG - Intergenic
986519025 5:8594262-8594284 CCCAGAAGCAGCAACCATCATGG + Intergenic
988160695 5:27515936-27515958 GCCAGCAGCAGAGACCAACACGG - Intergenic
989149570 5:38285523-38285545 GCCAGCCCAAGCTACCTTCAGGG + Intronic
990777950 5:59324379-59324401 CTCAGCCCCAGCCACCATGAGGG + Intronic
992712342 5:79471826-79471848 GCCAGGCACTGCCCCCATCAAGG + Intronic
992750106 5:79853784-79853806 GCCAGCCTCAGGCAGGATCACGG - Intergenic
996673331 5:126145413-126145435 GTCAGCAGCAGTCAACATCAAGG + Intergenic
998095702 5:139394580-139394602 CCCAGCGGGAGCCACCATCGGGG + Exonic
999351503 5:150875766-150875788 GCCAGCAGCAGAGACCAACACGG + Intronic
1001797029 5:174510938-174510960 TCCAGCGGCAGCAACCATCTGGG - Intergenic
1003245960 6:4382490-4382512 GGCAGCCACAGCCCCCACCAGGG - Intergenic
1005510326 6:26506707-26506729 GACAGCCACAGCCACTATCCAGG - Exonic
1008150727 6:47948409-47948431 GCAAGCCCCACCCACCCTCAAGG + Intronic
1008675006 6:53809973-53809995 GCCAGCCCTGGCCACCAGCAAGG + Intronic
1010000403 6:70943307-70943329 GCCTGCAGCAGCCAACATAAGGG + Intronic
1013428644 6:110036688-110036710 GGCAGTCCCAGCCACCTTCATGG + Intergenic
1013538879 6:111087944-111087966 GCCAGCCCCAGCCGCCCTCGGGG - Exonic
1017305172 6:152909897-152909919 GCCAGCTGCAGCCAGAATAAAGG + Intergenic
1018860208 6:167705690-167705712 GCCAGCCGCAGGCACCAGCACGG - Intergenic
1022506085 7:30909440-30909462 CCCAGCCACGGACACCATCATGG + Intergenic
1023522242 7:41060271-41060293 GCAAGCCTCGGCCATCATCAAGG + Intergenic
1026953965 7:74365266-74365288 GCCAGCTGCAGTCACCATGGGGG + Intronic
1027724003 7:81780263-81780285 GCTATTCACAGCCACCATCATGG + Intergenic
1030491475 7:110240506-110240528 GCCAGCAGCCACCAACATCAGGG + Intergenic
1035060725 7:156067311-156067333 GCCAGCCACAGCCCCCATTTCGG - Intergenic
1035073008 7:156158569-156158591 CCCAGACGCAGCCTCCATCCTGG + Intergenic
1036556175 8:9862284-9862306 GCCAGCCTCAGCCAGCATGCAGG - Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1037095146 8:14977276-14977298 GCTAGCAGCTGCCACCAGCATGG + Intronic
1037580938 8:20245736-20245758 GGCAGGTGCAGTCACCATCATGG - Intergenic
1040754169 8:50750612-50750634 GCCAGCAGCTGTCAGCATCAAGG + Intronic
1041626799 8:60038913-60038935 GCCAGCAGCCATCACCATCAAGG + Intergenic
1042761825 8:72279771-72279793 GCTAGCTGCAGCCAGCACCAGGG + Intergenic
1045111170 8:98940506-98940528 GCCAGCCGCAGGCACCCTTCCGG - Intronic
1049306569 8:141907185-141907207 TCCAGCCACACCCACCCTCAGGG - Intergenic
1049308600 8:141921197-141921219 GCCACAGCCAGCCACCATCAGGG + Intergenic
1049759704 8:144326477-144326499 GCCAGCCCCGGCCCCCAACAAGG - Exonic
1051660315 9:19419996-19420018 GCCTGCCTCTGCCACCATCTGGG - Intronic
1052817870 9:33115505-33115527 TCCAGCCCCAGCAACCATTATGG - Intronic
1053143795 9:35698482-35698504 GGTGGCCGCAGCCACCATCCGGG + Exonic
1057526207 9:95804269-95804291 GCCAGCAGCAGCAACCAGCTCGG + Intergenic
1060251957 9:121994009-121994031 GCCAGCCCCTGCCAGCCTCAGGG + Intronic
1060963801 9:127700353-127700375 GCCAGGAACAGCCCCCATCATGG - Intronic
1062283386 9:135761924-135761946 CCCAGCCCCAGCCACCCCCAGGG + Intronic
1062340332 9:136091216-136091238 GCCAGCCCCAGCCGGCATGAAGG + Intronic
1186898283 X:14027261-14027283 GCCAGCCTCAGCAACCAGCCAGG - Intronic
1187501645 X:19843855-19843877 GCCTGCCTCAGACACCATTAAGG + Intronic
1195417891 X:104640872-104640894 GCCTGCCACTGCCACCACCAGGG - Intronic
1197757382 X:130005327-130005349 GCCAGCAGCGGCCACCTTCCTGG - Intronic