ID: 1106717790

View in Genome Browser
Species Human (GRCh38)
Location 13:32408982-32409004
Sequence CTTCTAATCAGACTGAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106717787_1106717790 -4 Left 1106717787 13:32408963-32408985 CCCTACCTATTAAACAGAGCTTC 0: 1
1: 0
2: 1
3: 17
4: 144
Right 1106717790 13:32408982-32409004 CTTCTAATCAGACTGAAATGAGG 0: 1
1: 0
2: 0
3: 19
4: 205
1106717788_1106717790 -5 Left 1106717788 13:32408964-32408986 CCTACCTATTAAACAGAGCTTCT 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1106717790 13:32408982-32409004 CTTCTAATCAGACTGAAATGAGG 0: 1
1: 0
2: 0
3: 19
4: 205
1106717789_1106717790 -9 Left 1106717789 13:32408968-32408990 CCTATTAAACAGAGCTTCTAATC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1106717790 13:32408982-32409004 CTTCTAATCAGACTGAAATGAGG 0: 1
1: 0
2: 0
3: 19
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106717790 Original CRISPR CTTCTAATCAGACTGAAATG AGG Intronic
909108086 1:71438472-71438494 CTTCTCATCCCACTGAAAAGAGG + Intronic
909396090 1:75172437-75172459 CTTCTAACCATGGTGAAATGAGG + Intergenic
915918426 1:159955917-159955939 TTTATACTCAGACTGAAATCTGG - Intergenic
916511343 1:165474706-165474728 CTTTTACTCTGAGTGAAATGGGG + Intergenic
918748672 1:188241825-188241847 CTTCTCACAAAACTGAAATGTGG - Intergenic
920317608 1:205089751-205089773 CTTTTAATCTGACTGAACTATGG - Intronic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921504357 1:215949558-215949580 TTTCTAATCTGATTGAATTGTGG - Intronic
1062795849 10:344697-344719 CGTGTAGTCAGACTGAGATGTGG - Intronic
1066264024 10:33757711-33757733 CTTCTAGCCACACTGAAATGAGG + Intergenic
1067856320 10:49796681-49796703 TTTCTTATCAGACTTAAAAGAGG + Intergenic
1069550685 10:69361747-69361769 CTTTTAAGCAGCCTGAAAAGAGG + Intronic
1071189467 10:83082665-83082687 ATGCTAATCAGAATGAATTGGGG + Intergenic
1071986946 10:91061494-91061516 CTTCTACTCAAAGTGATATGAGG - Intergenic
1072005679 10:91244503-91244525 CTTTTACTCTGAATGAAATGGGG + Intronic
1074232909 10:111555441-111555463 CTTCTAATCAGTGTTTAATGAGG + Intergenic
1074351184 10:112738622-112738644 CATTTAATCAGACTGTATTGGGG - Intronic
1076220993 10:128733238-128733260 ATTCTAATGTGACTGAATTGTGG - Intergenic
1079148325 11:17874607-17874629 CTTCTCAAGAAACTGAAATGTGG + Intronic
1079317295 11:19419542-19419564 CTTCACATCAGACTGAGAAGCGG - Intronic
1085862574 11:80251862-80251884 ATTTGAAACAGACTGAAATGAGG - Intergenic
1085904195 11:80739821-80739843 CTTCTAGTCTGCCTGAAATTAGG - Intergenic
1087618200 11:100512913-100512935 CTTTGAATCAGACAGAAATGGGG + Intergenic
1090180985 11:124699266-124699288 CTTTTACTCTGAGTGAAATGAGG - Intergenic
1092405881 12:8221960-8221982 CTTCTCAGGAGAGTGAAATGAGG + Exonic
1093803921 12:23409303-23409325 CTTTTACTCTGAGTGAAATGGGG + Intergenic
1096717563 12:53500431-53500453 CTGATAATCAGGCTGTAATGTGG - Intergenic
1097173946 12:57132157-57132179 CTGCTAACCAGGCTGAAATCTGG - Intronic
1097229160 12:57498632-57498654 CCTCTAATGAGGCAGAAATGGGG + Intronic
1098679839 12:73338788-73338810 CTTCTAATTAAACGGAAATGAGG - Intergenic
1101577149 12:106008101-106008123 CTCATGATCAGACTGATATGAGG + Intergenic
1104201810 12:126596857-126596879 CTTTTTCTCAAACTGAAATGCGG - Intergenic
1104737672 12:131147780-131147802 CTTCTAAACAGGATGGAATGGGG - Intergenic
1106649125 13:31670293-31670315 CTTCCTATCTAACTGAAATGTGG + Intergenic
1106717790 13:32408982-32409004 CTTCTAATCAGACTGAAATGAGG + Intronic
1107740355 13:43444165-43444187 GTTTTAAGCAGACTGAAAAGGGG - Intronic
1108617698 13:52150266-52150288 CTGTTTATGAGACTGAAATGTGG + Intronic
1109139836 13:58701096-58701118 ATTCTCATCAGACTGAACTGCGG - Intergenic
1109154036 13:58882258-58882280 ATTAGAATCAGACTGAAAGGTGG + Intergenic
1109277411 13:60317898-60317920 CTTGTGAACAGACTGAAATCGGG + Intergenic
1109897363 13:68711208-68711230 CTTTTGATCTGACTGAGATGAGG - Intergenic
1110151771 13:72263939-72263961 GTGCTAATCACACTGAAATATGG - Intergenic
1110241035 13:73267129-73267151 CTTCAAAGCAGAATGAAATCTGG - Intergenic
1110440061 13:75517609-75517631 CTTCTTAGGAGGCTGAAATGGGG + Intergenic
1115471738 14:33775219-33775241 CTTCCAATCAGTCTGATAAGGGG - Intronic
1116534185 14:46010180-46010202 ATTCTAATTATACTTAAATGTGG + Intergenic
1117925178 14:60771557-60771579 CTTCTACTCTGCATGAAATGAGG - Intronic
1118732438 14:68677837-68677859 CATCTTATCAGCCTGCAATGGGG - Intronic
1118795828 14:69142932-69142954 CTCCTAATCAGACTAAAGTAGGG + Intronic
1119470419 14:74894388-74894410 CTTTTAATGAGATTGACATGAGG + Exonic
1119793320 14:77373946-77373968 CTTAGAATCATACTGAAAGGGGG - Intronic
1121067761 14:90984498-90984520 CTTCTGTTCAAACTGAAATGTGG + Intronic
1123816695 15:23986966-23986988 TTACTAATCACAATGAAATGAGG + Intergenic
1123829940 15:24124986-24125008 CTTCTAATCAGGTTAGAATGTGG - Intergenic
1123833078 15:24161825-24161847 CTTCCAATCAGTCTAAAGTGTGG - Intergenic
1123839806 15:24236909-24236931 CTTCCAATCAGTCTAAAGTGTGG - Intergenic
1123844845 15:24288927-24288949 CTTCTAATCAGGTTAGAATGTGG - Intergenic
1123852866 15:24378607-24378629 CTTCCAATCAGTCTAAAGTGTGG - Intergenic
1123868721 15:24550024-24550046 CTTCCAATCAGTCTAAAGTGTGG - Intergenic
1123894861 15:24818551-24818573 CTTCTATTCAGGCTTGAATGTGG - Intergenic
1124781124 15:32635055-32635077 CTTTTATTCAGAGTGAAACGAGG - Intronic
1125080423 15:35666326-35666348 CATCTAATCAGACTTGAGTGTGG + Intergenic
1127448118 15:59086644-59086666 CTTCTAAGCAGACTGGATTATGG + Intronic
1127712110 15:61609680-61609702 CTTGTAACCAGGGTGAAATGAGG + Intergenic
1129042562 15:72702562-72702584 CTTCTCATTAGCTTGAAATGAGG - Intronic
1131456607 15:92586917-92586939 TTTCTAATCACACTGAACGGCGG + Intergenic
1131741054 15:95392158-95392180 CTTCTTAATAGAGTGAAATGAGG - Intergenic
1134583125 16:15388582-15388604 CTTTTAATCAGACTAAGATAGGG - Intergenic
1135314621 16:21434127-21434149 CTTTTAATCAGACTAAGATAGGG - Intronic
1135367544 16:21866407-21866429 CTTTTAATCAGACTAAGATAGGG - Intronic
1135444270 16:22504755-22504777 CTTTTAATCAGACTAAGATAGGG + Intronic
1135856165 16:26012673-26012695 CTTCTATACATTCTGAAATGTGG - Intronic
1135930974 16:26736400-26736422 CTTTTACTCTGAATGAAATGTGG + Intergenic
1136193163 16:28630795-28630817 CTTTTAATCAGACTAAGATAGGG + Intergenic
1136311286 16:29412808-29412830 CTTTTAATCAGACTAAGATAGGG - Intergenic
1136324734 16:29514601-29514623 CTTTTAATCAGACTAAGATAGGG - Intergenic
1136439419 16:30254586-30254608 CTTTTAATCAGACTAAGATAGGG - Intergenic
1138025212 16:53516841-53516863 CTTTTACTCAGGCTGGAATGTGG - Intergenic
1139743680 16:69057375-69057397 ATAGTAATCATACTGAAATGGGG - Intronic
1139885926 16:70206886-70206908 CTTTTAATCAGACTAAGATAGGG - Intergenic
1142021393 16:87785071-87785093 TTTCTAATCACGGTGAAATGTGG - Intergenic
1143702935 17:8675004-8675026 CTGCTACTCAGATGGAAATGGGG - Intergenic
1146423818 17:32716342-32716364 CTTGTAATCATACTGATTTGTGG + Intronic
1148471942 17:47899771-47899793 CTTCTCATCAGACTGGGCTGCGG + Intronic
1148527518 17:48355188-48355210 CTTCTAAAAAGACTAAGATGGGG + Intronic
1149473100 17:56935355-56935377 CCTCTAATCAGACTCAAAAGAGG - Intergenic
1150612765 17:66747516-66747538 CTTCTACTCATACTAACATGTGG - Intronic
1150757115 17:67924472-67924494 CATCTAATAAGAGTGAAATCTGG - Intronic
1153179614 18:2418211-2418233 AGGCTAATCACACTGAAATGTGG - Intergenic
1153269667 18:3307725-3307747 CTTCTATTCAAAATAAAATGTGG + Intergenic
1157993330 18:52524021-52524043 CTTGTCATCAGACGTAAATGTGG + Intronic
1160368165 18:78347298-78347320 TTCTTAATCAGCCTGAAATGTGG - Intergenic
1164376233 19:27690716-27690738 CTTCTAATAATATTGACATGGGG - Intergenic
924981256 2:223634-223656 CTTTAAATCAGCCTGTAATGTGG + Intronic
926197963 2:10775040-10775062 CTTCTTATCAGACAGCAATCTGG - Exonic
926774933 2:16412642-16412664 CTTTTAATATGAGTGAAATGGGG - Intergenic
927639476 2:24837742-24837764 TTTCTAATCAGACTGACAGGAGG + Intronic
927741211 2:25571381-25571403 CTTTTACTCTGAGTGAAATGAGG - Intronic
928499773 2:31878316-31878338 CTTTTATTCTGACTGAAAGGGGG + Intronic
929603992 2:43223032-43223054 TTTGCAATCAGGCTGAAATGTGG - Exonic
931906492 2:66848956-66848978 ATTTTAACCAGACTAAAATGTGG + Intergenic
937898890 2:127000930-127000952 CTTATAAAAAGACAGAAATGTGG - Intergenic
938050981 2:128171421-128171443 CTTCTGATTAGAATGAAATTTGG - Intronic
941729894 2:168905882-168905904 CTGATAATCAGACTGAAATTTGG - Intronic
941771876 2:169353606-169353628 CTTCTAGTGAGATTAAAATGTGG + Intronic
942745410 2:179226274-179226296 CTTCTCAGCAGTCTTAAATGGGG - Intronic
942913857 2:181278483-181278505 CTCCTTATCAGTCTGAAATAAGG + Intergenic
943483196 2:188447768-188447790 CTGCAAATGAGATTGAAATGAGG + Intronic
943772035 2:191728384-191728406 TTACAAATCAGACTGAAATAGGG + Intergenic
944370127 2:198973308-198973330 CTCCTGATCTGCCTGAAATGGGG - Intergenic
1169305167 20:4483285-4483307 CTTATAGTCAGTCTGAAGTGTGG - Intergenic
1170478557 20:16742469-16742491 CTTATACTCTGAGTGAAATGGGG + Exonic
1171395744 20:24831938-24831960 CTTGTTATCAAACTGAACTGGGG - Intergenic
1172029375 20:31970868-31970890 CTTCTAATCATCCTGTCATGTGG + Intronic
1172413745 20:34746543-34746565 CATAAAATCGGACTGAAATGTGG - Intronic
1172525310 20:35597427-35597449 CTTCTTCTCTGAGTGAAATGGGG - Intergenic
1173366978 20:42395127-42395149 CTGAAAATGAGACTGAAATGGGG - Intronic
1174029568 20:47611625-47611647 CTACTAATAATACAGAAATGAGG + Intronic
1174733034 20:52936927-52936949 ATTGTAATCCAACTGAAATGGGG + Intergenic
1176082641 20:63281742-63281764 CTGCTCCTCAGCCTGAAATGAGG + Intronic
1177481015 21:21688743-21688765 CTTATACTCTGACTGAAATATGG + Intergenic
1178685781 21:34709621-34709643 CATTTAAACAGTCTGAAATGTGG + Intronic
1184093419 22:42304106-42304128 CTTCATATCAGCCTGAAATATGG - Intronic
1185240124 22:49737913-49737935 CTTCTCATCAGCATGCAATGAGG - Intergenic
952355034 3:32576161-32576183 CTTTTCCTCCGACTGAAATGAGG - Intergenic
955152928 3:56386604-56386626 CTTATAATCAGAATGACTTGGGG - Intronic
958987804 3:100802985-100803007 CTTCTGAGAAAACTGAAATGTGG + Intronic
959400055 3:105889140-105889162 TTACTAATCACACTGAAATATGG - Intergenic
961693176 3:128685165-128685187 CTTCTACCCTGTCTGAAATGCGG - Intergenic
963271555 3:143290460-143290482 CTTCCCATCAGACTCAAATCTGG - Intronic
964035029 3:152185060-152185082 CTTCTTATCTGTATGAAATGAGG - Intergenic
964874386 3:161349678-161349700 CTCCTAAGCAGACTGTGATGTGG + Intronic
965537342 3:169836941-169836963 CTTCTATTCAGAGAGAAATGGGG + Intronic
966628571 3:182046778-182046800 TTTATCATCAAACTGAAATGAGG - Intergenic
968557618 4:1255369-1255391 CTTCTCACCAGACTGCAATCAGG + Intergenic
969760249 4:9176007-9176029 CTTCTCAGGAGAGTGAAATGAGG - Exonic
970877982 4:20894601-20894623 CTTCTACTCAGAGTGAAATAAGG + Intronic
971469706 4:27009336-27009358 CTTGTAATTAAATTGAAATGAGG + Intronic
972855402 4:43099518-43099540 ATTTTAATCAGAGTTAAATGTGG + Intergenic
975037969 4:69708745-69708767 CTACTAATGAGAGTGTAATGAGG - Intergenic
976458272 4:85276260-85276282 ATTCTATGGAGACTGAAATGGGG + Intergenic
977137012 4:93317535-93317557 ATTCTAATAATACTGAAATTTGG + Intronic
979036263 4:115722894-115722916 CTTAGAATCAGACTGAGATATGG + Intergenic
981232722 4:142376781-142376803 CTCAAAATCAGATTGAAATGTGG - Intronic
981503869 4:145479665-145479687 CTTTTATTCTGAGTGAAATGAGG + Intergenic
983102761 4:163645271-163645293 CTGCTACTGAGACTGCAATGGGG - Intronic
983780701 4:171666670-171666692 CTCCTAATCAGAGAGAAATGAGG + Intergenic
983943712 4:173563572-173563594 CATCTGATCAAACTGAAATGAGG + Intergenic
987520232 5:18972858-18972880 ATCCTATTCACACTGAAATGGGG + Intergenic
987679998 5:21122957-21122979 CCACTAAACAGACTGAAATTTGG + Intergenic
987683911 5:21171898-21171920 ATTATACTCAGACTGAAATAGGG - Intergenic
989148405 5:38272043-38272065 CTCTGAATCATACTGAAATGTGG - Intronic
989165530 5:38430377-38430399 CTTACAATGAGCCTGAAATGGGG - Intronic
989606865 5:43252739-43252761 TTTCTAATCAGCCTAAAAGGGGG - Intronic
995710686 5:115032443-115032465 TTTCTGATCAGTCAGAAATGTGG + Intergenic
996432082 5:123392445-123392467 CTTTTGATCAAACTGAAATAGGG - Intronic
999065947 5:148685649-148685671 CTTCACATCAGAGTCAAATGTGG - Intergenic
999857739 5:155613543-155613565 CTTCTACTCTGAGTGAAATGGGG + Intergenic
1000442712 5:161282320-161282342 CTTTTACTCTGATTGAAATGAGG + Intergenic
1001876470 5:175206112-175206134 CTTTTATTCAGAGTGAGATGAGG + Intergenic
1005238214 6:23791010-23791032 CTTCAAGTCACACGGAAATGGGG - Intergenic
1007408220 6:41646903-41646925 CTCCTAATCAGCCTGCAATGAGG + Intronic
1008325271 6:50173050-50173072 CTTATACTAAGACTGAAATGGGG - Intergenic
1008773913 6:55011327-55011349 CTTCCAATCAGATTGAATTAGGG + Intergenic
1009708857 6:67291290-67291312 CTGCCGCTCAGACTGAAATGCGG - Intergenic
1011465093 6:87647195-87647217 CTTTTACTCTGAGTGAAATGCGG - Intronic
1012867259 6:104633220-104633242 ATTATAATCAGGCTGAAATTGGG - Intergenic
1013634734 6:112018371-112018393 CTTATAATTAGGCTGAACTGAGG - Intergenic
1015611466 6:135025250-135025272 CTTCTTACCAAACAGAAATGTGG + Intronic
1015943378 6:138474553-138474575 CTGCAAATCAGACAAAAATGAGG + Intronic
1017225049 6:152011295-152011317 CTTCTACTCAAACAGAAATGAGG + Intronic
1017552463 6:155523637-155523659 CTTCTATTCAGTCTGCAGTGAGG + Intergenic
1019225681 6:170505650-170505672 CTTCAAATAAGACTTTAATGGGG - Intergenic
1022631715 7:32091740-32091762 CTTTTACTCAGAGTGAAATGAGG + Intronic
1022791166 7:33690590-33690612 CTTTTACTCTGAATGAAATGGGG - Intergenic
1026118864 7:67519094-67519116 CTTGTAATAGGACTGAACTGGGG + Intergenic
1027261878 7:76470645-76470667 ATTCTTATCAGACTGAGATTGGG - Intronic
1027313260 7:76968744-76968766 ATTCTTATCAGACTGAGATTGGG - Intergenic
1029351737 7:100017904-100017926 CTTCTAAGCAGGCTGAAAATTGG + Intronic
1033559057 7:142513898-142513920 CTACTAAACATACTAAAATGAGG - Intergenic
1035833050 8:2718844-2718866 TTTAGAATCATACTGAAATGAGG - Intergenic
1036263873 8:7259754-7259776 CTTCTCAGGAGAGTGAAATGAGG - Intergenic
1036265169 8:7267376-7267398 CTTCTCAGGAGAGTGAAATGAGG - Intergenic
1036266470 8:7274998-7275020 CTTCTCAGGAGAGTGAAATGAGG - Intergenic
1036267776 8:7282620-7282642 CTTCTCAGGAGAGTGAAATGAGG - Intergenic
1036269079 8:7290242-7290264 CTTCTCAGGAGAGTGAAATGAGG - Intergenic
1036270373 8:7297864-7297886 CTTCTCAGGAGAGTGAAATGAGG - Intergenic
1036297512 8:7549191-7549213 CTTCTCAGGAGAGTGAAATGAGG + Intergenic
1036298816 8:7556838-7556860 CTTCTCAGGAGAGTGAAATGAGG + Intergenic
1036300121 8:7564488-7564510 CTTCTCAGGAGAGTGAAATGAGG + Intergenic
1036301425 8:7572133-7572155 CTTCTCAGGAGAGTGAAATGAGG + Intergenic
1036302722 8:7579782-7579804 CTTCTCAGGAGAGTGAAATGAGG + Intergenic
1036315913 8:7718293-7718315 CTTCTCAGGAGAGTGAAATGAGG - Intergenic
1036317220 8:7725941-7725963 CTTCTCAGGAGAGTGAAATGAGG - Intergenic
1036318528 8:7733589-7733611 CTTCTCAGGAGAGTGAAATGAGG - Intergenic
1036319837 8:7741236-7741258 CTTCTCAGGAGAGTGAAATGAGG - Intergenic
1036321144 8:7748884-7748906 CTTCTCAGGAGAGTGAAATGAGG - Intergenic
1036322453 8:7756532-7756554 CTTCTCAGGAGAGTGAAATGAGG - Intergenic
1036323761 8:7764180-7764202 CTTCTCAGGAGAGTGAAATGAGG - Intergenic
1036325063 8:7771828-7771850 CTTCTCAGGAGAGTGAAATGAGG - Intergenic
1036350981 8:8012480-8012502 CTTCTCAGGAGAGTGAAATGAGG + Intergenic
1036352278 8:8020126-8020148 CTTCTCAGGAGAGTGAAATGAGG + Intergenic
1036353578 8:8027774-8027796 CTTCTCAGGAGAGTGAAATGAGG + Intergenic
1036846265 8:12172899-12172921 CTTCTCAGGAGAGTGAAATGAGG + Intergenic
1036867628 8:12415218-12415240 CTTCTCAGGAGAGTGAAATGAGG + Intergenic
1037416879 8:18660709-18660731 CTTCCAATCAGAGTTACATGTGG - Intronic
1039344445 8:36688484-36688506 ATTCTAATCAGACTGAAGAGGGG + Intergenic
1039742721 8:40397026-40397048 ATTGTACTCAGAATGAAATGAGG - Intergenic
1042093989 8:65191653-65191675 CTTCAAATCAGACTGGAAAGTGG - Intergenic
1042756936 8:72224855-72224877 CTTCTCATAAGAATGAAATTTGG - Intergenic
1044837835 8:96313467-96313489 ATTCTAATCAGGGTGGAATGGGG - Intronic
1044933664 8:97274274-97274296 CTTCCCATTAGACTAAAATGGGG + Exonic
1045654241 8:104370361-104370383 CTTCCAATCTTTCTGAAATGAGG - Intronic
1047663778 8:127067230-127067252 CTTCTTATCAGATTAAAATCAGG - Intergenic
1055241681 9:74193817-74193839 CTTTTCATCTGAGTGAAATGGGG + Intergenic
1057215855 9:93228432-93228454 CTTCTAAACAGACAGAAAGCAGG - Intronic
1058122005 9:101148857-101148879 CTTCCAAGCAGACGGAATTGTGG - Intronic
1058941871 9:109821013-109821035 CTACTTATTAGACTGAAATCAGG - Intronic
1059492614 9:114681765-114681787 CTTCTGATCAAAGTGCAATGGGG - Intergenic
1060255303 9:122023052-122023074 CTTCTAAACAGACTGAGCAGAGG + Intronic
1188395674 X:29680334-29680356 CTTCTAACCAGGAGGAAATGTGG + Intronic
1188863837 X:35289938-35289960 CACCTAATCAGACTGAAAGCTGG + Intergenic
1194155715 X:90385903-90385925 CTTAGAATCAGCCTGATATGAGG - Intergenic
1197821120 X:130541898-130541920 CTTTTACTCGGAATGAAATGTGG + Intergenic
1200502062 Y:3962842-3962864 CTTAGAATCAGCCTGATATGAGG - Intergenic