ID: 1106713278

View in Genome Browser
Species Human (GRCh38)
Location 13:32360956-32360978
Sequence ATTGAGAAGACCAAAGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 427}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106713276_1106713278 18 Left 1106713276 13:32360915-32360937 CCTTAGCAGCTGGAAGGATAGAG 0: 1
1: 1
2: 10
3: 71
4: 411
Right 1106713278 13:32360956-32360978 ATTGAGAAGACCAAAGATGGAGG 0: 1
1: 0
2: 3
3: 27
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106713278 Original CRISPR ATTGAGAAGACCAAAGATGG AGG Intronic
900689554 1:3972097-3972119 ATCGAGCAGATCAAAGAGGGAGG - Intergenic
900722778 1:4188405-4188427 ACTGAGAACTCCAAAGGTGGGGG - Intergenic
901235732 1:7666688-7666710 CTGGAGAACACCAAAGAAGGGGG + Intronic
901405433 1:9041804-9041826 ATTCCGAAGACCAAAGATCTGGG + Exonic
902497890 1:16887110-16887132 AGTGAGAGGACCAAGGAGGGCGG - Intronic
903664028 1:24995860-24995882 ACAGAGAAGGCCAAAGATGCAGG - Intergenic
903751836 1:25627639-25627661 AAAAAGAAGATCAAAGATGGAGG - Intronic
904861022 1:33537676-33537698 AGTGCAAAGAACAAAGATGGGGG - Intronic
905104110 1:35552683-35552705 ATTCAGTAGGCCAAAGTTGGAGG + Intronic
905963880 1:42072103-42072125 AAGGAGAAGAACAAAGTTGGAGG - Intergenic
907969081 1:59363068-59363090 TTTGAGAAGAACAAGGATTGTGG + Intronic
908593288 1:65656652-65656674 AGTAAGAAGAACAAAGCTGGAGG + Intergenic
908661673 1:66443905-66443927 AATTAGAAGAGCAAAGTTGGAGG - Intergenic
909645528 1:77912501-77912523 AAGGAGAAGAACAAAGCTGGAGG + Intronic
909686116 1:78350935-78350957 ATTGAGAAGAACAAAGCAGAAGG - Intronic
909818806 1:80031997-80032019 TTTGAGATGACCTAAGATGTTGG - Intergenic
910084749 1:83386532-83386554 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
910136228 1:83973507-83973529 AAGGAGAAGAACAAAGTTGGAGG - Intronic
911060717 1:93745517-93745539 ATTGAGGAGAAGAAAAATGGTGG - Intronic
911485880 1:98504519-98504541 ATTGGGAAGACAGAAGATGAGGG - Intergenic
911935696 1:103968473-103968495 AAAGAGAAGAACAAAGTTGGAGG - Intergenic
914174089 1:145259109-145259131 AGTGAAAAGAACAAAGCTGGAGG + Intergenic
915293191 1:154900116-154900138 AATGATAAGAGCAAAGATGCAGG - Intergenic
915729968 1:158046348-158046370 ACTGAGAAGACCAAGTTTGGGGG + Intronic
915855553 1:159382819-159382841 AAACAGAAGATCAAAGATGGAGG + Intergenic
918789113 1:188802884-188802906 AATAAGAATACCAAAGATGTAGG + Intergenic
918817318 1:189205224-189205246 ATTTAGAAGACCATGGATGAGGG - Intergenic
919026105 1:192172388-192172410 ATGGTGAAGACCAAAGAAGTGGG - Intronic
919373057 1:196755185-196755207 ATTAAAAAGAACAAAGCTGGAGG + Intergenic
919379502 1:196839868-196839890 ATTAAAAAGAACAAAGCTGGAGG + Intronic
919556441 1:199060496-199060518 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
921033175 1:211351902-211351924 AAGGAGAAGAACAAAGCTGGAGG - Intronic
922348549 1:224717162-224717184 AATGAAAAGACCATAGATGGTGG + Intronic
922682412 1:227611546-227611568 CTTGAGAAGAACACAGATGAAGG - Intronic
924478382 1:244402665-244402687 CTTGAAAAGAACAAAGCTGGAGG + Intergenic
1063624303 10:7675058-7675080 ATTCAGAACAGCAAAGATGAAGG - Intergenic
1064334535 10:14426689-14426711 ATTGAGAAGGAGAAAAATGGTGG - Intronic
1064370065 10:14743792-14743814 AGTGAAAAGAACAAAGCTGGAGG - Intronic
1064533811 10:16337484-16337506 TTTGAGAAGAACAAAACTGGAGG + Intergenic
1064794590 10:18997134-18997156 AGTGAAAAGAACAAAGCTGGAGG + Intergenic
1065456726 10:25914154-25914176 AATGAGAAGGAGAAAGATGGGGG + Intergenic
1065798654 10:29331021-29331043 ACTGAGAAAACCAAAGAAGTTGG + Intergenic
1066043156 10:31572332-31572354 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
1066485626 10:35840773-35840795 ATGGAGAAGAACAAAGTTGGAGG - Intergenic
1067302555 10:45025669-45025691 ATTGGGGAGAAAAAAGATGGTGG + Intergenic
1068269623 10:54703807-54703829 ATTTAAAAGAACAAAGCTGGAGG + Intronic
1069300206 10:66898390-66898412 AGAGAGAAGAACAAAGATTGAGG + Intronic
1070470377 10:76773365-76773387 ATTGAGAAGACGAAATAAGAGGG - Intergenic
1070572451 10:77650346-77650368 TTTGGGAAGAGCAAAGGTGGTGG + Intergenic
1070581463 10:77723495-77723517 ATTGTGATGTCCAACGATGGAGG + Intergenic
1070639419 10:78156665-78156687 AAAAAGAAGAACAAAGATGGAGG - Intergenic
1071423166 10:85522416-85522438 TTTGAGAAAACCAAAGTTGCTGG - Intergenic
1071998426 10:91169824-91169846 AAGGAGAAGAACAAAGTTGGAGG + Intronic
1072084994 10:92070219-92070241 ATTGTGAAGACCCAAGAAGGAGG - Intronic
1072778600 10:98226606-98226628 TTTGAAAAGAACAAAGTTGGAGG + Intronic
1072845533 10:98826384-98826406 ATTGACAAGACTAAATATTGGGG + Intronic
1074628817 10:115225951-115225973 CTTTAGAAGAACAAAGCTGGAGG + Intronic
1074628820 10:115225989-115226011 TTTTAGAAGAACAAAGCTGGAGG + Intronic
1074879223 10:117640373-117640395 ATAAAGAAGAACAAAGTTGGAGG - Intergenic
1075501339 10:122977749-122977771 ATTGACAACACCAAATATGAGGG + Intronic
1075572525 10:123556463-123556485 GTTGAGAAGAACAAAGCGGGAGG + Intergenic
1076085336 10:127623298-127623320 ATAAAGAAGAACAAAGTTGGAGG - Intergenic
1080207015 11:29741537-29741559 ATTTAGAAGAGGAGAGATGGAGG + Intergenic
1081135076 11:39430645-39430667 AGTAAAAAGAACAAAGATGGAGG + Intergenic
1081510756 11:43770482-43770504 CTTGAGAAGGCCAAAGTGGGAGG + Intronic
1082662518 11:55929591-55929613 AGTGAAAAGAACAAAGCTGGAGG - Intergenic
1082972978 11:59043148-59043170 AATGAAAAGACCAAAGATAAAGG - Intronic
1083271534 11:61575309-61575331 AGTGACAAAACCAAAGATGCTGG - Intronic
1083546380 11:63552074-63552096 ATTGGTGGGACCAAAGATGGCGG + Intergenic
1086514274 11:87593686-87593708 AGTGAAAAGAACAAAGCTGGAGG + Intergenic
1086803625 11:91210683-91210705 AGTGAAAAGAACAAAGCTGGAGG + Intergenic
1086821398 11:91440752-91440774 ATATAGATGAGCAAAGATGGGGG + Intergenic
1087089397 11:94252706-94252728 AGTGAAAAGAACAAAGCTGGAGG + Intergenic
1087821606 11:102718736-102718758 ATTGAGAAGAATCAAGATAGTGG + Intronic
1088396481 11:109375457-109375479 ATTGTGAAGACCCAACATTGGGG - Intergenic
1090158955 11:124471086-124471108 AATGGGAAGAGCAAAGACGGAGG + Intergenic
1090754415 11:129776717-129776739 AAAGAGAAGAACAAAGTTGGAGG + Intergenic
1090859998 11:130644528-130644550 ATTGAGCAGACCAGAGAAGGAGG - Intergenic
1091707297 12:2704193-2704215 AGTGAAAAGAACAAAGCTGGAGG + Intergenic
1093046336 12:14449634-14449656 TTTGAAAAGAACAAAGTTGGAGG - Intronic
1093120253 12:15262204-15262226 ACTAAGAAGAACAAAGCTGGAGG + Intronic
1093410166 12:18855769-18855791 AGAGAGAAGGACAAAGATGGAGG + Intergenic
1093571152 12:20667706-20667728 AACGAAAAGAACAAAGATGGAGG - Intronic
1094081964 12:26546603-26546625 AGTGAAAAGAACAAAGCTGGAGG + Intronic
1094268811 12:28588706-28588728 CTTGAGAAGATGACAGATGGAGG + Intergenic
1094309498 12:29063173-29063195 AAGGAGAAGAACAAAGTTGGAGG - Intergenic
1094406218 12:30119025-30119047 CTTGAGAAGACCGGACATGGTGG + Intergenic
1094432212 12:30381762-30381784 AAGAAGAAGAACAAAGATGGAGG + Intergenic
1094595975 12:31866955-31866977 ATCAAGAAGAACAAAGTTGGAGG + Intergenic
1094795852 12:33971722-33971744 AGTGAAAAGAACAAAGCTGGAGG - Intergenic
1095108594 12:38265594-38265616 ACTGAAAAGAACAAAGCTGGAGG - Intergenic
1096037392 12:48484302-48484324 ATTGAGAAGACTGAATCTGGAGG + Intronic
1097498066 12:60367883-60367905 AGTAAAAAGACCAAAGCTGGAGG + Intergenic
1098349469 12:69542673-69542695 ACTCAGTAGACCAAAGATGTTGG + Intronic
1099590342 12:84579124-84579146 ATCAAAAAGAACAAAGATGGAGG + Intergenic
1100151918 12:91748790-91748812 ATTGAGATGGCAAAAGATGATGG + Intergenic
1100327772 12:93555404-93555426 TTAGAGAAGAACAAAGAAGGAGG - Intergenic
1101974483 12:109344138-109344160 ATTGGGAAGACCACAGAGGCAGG + Intergenic
1104194718 12:126524126-126524148 AGTAAGAAGAACAAAGCTGGAGG - Intergenic
1106713278 13:32360956-32360978 ATTGAGAAGACCAAAGATGGAGG + Intronic
1107252075 13:38375986-38376008 ATAGAGAAGACCAGGCATGGTGG - Intergenic
1108134788 13:47344056-47344078 AGTGAAAAGACCAAATCTGGAGG + Intergenic
1108141562 13:47427985-47428007 TTTTAAAAGCCCAAAGATGGTGG + Intergenic
1108443740 13:50484854-50484876 CTTGGGAAGACCCAAAATGGAGG + Intronic
1108865281 13:54915880-54915902 AGTGAAAAGAACAAAGTTGGAGG + Intergenic
1108941214 13:55956197-55956219 AATAAGAAGAACAAAGGTGGAGG + Intergenic
1109018265 13:57049130-57049152 ATTGAAAAGAACAAATTTGGAGG - Intergenic
1109363083 13:61322079-61322101 AGAGAGAAGAACAAAGTTGGAGG + Intergenic
1109528045 13:63602207-63602229 AGTGAAAAGAACAAAGCTGGAGG - Intergenic
1109644411 13:65234783-65234805 ATTGAAAAGGACAAAGCTGGAGG - Intergenic
1110121868 13:71892309-71892331 ACTCAGAAGCCCAAAAATGGTGG - Intergenic
1110671141 13:78179523-78179545 AGTGAAAAGAACAAAGCTGGAGG - Intergenic
1110972205 13:81778666-81778688 ATGAAAAAGAACAAAGATGGAGG - Intergenic
1111166791 13:84468228-84468250 ATTAAGAAAAACAAAGCTGGAGG + Intergenic
1111235311 13:85401046-85401068 TGTGTGAACACCAAAGATGGCGG + Intergenic
1112614855 13:100993676-100993698 AGTGAAAAGAACAAAGCTGGAGG + Intergenic
1112764191 13:102723299-102723321 AATGAGATCACCAAAGGTGGAGG + Intergenic
1113014291 13:105809943-105809965 ATGGAAAAGACTAAAAATGGGGG - Intergenic
1114732713 14:25010837-25010859 TTTGACAAGACCAATGGTGGTGG + Intronic
1116814547 14:49571499-49571521 GATGAGATGACCCAAGATGGAGG + Exonic
1117115591 14:52507616-52507638 AGTGAAAAGAACAAAGCTGGAGG + Intronic
1117143302 14:52811204-52811226 AAAAAGAAGACCAAAGTTGGGGG - Intergenic
1117212650 14:53517022-53517044 ATTGACAAGATCAAAGATTAGGG - Intergenic
1118143219 14:63107793-63107815 AGTGAAAAGAACAAAGCTGGAGG - Intergenic
1118794283 14:69126611-69126633 ATTTTGAAGAACAAAGTTGGAGG + Intronic
1118914186 14:70088070-70088092 ATTGAGAATACAAAAGATTCAGG + Intronic
1121641480 14:95487348-95487370 AGTGAGAAGACCAAGGATTGGGG + Intergenic
1122912477 14:104838388-104838410 ATTAAAAAGAACAAAGCTGGAGG - Intergenic
1123699086 15:22901507-22901529 TTCCAGAAGACCATAGATGGAGG - Intronic
1124292032 15:28461452-28461474 TTTAAGAAGACCAAGGATTGAGG + Intergenic
1125042202 15:35202297-35202319 ATTGAGAAGATCAAGGATGGTGG + Intergenic
1126061574 15:44787619-44787641 ACAGTCAAGACCAAAGATGGGGG + Intergenic
1126215815 15:46153676-46153698 ATTGTCAAGACCAAAGGTGATGG + Intergenic
1126224644 15:46256656-46256678 AAAGAGAAGACCAAATTTGGGGG + Intergenic
1126260824 15:46688710-46688732 ATTGAAAAGAGCAAAGTTGAAGG + Intergenic
1127028278 15:54832823-54832845 ATAAATAAGACCAAAGATGTTGG + Intergenic
1127135184 15:55912597-55912619 ATTTAGAAAACAACAGATGGGGG + Intronic
1127150569 15:56070676-56070698 AAGGAGAAGAACAAAGATGGAGG + Intergenic
1128694173 15:69747937-69747959 CTTGAAAAGAAAAAAGATGGAGG - Intergenic
1129134128 15:73531283-73531305 AATCTGAAGTCCAAAGATGGTGG - Intronic
1129581622 15:76818001-76818023 ATTTTGAAGAACAAAGCTGGTGG + Intronic
1130069759 15:80636553-80636575 ATGAAGTAGACCATAGATGGAGG + Intergenic
1131010561 15:89014404-89014426 CTTGAGAAGAACAAAGTTAGAGG + Intergenic
1136562818 16:31050759-31050781 CTTTAGAAGGCCAAAGCTGGCGG - Intergenic
1137319197 16:47361955-47361977 ATTTAGCAGACCTAAGATGAGGG - Intronic
1138102231 16:54261993-54262015 CTGGACAAGACCAAAGCTGGAGG - Intronic
1138591865 16:58004387-58004409 AAGGAGAAGAACAAAGTTGGAGG - Intronic
1138616807 16:58174651-58174673 AATGGGAAGACTAAAGATGAAGG + Intronic
1140209764 16:72960769-72960791 TTTGAGAAGTTCAAAGAAGGCGG + Intronic
1140705146 16:77621343-77621365 ATTGTGAAGAATAAAGTTGGTGG + Intergenic
1143934909 17:10473564-10473586 ATTGATAATGCAAAAGATGGAGG + Intergenic
1144025776 17:11274619-11274641 ATTTGGGAAACCAAAGATGGAGG + Intronic
1147542998 17:41376776-41376798 ATGGATAAGACCAAAGATCTAGG + Intronic
1148917561 17:50995172-50995194 GGTGGGAAGACCAGAGATGGTGG - Exonic
1149129321 17:53277856-53277878 ATACAGAGGTCCAAAGATGGTGG + Intergenic
1149745737 17:59095961-59095983 GTTGGGAGGCCCAAAGATGGAGG - Intronic
1150544847 17:66145021-66145043 ACTGAGAAAACCAAGTATGGTGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1155124916 18:22864075-22864097 AAGGAGAAGATCAAAGTTGGAGG - Intronic
1155690725 18:28619137-28619159 ATTAAGAAAACCAAAGATTCAGG + Intergenic
1155781513 18:29842784-29842806 AAAGAGAAGAGCAAAGCTGGAGG - Intergenic
1156262084 18:35454081-35454103 CTTGAAAAGAACAAAGTTGGAGG + Intronic
1158108665 18:53915086-53915108 AATGATAAGAACAAAGCTGGAGG - Intergenic
1158140175 18:54247096-54247118 TTGGGGAAGAACAAAGATGGGGG - Intergenic
1159487184 18:69077299-69077321 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
1159997284 18:74978431-74978453 ATTCAGAAAGACAAAGATGGAGG + Intronic
1162195501 19:8981346-8981368 ATTGAGAAGACCAAATCTCAGGG + Intergenic
1164528935 19:29032705-29032727 AGTCAAAAGACAAAAGATGGGGG + Intergenic
1164551937 19:29219274-29219296 ACTGAGAAGGCCAGAGGTGGAGG - Intergenic
1164990286 19:32677642-32677664 ATTTAGGAAACCAAAGAGGGTGG + Exonic
1165265489 19:34659841-34659863 AATAAAAAGAACAAAGATGGAGG + Intronic
1166916221 19:46197529-46197551 ACTGAGCAGGCCAGAGATGGGGG - Intergenic
926206743 2:10839370-10839392 ATTGAGAAGACCCAAGAAATGGG - Intergenic
926211168 2:10870614-10870636 ATTGAGAGGAACCAAGGTGGAGG + Intergenic
927267987 2:21174453-21174475 ACTGAGAAGACTAAGGAGGGAGG - Intergenic
927286254 2:21360114-21360136 ATGGAGAGGGCCAAAGTTGGGGG + Intergenic
928051340 2:27999336-27999358 ATTTAGAAGGCAAGAGATGGGGG + Intronic
928896894 2:36276103-36276125 AGTAAGAAGCCCAAAGAAGGCGG + Intergenic
928922943 2:36544408-36544430 ATTGAGAAGACAAACCATCGAGG + Exonic
929497421 2:42458287-42458309 AGTGAGAAAAGCAAAGGTGGAGG - Intronic
930961108 2:57262847-57262869 AGTGAAAAGAACAAAGCTGGAGG - Intergenic
932980276 2:76655481-76655503 TATGAGAAGAACAAAGTTGGAGG - Intergenic
933045167 2:77526241-77526263 CTTTGGAAGACCAAGGATGGTGG + Intronic
934600919 2:95657721-95657743 AGAGAGAAGACAGAAGATGGAGG - Intergenic
934612281 2:95749676-95749698 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
934841871 2:97629771-97629793 AAGGAGAAGAACAAAGTTGGAGG - Intergenic
934875767 2:97918271-97918293 AATGAGAATACTCAAGATGGGGG - Intronic
935349037 2:102137961-102137983 TTGCAGAAAACCAAAGATGGTGG + Intronic
935723884 2:106006396-106006418 ATTGAGAACACCATATATTGAGG - Intergenic
936034566 2:109100574-109100596 ATTAAGAAGTCCAAAGGTGACGG + Intergenic
936238121 2:110763238-110763260 AAGGAGAAGAACAAAGTTGGAGG + Intronic
936772290 2:115928547-115928569 ATGGAGAAGAACCAAGTTGGAGG - Intergenic
937411075 2:121676404-121676426 AGTGAGAAGAACAAATCTGGAGG + Intergenic
937563277 2:123251431-123251453 AAGGAGAAGAAGAAAGATGGCGG + Intergenic
937626653 2:124051609-124051631 ATTAAGAAGAGCATTGATGGTGG + Intronic
937868332 2:126770373-126770395 ATTGGGAAGACCAGATCTGGAGG - Intergenic
938222710 2:129585152-129585174 AATGAGAAGAACAAAGTTGAAGG + Intergenic
939655668 2:144820977-144820999 ATAGAAAAGAACAAAGCTGGAGG - Intergenic
940304653 2:152212567-152212589 TTTAAGAAGAACAAAGTTGGGGG - Intergenic
940566036 2:155361510-155361532 ATTGAGAATATCAAAGATTTTGG + Intergenic
940819276 2:158333864-158333886 AAAGAGAAGAGCAAAGTTGGAGG - Intronic
942407694 2:175673342-175673364 ATCGAAAAGAACAAAGCTGGAGG + Intergenic
942546586 2:177071051-177071073 ATTGAGAAGTCCAAGACTGGGGG + Intergenic
942883144 2:180887493-180887515 AGTGAAAAGAGCAAAGCTGGAGG + Intergenic
943412344 2:187559841-187559863 AGTGAGAGGTCCAAATATGGGGG + Intronic
943459931 2:188159969-188159991 CTTGGGAAGAACAAAGATGTGGG - Intergenic
944268327 2:197752856-197752878 AGTGAAAAGAACAAAGCTGGAGG + Intronic
945110991 2:206359484-206359506 AGTAAAAAGAACAAAGATGGAGG + Intergenic
945329307 2:208520989-208521011 AGTGAAAAGAACAAAGCTGGAGG - Intronic
946490317 2:220143230-220143252 AGTGAGAAGGCAAAAGATGATGG - Intergenic
948532113 2:238615623-238615645 AAGGGGAATACCAAAGATGGGGG - Intergenic
1169288633 20:4330375-4330397 ACTGAGAAGTCCAGAGTTGGGGG + Intergenic
1170652192 20:18252877-18252899 AGTGAGGAGACCAAAGTTGCTGG - Intergenic
1171096465 20:22336803-22336825 ATTCTGAAGCCCAAAGATAGGGG - Intergenic
1171135669 20:22692369-22692391 ATGGGGAAGAGAAAAGATGGAGG + Intergenic
1171791527 20:29530464-29530486 AGCGAGAAGAACAAAGCTGGAGG + Intergenic
1172514079 20:35521152-35521174 TTGGATAAGACAAAAGATGGTGG + Intergenic
1173379332 20:42524962-42524984 ATTGAGAACACCAAATGTTGAGG - Intronic
1173411548 20:42815387-42815409 ATTGCCAACACCAAGGATGGAGG + Intronic
1176081668 20:63276523-63276545 CTTGAGAAGATGAAAGCTGGTGG + Exonic
1176664943 21:9677826-9677848 GCTGAGAAGTCCAAGGATGGGGG + Intergenic
1177115647 21:17082830-17082852 TTTGAGAAAACCAAAGAAGTAGG - Intergenic
1177306395 21:19322668-19322690 TTTGAGTATATCAAAGATGGAGG + Intergenic
1178294594 21:31398489-31398511 ATGGAGAATACAAAAGATGTGGG - Intronic
1179486585 21:41714339-41714361 ACTGCAAAGACCACAGATGGAGG - Intergenic
1180004707 21:45015001-45015023 ATTGAGATGAGCAAAGATCCTGG - Intergenic
1183230088 22:36576641-36576663 AAAGAGGAGAACAAAGATGGTGG + Intronic
1183613989 22:38930963-38930985 AAGGAGAAGAACAAAGTTGGAGG - Intergenic
1184268429 22:43363431-43363453 TTAGAGAAGCCCAAAGCTGGCGG + Intergenic
1184440412 22:44509156-44509178 ATAGAAAAGAACAAAGAAGGAGG + Intergenic
1184869710 22:47228289-47228311 AAAGAGAAGAACAAAGTTGGAGG + Intergenic
1184936018 22:47721620-47721642 AAAGAGAAGAACAAAGTTGGAGG - Intergenic
949146922 3:712245-712267 AAGGAGAAGAACAAAGTTGGAGG - Intergenic
950389942 3:12688731-12688753 GTTGAGAAGACCAGATGTGGTGG + Intergenic
951134401 3:19087019-19087041 AAAGAGAAGAACAAAGGTGGAGG + Intergenic
952207304 3:31192696-31192718 TTTGAGAAGAGCAATGGTGGTGG - Intergenic
952683904 3:36128468-36128490 AGTAAGAAGAACAAAGCTGGAGG + Intergenic
952941321 3:38446471-38446493 AGTGAAAAGAACAAAGCTGGAGG + Intergenic
953242782 3:41164686-41164708 ATTGAGATGAACACAGATGCTGG + Intergenic
954494940 3:50948829-50948851 ACTCAGAAGAACAAAGCTGGAGG + Intronic
956253343 3:67257458-67257480 ATTAAGAAGAACAAAGGTGGAGG - Intergenic
956896896 3:73670435-73670457 ATTGAGAAAACCTAAGGTTGTGG + Intergenic
957310079 3:78508385-78508407 TTTGAGAAGACCACAGAAGCGGG + Intergenic
957696272 3:83641566-83641588 ATTAACAAGAACAAAGCTGGAGG + Intergenic
957703356 3:83747786-83747808 AGTGAAAAGAACAAAGCTGGAGG + Intergenic
957747215 3:84361368-84361390 AACAAGAAGAACAAAGATGGAGG - Intergenic
958475641 3:94577517-94577539 AAGGAGAAGAACAAAGATGGAGG + Intergenic
958667767 3:97162190-97162212 ATTGAGAACTTGAAAGATGGAGG - Intronic
958703552 3:97623943-97623965 ACAGAGAAGAGCAAAGCTGGAGG - Intronic
960251194 3:115455960-115455982 AATTAGAAGAACAAAGTTGGAGG - Intergenic
960261119 3:115569409-115569431 AGTGAAAATAACAAAGATGGAGG + Intergenic
961180697 3:124874557-124874579 AGCAAGAAGAACAAAGATGGAGG + Intronic
961914783 3:130362570-130362592 AAGGAGAAGAACAAAGTTGGAGG - Intronic
961953596 3:130776025-130776047 AGTGAAAAGAACAAAGCTGGAGG + Intergenic
962641574 3:137392370-137392392 AGTGAAAAGAACAAAGCTGGAGG - Intergenic
963477074 3:145821109-145821131 ATTAAAAAGAACAAAGTTGGAGG - Intergenic
963704217 3:148665620-148665642 AATGAGAAGACCAAGGAGGGAGG - Intergenic
963805773 3:149720556-149720578 AAAGAGAAGAACAAAGCTGGAGG - Intronic
964027110 3:152087906-152087928 ATGGACAAGTCCAAATATGGAGG + Intergenic
964267695 3:154918562-154918584 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
965340072 3:167479852-167479874 ATTGAGAATAAGAAACATGGAGG + Intronic
965371257 3:167864498-167864520 CTTGAGAAGAACCAAGAAGGAGG + Intergenic
965738099 3:171843567-171843589 ATTGAGAAAATAAAAGAAGGTGG + Intronic
966573321 3:181472064-181472086 AGTGAAAAGAACAAAGCTGGTGG - Intergenic
967099288 3:186202771-186202793 TCTCAGAAGACCAAAGTTGGGGG - Intronic
967276971 3:187785412-187785434 CTTTAGAAGACCAAGGAGGGAGG - Intergenic
967689961 3:192462519-192462541 ATTGAGAAGTCCAAAATTGAGGG - Intronic
970329012 4:14959631-14959653 ATTCAGATGAGCAAAGATGGTGG - Intergenic
971311450 4:25529007-25529029 ATAGATAAGCACAAAGATGGGGG - Intergenic
972136317 4:35899164-35899186 ATTGAGAAGTACCAACATGGTGG - Intergenic
972203683 4:36746603-36746625 AAAGAGAAGAACAAAGTTGGAGG + Intergenic
972964539 4:44493462-44493484 AGTGACAAGAGCAAAAATGGTGG + Intergenic
973222345 4:47742802-47742824 TTTAAGAAGAACAAAGATAGAGG + Intronic
974454349 4:62106868-62106890 ATTGAATGGACCAAAGCTGGAGG - Intergenic
974660644 4:64883827-64883849 ATTGATTAGGCCAGAGATGGTGG + Intergenic
974676123 4:65091216-65091238 TTTAAGAAGGCCAAACATGGTGG - Intergenic
977745745 4:100545005-100545027 ATTGAGAAGACCAAAGATAAAGG + Intronic
979071277 4:116209994-116210016 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
980215013 4:129841270-129841292 ATTGAAAATGCCAGAGATGGGGG - Intergenic
980312116 4:131144134-131144156 AGTGAAAAGAACAAAGATGGAGG + Intergenic
980493610 4:133561949-133561971 ATAGAAAAGAACAAAGATGTGGG - Intergenic
980715816 4:136627224-136627246 ATAGACAAGACCAAATATGAAGG - Intergenic
980798264 4:137713606-137713628 ATTGTGAATACCAAATAGGGTGG + Intergenic
982385612 4:154798191-154798213 ACTGATAAGACCAAAAATCGTGG + Exonic
983058759 4:163130467-163130489 AAGGAGAAGAACAAAGCTGGAGG + Intronic
984138176 4:175967973-175967995 AAGGAGAAGAACAAAGTTGGAGG + Intronic
986117354 5:4790121-4790143 ATGAAGAAGAACAAAGTTGGAGG + Intergenic
986515538 5:8559317-8559339 CTTGAGAAGACAGAAGATGTGGG + Intergenic
988554169 5:32222004-32222026 ATTGTGAAGAACAATGATGATGG + Intergenic
988611633 5:32732282-32732304 ATTCTCAAGATCAAAGATGGTGG + Intronic
989304467 5:39937005-39937027 ATTTAGAAAACAGAAGATGGAGG + Intergenic
989606161 5:43246203-43246225 ACTGAGAAGACCACAGAAGGCGG - Intronic
989776698 5:45217274-45217296 AAAGAGAAGAACAAAGTTGGAGG - Intergenic
990096990 5:52128217-52128239 AAAGAGAAGAACAAAGTTGGAGG + Intergenic
990326676 5:54683561-54683583 AAAGAGAAGAACAAAGTTGGAGG - Intergenic
990827189 5:59914263-59914285 GTGGAGAAAAACAAAGATGGGGG + Intronic
991325978 5:65433208-65433230 TTTGAGAAGAAAAAATATGGTGG - Intronic
991525603 5:67554345-67554367 ATTGAAAAGAGTAAATATGGAGG - Intergenic
991651681 5:68862093-68862115 ATTGAGAAGAATAAAGGTGCTGG - Intergenic
991745593 5:69737491-69737513 ATTGAGTAGCCCAAAGACAGAGG + Intergenic
991752113 5:69817742-69817764 ATTGAGTAGCCCAAAGACAGAGG - Intergenic
991797160 5:70317244-70317266 ATTGAGTAGCCCAAAGACAGAGG + Intergenic
991824971 5:70612805-70612827 ATTGAGTAGCCCAAAGACAGAGG + Intergenic
991831433 5:70692847-70692869 ATTGAGTAGCCCAAAGACAGAGG - Intergenic
991889539 5:71316777-71316799 ATTGAGTAGCCCAAAGACAGAGG + Intergenic
992649670 5:78846321-78846343 AATGAAAAGAACAAAGTTGGAGG - Intronic
994480313 5:100326407-100326429 ATTGATAAGAACAAGGATAGTGG - Intergenic
994573746 5:101548761-101548783 AGTGAGAACACCAAACATGGTGG - Intergenic
995128665 5:108606878-108606900 AATTAGAAGACCAAAAATGAGGG + Intergenic
996181746 5:120427846-120427868 AGTAAGAAGAACAAAGCTGGAGG - Intergenic
996255203 5:121392678-121392700 GTTAAGAAAACCAAACATGGAGG + Intergenic
996635462 5:125683985-125684007 TTTGAGAAGATCAAAGTAGGAGG + Intergenic
997481334 5:134187035-134187057 ATTGAGGAGGCCAAGGATAGAGG + Intronic
998267661 5:140678162-140678184 GGTGAGAAGCCCAAAGATGCCGG - Intronic
1000150700 5:158497862-158497884 TGTGAAAAGACCAAAGATGAGGG - Intergenic
1000238730 5:159388886-159388908 AATGAGAAGAACAAAGTTGGAGG - Intergenic
1000572528 5:162932974-162932996 ACTGAAAAGAACAAAGCTGGAGG - Intergenic
1003375456 6:5572679-5572701 GTGGAGAAGAGAAAAGATGGGGG - Intronic
1004883962 6:20034413-20034435 TTTGTGAAGAACAAAGAGGGGGG - Intergenic
1006508739 6:34509507-34509529 ATTGAGAAGAACAAAGCTGGAGG - Intronic
1006853919 6:37119546-37119568 ATTGAGTAGACTATAGATGGAGG - Intergenic
1007906555 6:45467186-45467208 ATGGAAGAGACCAAGGATGGAGG - Intronic
1008149424 6:47932357-47932379 TTTGTCAAGAGCAAAGATGGGGG + Intronic
1008744353 6:54651186-54651208 GAAGAGAAGACCAAAGCTGGAGG - Intergenic
1008758659 6:54827819-54827841 ATTGAGAAGAGTAAAAGTGGTGG + Intergenic
1008778322 6:55068743-55068765 AATGAAAAGAGCAAAGCTGGAGG - Intergenic
1008939542 6:57031362-57031384 ATTGAAAAGAAAAAAGAAGGAGG + Intergenic
1010266630 6:73875255-73875277 ATTGAGTACCACAAAGATGGAGG + Intergenic
1010797653 6:80136167-80136189 ATTCAGAAGAACAAAGTTGGAGG + Intronic
1011937122 6:92793928-92793950 CTGGAAAAGAGCAAAGATGGAGG - Intergenic
1012693106 6:102340765-102340787 ATTTAAAAGACTAAAGAAGGTGG - Intergenic
1013841350 6:114398182-114398204 ATTGAGTGGACTGAAGATGGTGG - Intergenic
1014301883 6:119692196-119692218 ATGGACAAGACAAAAGCTGGAGG - Intergenic
1014428527 6:121338776-121338798 ATTAATAAAACCAAAGAAGGGGG - Intergenic
1014841544 6:126225559-126225581 ACAGAGAAGAGCCAAGATGGTGG - Intergenic
1015083977 6:129265103-129265125 ATTGAGAAGATAACAGATGCTGG + Intronic
1015789041 6:136947876-136947898 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
1016149906 6:140727692-140727714 CTTCAGAAGAACAAAGTTGGAGG + Intergenic
1016177079 6:141093549-141093571 AAAGAGAAGAACAAAGATGAAGG - Intergenic
1016263681 6:142206648-142206670 AAGGAGAAGAACAAAGTTGGAGG + Intronic
1016820313 6:148340890-148340912 CTTGAGGAGACCAAGGAGGGAGG + Intronic
1017269333 6:152488422-152488444 TTTGACAAGAGCACAGATGGTGG - Exonic
1018622065 6:165739189-165739211 ATCAAGAAGAACAAAGCTGGAGG + Intronic
1019957819 7:4430348-4430370 AATAAGAAGAACAAAGCTGGGGG + Intergenic
1021033768 7:15771357-15771379 CTTGAGAAGAACAAATCTGGAGG + Intergenic
1022575537 7:31493431-31493453 ATGGAGAAAACACAAGATGGTGG - Intergenic
1023096406 7:36664552-36664574 AAGGAGAAGAACAAAGCTGGAGG - Intronic
1023303953 7:38803722-38803744 GTGGAGAAGACCTAGGATGGTGG + Intronic
1023606394 7:41935225-41935247 ATGGAGAATAGCAAAGAAGGAGG + Intergenic
1024221334 7:47289946-47289968 AAAGAGAAGAGCAAAGTTGGAGG + Intronic
1026643331 7:72146671-72146693 ACTCAAAAGAACAAAGATGGAGG + Intronic
1027246876 7:76373562-76373584 CTGGAGAAAACCACAGATGGGGG - Intergenic
1027301570 7:76842645-76842667 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
1027809097 7:82870143-82870165 AGTGAAAAGAACAAAGCTGGAGG + Intronic
1027863865 7:83621549-83621571 AGTGAAAAGAACAAAGCTGGAGG + Intronic
1027884484 7:83886173-83886195 ATTTGGGAGGCCAAAGATGGAGG + Intergenic
1028654637 7:93190481-93190503 ATTGAGAAGACAGAAGAAGAAGG + Intronic
1028808003 7:95051417-95051439 AAGGAGAAGAACAAAGTTGGAGG - Intronic
1029018703 7:97341335-97341357 ATTTAGAAAAACAAAGATGTTGG - Intergenic
1030352399 7:108504674-108504696 ATTGAGAAGAACAAGGTTGGAGG + Intronic
1030702200 7:112653262-112653284 AGAGAGAAGAGCAAAGTTGGAGG + Intergenic
1030806566 7:113927356-113927378 AGTGAAAAGAACAAAGCTGGAGG - Intronic
1030970932 7:116053774-116053796 ATTGAGATGTCCAAAGTTGTAGG - Intronic
1031547041 7:123063623-123063645 AGTGAAAAGAACAAAGCTGGAGG - Intergenic
1032673216 7:134105100-134105122 TTTGAGAAAACCAAAGAAGCAGG + Intergenic
1033063817 7:138133528-138133550 ATCAAGAAGAACAAAGCTGGAGG - Intergenic
1033544364 7:142386469-142386491 ATCGACAAGACCCAAGACGGGGG + Intergenic
1033653791 7:143360821-143360843 AGAGAGAAGACAGAAGATGGTGG + Intronic
1036023721 8:4879122-4879144 ATTGAGCAAACAAAATATGGTGG + Intronic
1039140933 8:34387266-34387288 GTGGAGAAGAACAAAGATGAAGG + Intergenic
1039277411 8:35948659-35948681 AAAGAGTAGACCAAAGTTGGAGG - Intergenic
1039674921 8:39651805-39651827 AGTGAAAAGAGCAAAGTTGGAGG + Intronic
1039996397 8:42537684-42537706 ATTGAAATGACTAAAGATGGTGG - Intronic
1040815488 8:51503979-51504001 ATTGAGACAAGCAAAAATGGAGG - Intronic
1040928241 8:52708185-52708207 ATTCAGATCAGCAAAGATGGGGG - Intronic
1041334513 8:56765518-56765540 AAGGAGAAGAACAAAGTTGGAGG - Intergenic
1041680955 8:60590392-60590414 ATTGGGAAGGCCAAAGTGGGAGG + Intronic
1043951577 8:86315316-86315338 ATTTAAAAGAACAAAGCTGGAGG - Intronic
1044078249 8:87850831-87850853 AAGGAGAAGAACAAAGGTGGAGG + Intergenic
1044363279 8:91313417-91313439 CTTGAGAAGAACAAAGCTGAAGG - Intronic
1044610353 8:94085710-94085732 ATCGAAAAGAACAAAGCTGGAGG - Intergenic
1044728064 8:95208872-95208894 AGTGAGAAAAGGAAAGATGGAGG - Intergenic
1044939296 8:97324317-97324339 ATTTAGAAGAAAAATGATGGTGG - Intergenic
1045194605 8:99917600-99917622 ACTAAGAAGAACAAAGTTGGAGG + Intergenic
1045196682 8:99939351-99939373 TTTGATAAGAACAAAGTTGGAGG - Intergenic
1045580401 8:103472741-103472763 AGTGAAAAAACCAAAGCTGGAGG - Intergenic
1045756815 8:105553174-105553196 ATAGAGAAGACGAAATATGTGGG - Intronic
1045840040 8:106569246-106569268 ATTGAGAAGAAAGAAGAAGGGGG - Intronic
1048160837 8:132019679-132019701 CTTGAGAAGAACAAAGCTGGAGG + Intergenic
1048630473 8:136237056-136237078 ATTGAGAAAACAAAAAATGTAGG - Intergenic
1049953935 9:673981-674003 ACTGGGAAGACCAGAGAGGGAGG - Intronic
1050776457 9:9268567-9268589 GTTGAGAAGAACAAAGCTGGAGG + Intronic
1050784247 9:9379475-9379497 AAGGAGAAGAACAAAGTTGGAGG - Intronic
1050808683 9:9717289-9717311 AGTGAAAAGAACAAAGCTGGAGG - Intronic
1050827882 9:9972303-9972325 CTTGAGAAGAGCAAAAATAGGGG - Intronic
1051939429 9:22487656-22487678 ATTGAGAAGAACAAAGAAATGGG - Intergenic
1051985806 9:23085647-23085669 AGTGAAAAGAACAAAGCTGGAGG + Intergenic
1052761157 9:32592976-32592998 CTTGAGAAAACCAAAGATGAGGG + Intergenic
1053040982 9:34871829-34871851 AAGGAGAAGACCAAGGTTGGAGG - Intergenic
1055247908 9:74269097-74269119 GTTGTGAAGATCAAAGATGATGG - Intergenic
1055472139 9:76622504-76622526 ATTTTGAAGACAAAAGATGGGGG - Intronic
1055505502 9:76944221-76944243 CTTGAGAAGAGCAATGTTGGTGG - Intergenic
1056046512 9:82723318-82723340 AGTAAAAAGACCAAAGATTGGGG - Intergenic
1056604149 9:88072036-88072058 AGTGAGAAGAACAAATTTGGAGG + Intergenic
1056832335 9:89927393-89927415 ATTGAGAACACCAAACAGGAGGG - Intergenic
1056985026 9:91355311-91355333 CTTTGGAAGGCCAAAGATGGTGG + Intronic
1057452893 9:95181352-95181374 ATTTAGAGGACCAAAGTTTGAGG - Intronic
1057587219 9:96339907-96339929 ATGGAGAAGATCAGAGATTGTGG - Intronic
1057698586 9:97346247-97346269 AAGGAGAAGACTAAAGGTGGAGG - Intronic
1057726142 9:97569713-97569735 GTTGTGAAGATCAAAGATGATGG - Intronic
1058191444 9:101921068-101921090 ATTTAGAACACAAAAGGTGGAGG + Intergenic
1058202606 9:102062981-102063003 AATGAAAAGAACAAAGCTGGAGG - Intergenic
1058547974 9:106081374-106081396 ATGTAGAAAACCAAAGATGAAGG + Intergenic
1059406914 9:114106385-114106407 ATGGAGAAGAGCAAAGTTGGAGG + Intergenic
1059547316 9:115190887-115190909 AATGACAAGAACAAAGCTGGAGG + Intronic
1060871788 9:127048458-127048480 ATTGAGGTGACCAAAGGAGGAGG - Intronic
1061269510 9:129529932-129529954 AGTGAGAACTCCCAAGATGGTGG + Intergenic
1203661158 Un_KI270753v1:43923-43945 GCTGAGAAGTCCAAGGATGGGGG - Intergenic
1186238245 X:7537178-7537200 AGTGAAAAGAACAAAGCTGGAGG - Intergenic
1186620840 X:11238513-11238535 ATTTAGAGGACTAAACATGGTGG + Intronic
1187041712 X:15603457-15603479 AATTAGAAGACCAAAGATGCAGG + Intergenic
1187875473 X:23800176-23800198 ATTGTGCAGACCAGACATGGTGG - Intergenic
1188732139 X:33662730-33662752 AGTGAAAAGAACAAAGCTGGAGG + Intergenic
1189085645 X:38020739-38020761 ATTGAGAATAGAAACGATGGAGG + Intronic
1189718439 X:43889164-43889186 AGAGAGAAGAACAAAGCTGGAGG - Intergenic
1190975971 X:55401223-55401245 AGTCAAAAGAACAAAGATGGAGG + Intergenic
1191032107 X:55985563-55985585 AGTGAAAAGAACAAAGCTGGAGG - Intergenic
1191586396 X:62831729-62831751 AATAAGAAGAACAAAGCTGGAGG + Intergenic
1191642376 X:63441347-63441369 AGTGAAAAGAACAAAGGTGGAGG + Intergenic
1192474910 X:71432041-71432063 AGAGAGAAGACCAAAGAGGATGG + Intronic
1193762475 X:85484668-85484690 AGTGAAAAGATCAAAGCTGGAGG - Intergenic
1193832258 X:86303934-86303956 CTTGAGTAGAACAAAGCTGGAGG + Intronic
1193970440 X:88044477-88044499 AGTAAAAAGAACAAAGATGGAGG + Intergenic
1194052341 X:89086369-89086391 ATAAAGAAGAACAAAGTTGGAGG + Intergenic
1194071971 X:89336746-89336768 CTTGAGAAGAACAAAGCTGGAGG + Intergenic
1194797712 X:98233262-98233284 AGTGAAAAGAACAAATATGGAGG + Intergenic
1195238118 X:102922362-102922384 AATGAAAAGTGCAAAGATGGAGG - Intergenic
1195260188 X:103124276-103124298 ATCTAGAAGATCAAAGAAGGGGG + Intergenic
1195475466 X:105279981-105280003 GGTGAGAAGAACAAAGCTGGAGG + Intronic
1195620746 X:106952100-106952122 AGTGACAAGATCAAAGATGAAGG - Intronic
1195714060 X:107801192-107801214 AAAGAGAAGAACAAAGTTGGAGG + Intergenic
1196977127 X:121171350-121171372 TTGAAAAAGACCAAAGATGGGGG - Intergenic
1197187730 X:123607004-123607026 ATTGAGAAGCCAAAGGGTGGTGG + Intronic
1197262292 X:124332413-124332435 ATTGAGAGTACAAGAGATGGAGG + Intronic
1197597612 X:128485228-128485250 AGTGAAAAGAGCAAAGCTGGAGG + Intergenic
1197981446 X:132221446-132221468 ATTAAGAAGGCCAGACATGGTGG - Intergenic
1198425154 X:136511036-136511058 TTTGAAAAGACAGAAGATGGGGG + Exonic
1199193465 X:144998748-144998770 ATAGGGAAGAACAAAGTTGGAGG - Intergenic
1199566422 X:149220500-149220522 TTTTGGAAGACCAAAAATGGTGG + Intergenic
1200518188 Y:4175523-4175545 ATTGTGAAGAACATGGATGGTGG - Intergenic
1200726214 Y:6672478-6672500 CTTGAGAAGAACAAAGCTGGAGG + Intergenic
1201778310 Y:17690793-17690815 AGTGAAAAGAACAAAGCTGGAGG - Intergenic
1201823245 Y:18215199-18215221 AGTGAAAAGAACAAAGCTGGAGG + Intergenic
1201888492 Y:18915180-18915202 ACTGAAAAGAACAAAGGTGGAGG + Intergenic
1201909185 Y:19116129-19116151 ATTGAAAAGAACAAAGCTGGAGG - Intergenic
1202041638 Y:20691447-20691469 AGTGAAAAGAACAAAGCTGGAGG - Intergenic
1202346393 Y:23932535-23932557 ATTAAGAAGGACAAGGATGGTGG - Intergenic
1202524378 Y:25737555-25737577 ATTAAGAAGGACAAGGATGGTGG + Intergenic