ID: 1106713759

View in Genome Browser
Species Human (GRCh38)
Location 13:32366893-32366915
Sequence CTAGGGTTACTCACTACTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106713759_1106713762 17 Left 1106713759 13:32366893-32366915 CCAGTAGTAGTGAGTAACCCTAG 0: 1
1: 0
2: 0
3: 9
4: 71
Right 1106713762 13:32366933-32366955 AAGTACTGTTTTCTCTTAAAAGG 0: 1
1: 0
2: 1
3: 34
4: 351
1106713759_1106713763 25 Left 1106713759 13:32366893-32366915 CCAGTAGTAGTGAGTAACCCTAG 0: 1
1: 0
2: 0
3: 9
4: 71
Right 1106713763 13:32366941-32366963 TTTTCTCTTAAAAGGATGCAAGG 0: 1
1: 1
2: 5
3: 40
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106713759 Original CRISPR CTAGGGTTACTCACTACTAC TGG (reversed) Intronic