ID: 1106717945

View in Genome Browser
Species Human (GRCh38)
Location 13:32410265-32410287
Sequence CAGAAGGATGACAGGCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106717945_1106717952 12 Left 1106717945 13:32410265-32410287 CCGCAGGGCCTGTCATCCTTCTG 0: 1
1: 0
2: 0
3: 45
4: 306
Right 1106717952 13:32410300-32410322 CCAGGTCTCTTCACAGACCGCGG 0: 1
1: 0
2: 1
3: 10
4: 123
1106717945_1106717948 -6 Left 1106717945 13:32410265-32410287 CCGCAGGGCCTGTCATCCTTCTG 0: 1
1: 0
2: 0
3: 45
4: 306
Right 1106717948 13:32410282-32410304 CTTCTGAAAGAGCCTCACCCAGG 0: 1
1: 0
2: 1
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106717945 Original CRISPR CAGAAGGATGACAGGCCCTG CGG (reversed) Intronic
900294773 1:1943388-1943410 CAGCAGGAGGACAGGCGCCGCGG + Intronic
900553687 1:3269361-3269383 CAGGAGGAGGACAGTCCCAGAGG + Intronic
900553825 1:3269960-3269982 CAGAAGGAGGACAGTTCCAGAGG + Intronic
900553845 1:3270051-3270073 CCGGAGGATGACAGTCCCAGAGG + Intronic
900553924 1:3270399-3270421 CAGGAGGAGGACAGTCCCAGAGG + Intronic
900553979 1:3270660-3270682 CAGGAGGAGGACAGTCCCAGAGG + Intronic
900651415 1:3731861-3731883 CAGAAGAATGTAAGGCCCCGAGG + Intronic
900925961 1:5706124-5706146 CAGAGCTATGACAGGGCCTGGGG + Intergenic
902289166 1:15425647-15425669 CAGGAGGCTGCCAGGCCCTGTGG + Intronic
903386148 1:22928225-22928247 CAGCAGGAGCAAAGGCCCTGAGG + Intergenic
904282101 1:29427752-29427774 CAGAGGGAGGGCAGCCCCTGAGG - Intergenic
904353638 1:29924677-29924699 TAGGAGGCTGAGAGGCCCTGAGG - Intergenic
905556761 1:38891888-38891910 TGGAAGAATGACAGACCCTGGGG - Intronic
907386346 1:54128011-54128033 GAGAAGGAAGCCAGGTCCTGTGG + Intergenic
907400539 1:54222338-54222360 CAGCAGGAACAAAGGCCCTGGGG + Intronic
907473307 1:54688765-54688787 CAGAAGGCTGACGGGCTCTGGGG + Intronic
908727531 1:67192909-67192931 CAGAAGGGTGACATGGCCTGAGG - Intronic
909367604 1:74846008-74846030 CAGCAGGAGTGCAGGCCCTGAGG - Intergenic
910667320 1:89739363-89739385 TAGAAGGCTGCCTGGCCCTGGGG - Intronic
911128461 1:94364425-94364447 CAGTCCCATGACAGGCCCTGGGG + Intergenic
911444249 1:97970949-97970971 TAGAAGGATTATTGGCCCTGCGG + Intergenic
911512454 1:98824279-98824301 AAGAAGGGTGACAGGCGCGGTGG - Intergenic
912679946 1:111722621-111722643 CCAAAGGATGACATGCACTGGGG - Exonic
913078928 1:115364114-115364136 CAAAAGGGACACAGGCCCTGGGG - Intergenic
915319170 1:155046891-155046913 CAGAAGGATGGCTGGCACAGTGG - Intronic
916472282 1:165136143-165136165 CAGAGGGAAGACAGGCCTTGAGG + Intergenic
916800594 1:168212213-168212235 CAGAAGGAGGCCAGGCGCGGTGG + Intergenic
916803445 1:168235658-168235680 TACAAGGATGACAGGCCATAAGG - Intronic
917073095 1:171174565-171174587 AAGAAGGAAGACAAGCCCTGTGG + Intergenic
917334941 1:173916890-173916912 CGGATGGATGGCAGGCCCTGGGG + Intronic
918344822 1:183597898-183597920 TAGAAGGATGGTAGGCCCTGTGG + Intronic
920496116 1:206455981-206456003 CAGCAGGATGACAAGCCCCAGGG + Intronic
923524582 1:234762628-234762650 CACAGGGAGGACAGGGCCTGAGG - Intergenic
923936961 1:238772801-238772823 CAGAATTATCACAGGCACTGCGG + Intergenic
1063144279 10:3282628-3282650 CAGAAGGAAGCCAGGCTCAGTGG + Intergenic
1065506037 10:26431131-26431153 CAGAATGATGACAGGACTTCAGG - Intergenic
1065970682 10:30803841-30803863 CAGCAGGAGGGCAGCCCCTGAGG + Intergenic
1066107348 10:32167512-32167534 CAGGAGGATGACAGCCCCCATGG + Intergenic
1066297389 10:34066772-34066794 CAGCCCGATGACAGGCTCTGTGG - Intergenic
1067051274 10:43022784-43022806 CAGCAAGAGCACAGGCCCTGAGG + Intergenic
1067414682 10:46094385-46094407 CAGCAGAATGCCAGGCTCTGAGG + Intergenic
1067581245 10:47447441-47447463 CAGCAGAATGTCAGGCTCTGAGG - Intergenic
1068443485 10:57090266-57090288 CAGGAGGATGACACATCCTGAGG + Intergenic
1068643282 10:59435760-59435782 CAGGAGGCTGAAAAGCCCTGGGG - Intergenic
1069555423 10:69394641-69394663 CAGGAGGAGGACAGGCTCTCGGG + Intronic
1071292677 10:84198698-84198720 CAGCAGTATGCCAGGCACTGAGG - Intronic
1071875581 10:89839270-89839292 GAGATGGCTGAGAGGCCCTGTGG + Intergenic
1071974924 10:90945858-90945880 CTGGAGGATGAAAGGCCTTGTGG + Intergenic
1072122707 10:92418709-92418731 GAGATGGCTGAGAGGCCCTGCGG - Intergenic
1072948983 10:99835918-99835940 CAGAATGATGAGAGGCTCCGAGG - Intronic
1073219295 10:101856494-101856516 CAGAATGATGACAGTCTCTTTGG - Intronic
1074322889 10:112420073-112420095 CAGAATGATGCCAAGGCCTGAGG + Intronic
1074821296 10:117181154-117181176 AAGAAGCATGCCAGGCGCTGTGG + Intergenic
1075086387 10:119417015-119417037 CAGAAGGCTGGCAGGCCGTTGGG + Intronic
1075595637 10:123727205-123727227 CAGAAGAATGAAATGTCCTGGGG - Intronic
1075795827 10:125118764-125118786 CAGAGGGAAGCCTGGCCCTGAGG + Intronic
1076307037 10:129472693-129472715 CAGAAGGAGGCCTGGCGCTGGGG + Intronic
1076469683 10:130709856-130709878 CAGGAGGCAGACAGGCCTTGGGG + Intergenic
1077220361 11:1413012-1413034 AAGAAGGAGGCCAGGGCCTGGGG - Intronic
1077366148 11:2162131-2162153 CAGAAGGAGGGCATGACCTGGGG + Intergenic
1078699639 11:13668522-13668544 GAGGAGGATGACTGGTCCTGCGG + Intergenic
1079056006 11:17207523-17207545 CAGAAGGAGGGCAGGCCCCCCGG - Intronic
1080003811 11:27382729-27382751 CAGAAGGAGGCCAGGCACAGTGG + Intronic
1080393645 11:31870992-31871014 CACAGGGAGGACAGGCTCTGGGG - Intronic
1080782101 11:35439144-35439166 CAGAAGGATGTGAGCCCCTCTGG - Intronic
1081537892 11:44008465-44008487 CAGAAGAAGGACAGCCCCTGTGG - Intergenic
1083453476 11:62762202-62762224 TAGAATGAGGACAGCCCCTGTGG + Intronic
1083973837 11:66100933-66100955 CTGGAGGAGGACAGGCACTGAGG - Intronic
1084981217 11:72829801-72829823 CAGCAGGAAGAAAGGCCCTGAGG + Intronic
1085282986 11:75342795-75342817 CAGCAGGAACAAAGGCCCTGAGG + Intronic
1085385993 11:76158696-76158718 CAGCAGGATGACAGACCTTAGGG + Intergenic
1085456117 11:76666274-76666296 CAGAAGGCTGACAGACCCTAAGG + Intronic
1086085114 11:82945735-82945757 CAGAAGGCAGACAGGATCTGGGG - Intronic
1086436331 11:86784582-86784604 CAGCAGGATGACAGTCACTCTGG + Intergenic
1088152439 11:106760863-106760885 CAGAAGGAAGACAGGAACTGAGG + Intronic
1089053540 11:115566001-115566023 CAGAAGTATGACACCCCCTTAGG - Intergenic
1089287872 11:117419409-117419431 GAGAAAGTTGGCAGGCCCTGGGG + Intergenic
1089584855 11:119503814-119503836 CTGGAGGATGACAGACCCAGTGG - Intergenic
1090751260 11:129748356-129748378 CAGCACCATGACAGGCACTGAGG - Intergenic
1095651141 12:44610679-44610701 CAGGAGGATGTCAAGACCTGAGG + Intronic
1096768617 12:53916195-53916217 CAGAAGGATCCCAGCACCTGAGG - Intergenic
1097492007 12:60282553-60282575 CAGGAGGCAGACAGGCTCTGGGG - Intergenic
1098759438 12:74404440-74404462 CAGAAGTCTGACAGGCGTTGGGG + Intergenic
1099084394 12:78227013-78227035 CAGAATGATGAGAGGCTCTGGGG + Intergenic
1101212090 12:102544698-102544720 CAAAAGGAAGAGATGCCCTGTGG + Intergenic
1102522820 12:113489608-113489630 CTGGAGGATCACAGGCCCTGTGG - Intergenic
1103748301 12:123141313-123141335 CAGAAGTATGCCATGCACTGCGG + Intronic
1104540374 12:129658824-129658846 ATGAAGGATGAGAGGCCATGTGG + Intronic
1104970157 12:132527430-132527452 CAGGAGGACGACAGCCCCTGGGG + Intronic
1105438691 13:20398480-20398502 GAGGAGGATTACAGGCCCTTGGG - Intergenic
1105443288 13:20432689-20432711 CAGAAGAATGTCAGAGCCTGTGG - Intronic
1105624312 13:22098416-22098438 AAGAAGCATGACACTCCCTGCGG - Intergenic
1106717945 13:32410265-32410287 CAGAAGGATGACAGGCCCTGCGG - Intronic
1106718172 13:32412828-32412850 TTTCAGGATGACAGGCCCTGCGG - Intronic
1108508366 13:51133736-51133758 CAAAAGGTTGACAGCCACTGGGG - Intergenic
1109376434 13:61500342-61500364 GAGGAAGATGACAGGCACTGGGG + Intergenic
1110424015 13:75345032-75345054 CAGGAGGCTTCCAGGCCCTGAGG + Intronic
1116069956 14:40031408-40031430 CAGCAAGATCAAAGGCCCTGGGG + Intergenic
1117500398 14:56345466-56345488 CAGGAGGAAGACAGGCCGAGGGG + Intergenic
1118223178 14:63874462-63874484 CAGGAAGATGACAGGCCAAGGGG + Intronic
1120189062 14:81423516-81423538 CAGAAGGAAGCCAGGCACTGTGG + Intronic
1121855613 14:97266835-97266857 CAGTCGGATGACAGGCAATGAGG + Intergenic
1122067624 14:99184635-99184657 CACAGGGATGGCAGACCCTGTGG + Intronic
1122910675 14:104826447-104826469 CAGCAGGACGCCAGGCTCTGGGG - Intergenic
1123037664 14:105478061-105478083 CAGAGGGAGAACAGGGCCTGGGG + Intronic
1125343575 15:38697407-38697429 GAGAAGGATTCCATGCCCTGTGG + Intronic
1125518241 15:40334757-40334779 GAGAGGGAGGCCAGGCCCTGGGG + Exonic
1127645753 15:60957366-60957388 CTGAAGGATGACAGGCACAATGG - Intronic
1128091861 15:64924531-64924553 CAGAAGCAGGACTGGGCCTGTGG - Intronic
1129692622 15:77722356-77722378 CAGAGGGTTGCCACGCCCTGTGG - Intronic
1129715085 15:77842961-77842983 CTGAAGGAAGCCAGGCACTGTGG + Intergenic
1132278683 15:100593161-100593183 CAGGATGCTGACAGGCTCTGAGG + Intronic
1133003127 16:2861070-2861092 CACATGGATCAGAGGCCCTGAGG - Intergenic
1134040885 16:11067444-11067466 CAGAAGAAGCAAAGGCCCTGGGG + Intronic
1136061064 16:27726803-27726825 CAGCAGGAGCAAAGGCCCTGCGG + Intronic
1136089963 16:27911624-27911646 CAGCAGGTGCACAGGCCCTGAGG - Intronic
1138554192 16:57762558-57762580 CAGATGCATGCCTGGCCCTGTGG + Intronic
1141042571 16:80684642-80684664 GAGAAGGATGAGAGGCACTTTGG - Exonic
1141449760 16:84090650-84090672 TAGAAGGAAGACCGGCCTTGAGG + Intronic
1141789685 16:86226199-86226221 CAGGAGGAGGGCAAGCCCTGGGG + Intergenic
1142490343 17:274426-274448 CGGAGGGAGGACAGCCCCTGTGG - Intronic
1142782424 17:2191508-2191530 CAGGAGCATGACAGGAGCTGAGG + Intronic
1142850547 17:2702599-2702621 CAACAGGCGGACAGGCCCTGGGG + Intronic
1143337926 17:6187418-6187440 CTGCAGGAGGAGAGGCCCTGTGG - Intergenic
1144825421 17:18103101-18103123 CAGCAGGAGGAGAGGACCTGAGG - Intronic
1145236299 17:21210581-21210603 CAGATGGAGCACAGGCCCCGGGG - Intronic
1145942469 17:28749804-28749826 AAGAAGGGAGACAGGCCCTGGGG - Exonic
1146281003 17:31544465-31544487 CTGAAGGTTGAGAGGCCCCGAGG - Intergenic
1147377816 17:40033291-40033313 GAGAGGGAGGACACGCCCTGGGG - Intronic
1147793473 17:43027160-43027182 CTGAAGGAAGACAGGGCATGAGG - Intronic
1148456771 17:47815366-47815388 CAGATGGATGTCAGGCTCCGGGG + Intronic
1150314455 17:64156692-64156714 CAGTAGGATGGCAGTGCCTGAGG + Intronic
1150376949 17:64689292-64689314 CTGAAGGGTGACAGACCATGTGG - Intergenic
1150428179 17:65093872-65093894 CAGAAGGAGGCCAGGCGCCGTGG - Intergenic
1150485121 17:65537876-65537898 CAGAAGGGCCAGAGGCCCTGGGG + Intronic
1150630381 17:66876373-66876395 CAGATGGATGCCAGCCCCCGTGG - Intronic
1151430577 17:74059802-74059824 GAGGAGGATCACAGGCCTTGTGG + Intergenic
1151473915 17:74334621-74334643 CTGAAGGCTGACAGGCCCCAGGG + Intronic
1152157642 17:78645285-78645307 CAGGAGGATGACAGCCTCTGTGG + Intergenic
1152794062 17:82298283-82298305 GGGAGGGATGACATGCCCTGGGG + Intergenic
1153542659 18:6172565-6172587 CAGTAGGATGGCTGGACCTGGGG - Intronic
1153784242 18:8520297-8520319 GAGAAGGATGACTGGCCATGAGG - Intergenic
1154301662 18:13198907-13198929 CTGATGGTTGCCAGGCCCTGGGG - Intergenic
1155209594 18:23589040-23589062 CAGAAAGATGCCAGGCTTTGTGG - Intergenic
1156349565 18:36291841-36291863 CAGCAGCATGACATGCCCAGAGG - Intergenic
1156702187 18:39839387-39839409 CAGAAGAATGAAAGCCACTGGGG - Intergenic
1156899868 18:42288102-42288124 CAGAAGGAGGCTAGGCCCAGTGG - Intergenic
1157042922 18:44061239-44061261 CAGGAGGCAGACAGGCTCTGGGG - Intergenic
1158996428 18:62925173-62925195 CAGAAGGATGGCAATCCCTCTGG - Intronic
1159106900 18:64013240-64013262 AAGAAGAATGCCAGGCACTGGGG - Intergenic
1160993122 19:1869055-1869077 CATAAGGATGAAATGCCATGTGG + Intergenic
1161242045 19:3228068-3228090 CCGAAAGAGGGCAGGCCCTGGGG + Intronic
1161785015 19:6319213-6319235 CAGAAGGAGGACAGAGACTGTGG + Intronic
1162151214 19:8646903-8646925 CAGGAAGAACACAGGCCCTGAGG + Intergenic
1162314935 19:9933074-9933096 CAGAAGGTGCAAAGGCCCTGGGG - Intronic
1163126726 19:15248278-15248300 TAGAATGACGACAGCCCCTGGGG - Intronic
1163463694 19:17454594-17454616 GAGAAGCAGGACAGGACCTGGGG - Intronic
1163772263 19:19198249-19198271 CAGGAGGCTGAGAGGTCCTGGGG - Intronic
1164426675 19:28147810-28147832 CAGAGCCATGTCAGGCCCTGGGG + Intergenic
1165334804 19:35162245-35162267 GAGGAGGAAGAGAGGCCCTGGGG - Intronic
1165992337 19:39823812-39823834 CAGAAGGTTGACAGGCTGTGTGG - Intergenic
1166883927 19:45947289-45947311 CTGAAGGATGACACGCCCACAGG + Intronic
1166978222 19:46617458-46617480 CAGTGAGATGTCAGGCCCTGGGG + Intergenic
1167644464 19:50698153-50698175 AATAAGGATGACAGGCATTGGGG + Intronic
1167726835 19:51220496-51220518 CAGAAGGAGGCGAGGCCATGTGG - Intergenic
925170141 2:1745069-1745091 CAGGTGGCTGACAGGCCCCGGGG - Intergenic
925209185 2:2032551-2032573 CCGCAGGATGAGAGGCACTGGGG - Intronic
926009941 2:9399848-9399870 AGGAAGAATGAGAGGCCCTGAGG - Intronic
926305333 2:11633977-11633999 CAGCAGGGTGCCTGGCCCTGGGG + Intronic
927900034 2:26812457-26812479 CTGATGGATGACAGGGTCTGGGG - Intergenic
928298811 2:30107955-30107977 CAGAAGGAAGTCAGGATCTGAGG + Intergenic
928444222 2:31318860-31318882 CAGAAAGAAGACAGGCGCTGGGG - Intergenic
928723650 2:34147767-34147789 CAGAAGGCAGACAGGCTCTTGGG - Intergenic
930143795 2:47980670-47980692 CAGAAGGATGGCAGGAAATGGGG + Intergenic
930403505 2:50923034-50923056 CTGAAGAATTACAAGCCCTGTGG - Intronic
931196402 2:60055995-60056017 CAGAAGGAAGACAGAACCTGTGG + Intergenic
934884934 2:98016258-98016280 CAGAAAGATGACAGTCCTTCTGG - Intergenic
935045909 2:99482242-99482264 TGGAAGGATGACACGTCCTGAGG + Intronic
936022290 2:109003994-109004016 AAGAGGGATGACAGGCATTGAGG + Intergenic
937024928 2:118690015-118690037 CAGAAAGGTGACAGGCAGTGTGG + Intergenic
937072160 2:119072771-119072793 CAGCAGGTGCACAGGCCCTGAGG - Intergenic
937251127 2:120524514-120524536 CAGACAGAAAACAGGCCCTGGGG + Intergenic
937571121 2:123363254-123363276 TAGAAGGATGTGAGGCCGTGGGG - Intergenic
938140795 2:128793422-128793444 GAGAAGGAGGACAGGCCACGTGG + Intergenic
943521515 2:188957115-188957137 CAGAAGGATAACAGACCATCTGG - Intergenic
946114828 2:217452118-217452140 TAGAAGGCTGACTGTCCCTGAGG - Intronic
946146585 2:217735585-217735607 CAGCAGGAGCAAAGGCCCTGAGG - Intronic
948694912 2:239728353-239728375 CAGGAGGATGACTGGGGCTGAGG + Intergenic
1169058553 20:2643334-2643356 CATCAGAATGCCAGGCCCTGAGG + Intergenic
1169117900 20:3078000-3078022 CAGGAGGATGAGAGACCATGTGG + Intergenic
1171100537 20:22379625-22379647 CTGGAGGATGAGAGGCCCTGGGG - Intergenic
1173460892 20:43242689-43242711 CACAGGGATGACAGGAACTGTGG - Intergenic
1173509132 20:43612403-43612425 CAGAGGGAGGCCAGGCCCGGTGG + Intronic
1173545306 20:43893308-43893330 CAGAAGAATGACAGCTACTGAGG - Intergenic
1174087375 20:48018766-48018788 CAGCAGGTGCACAGGCCCTGGGG - Intergenic
1174128913 20:48328204-48328226 CAGCAGGTGCACAGGCCCTGGGG + Intergenic
1176060593 20:63170926-63170948 CAGAAGCATGGAAGCCCCTGTGG + Intergenic
1176887909 21:14277982-14278004 CTGAAGGATGACAGATCATGTGG - Intergenic
1176922009 21:14699033-14699055 CAGGAGGATGCCAGGCTATGTGG + Intergenic
1178782062 21:35613070-35613092 AACAAGGATGACAGGGCCTCAGG + Intronic
1179174009 21:38994201-38994223 GAGAATGAGGACAGGCCCAGGGG - Intergenic
1179482179 21:41685450-41685472 CAGCAGGGTGACAGGCGCTGGGG - Intergenic
1179791759 21:43759898-43759920 CAGAAGGACCCCAGGCCCTGGGG + Exonic
1179852700 21:44146564-44146586 CAGGAGGCTGAGAGGCTCTGGGG - Intergenic
1180184263 21:46131685-46131707 CAGCAGGTGGACAGGGCCTGGGG + Intronic
1180880130 22:19197701-19197723 CAGCAGGATGGCAGGGCCAGGGG - Intronic
1181859944 22:25810383-25810405 CTGAAGGAGGACAGGCACAGTGG - Intronic
1181971722 22:26695666-26695688 CAGCAGGAGCAAAGGCCCTGAGG + Intergenic
1182354240 22:29715199-29715221 GAGGAGGGGGACAGGCCCTGGGG + Intergenic
1183400952 22:37604077-37604099 CAGAAAGATGACAGAGCCTACGG - Intergenic
1183482628 22:38073614-38073636 CTGAGGGATGACAGGGCCTGAGG - Intronic
1183489387 22:38108560-38108582 CAGGGGGATGGGAGGCCCTGAGG + Intronic
1183751435 22:39723244-39723266 GAGAAGGATGCCAGGCACGGTGG - Intergenic
1184414815 22:44346135-44346157 CAGGATGATGAGAGGTCCTGAGG + Intergenic
1184496154 22:44842752-44842774 CAGGAGGTTGGCAGGGCCTGGGG + Intronic
1184587556 22:45458175-45458197 CACTGGGATGACAGGTCCTGAGG + Intergenic
949371263 3:3337090-3337112 CAGAAGGTTGAAAGGACCTTGGG - Intergenic
950206399 3:11084460-11084482 CAGAAGGCTGCCTGGGCCTGGGG - Intergenic
950310479 3:11953587-11953609 CAGAACCATGCCATGCCCTGGGG + Intergenic
950494594 3:13326085-13326107 CAGGAGCATGACCGGCACTGGGG - Intronic
950628339 3:14264938-14264960 CAGAACCCAGACAGGCCCTGAGG + Intergenic
952970485 3:38647842-38647864 CAGAAGGGGAACTGGCCCTGGGG - Intronic
953923449 3:46967717-46967739 CAGCTGTATGACAGGCCCTGGGG - Intronic
954317452 3:49808880-49808902 CAGAAGGAAGATAGGGCCTAGGG - Intronic
954973811 3:54674461-54674483 TAGAAGGATGACCGGCAGTGGGG + Intronic
956947438 3:74239018-74239040 CAGAAGTGTGGCAGGCACTGTGG + Intergenic
957771857 3:84704413-84704435 GAGAAGAATAACAGGCACTGGGG + Intergenic
961517329 3:127446086-127446108 CAGCAGGATGCAAGGCCCTGAGG + Intergenic
961675914 3:128566587-128566609 CAGAAGGAAGAAAGGACCAGGGG - Intergenic
962412038 3:135149767-135149789 CATGAGGGTTACAGGCCCTGTGG - Intronic
964091747 3:152885293-152885315 CAGAAGCATGCCAAGTCCTGAGG - Intergenic
965674739 3:171182783-171182805 CAGAAGAATGAGAGGCTGTGTGG + Intronic
966077873 3:175960593-175960615 CAGAAGGACAAAAAGCCCTGGGG - Intergenic
966149200 3:176848217-176848239 AAGAAGAATGGCAGGGCCTGGGG + Intergenic
967968724 3:194984125-194984147 CAGCAGGGCGACAGGCCCAGTGG - Intergenic
968736302 4:2298479-2298501 CAGACAGATGACAGACACTGAGG - Intronic
969128710 4:4974715-4974737 TTGCAGGATGACATGCCCTGAGG - Intergenic
969568242 4:7992761-7992783 CAGCAGGAGGAGAGGCCCCGGGG - Intronic
969688574 4:8690661-8690683 CAGAAGCAGCAAAGGCCCTGGGG + Intergenic
971260773 4:25054724-25054746 CAGAAGGCAGAAAGGCCCTGGGG + Intergenic
975711941 4:77169670-77169692 CTGAAAGATGAGAGGCCATGTGG + Exonic
976356399 4:84122671-84122693 CCGCAGGAGGAGAGGCCCTGAGG - Intergenic
976831256 4:89317349-89317371 CAGAAGACTCAAAGGCCCTGGGG + Intergenic
977770204 4:100849050-100849072 CAGCTAGATGGCAGGCCCTGTGG + Intronic
978309318 4:107368555-107368577 CTGAAGGATGACAGGCCATTTGG - Intergenic
979527028 4:121728257-121728279 CAGAAAGATGATGGGCTCTGGGG - Intergenic
979639117 4:122991370-122991392 CTGGAGGATGAGAGACCCTGTGG + Intronic
979985576 4:127309948-127309970 CATCAGGATCACAGGCCTTGAGG - Intergenic
979986335 4:127320210-127320232 CAGAAGGATGATAGGTGATGAGG + Intergenic
981405212 4:144359789-144359811 CAGAAGGATGACAAAGACTGAGG + Intergenic
981710182 4:147701464-147701486 TAGAATGATGACAGGGCCTCAGG - Intergenic
982069790 4:151685333-151685355 CAGGAGGCTGACAGCACCTGTGG + Intronic
984698088 4:182799448-182799470 CAGAAGGCTGACAGCCCGGGTGG - Intronic
985786721 5:1899423-1899445 AGGCAGGCTGACAGGCCCTGGGG + Intergenic
986556771 5:9017754-9017776 CAGGAGGAGGCCAGGCGCTGTGG - Intergenic
988962373 5:36383054-36383076 CAGGAGGATGAAAGGCCAAGAGG - Intergenic
989625800 5:43428484-43428506 CAGAGGGATGCCAGAGCCTGGGG - Intergenic
992163765 5:74028164-74028186 CAGAAAAATCACAGGCTCTGGGG + Intergenic
993050219 5:82917928-82917950 AAGAGGGATGAGAGGCACTGGGG + Intergenic
994805186 5:104437513-104437535 CAGAAGGATGAGTGGCACAGAGG + Intergenic
995541669 5:113191645-113191667 CAGAAGGAAGCCAGGTCATGGGG + Intronic
996888609 5:128389577-128389599 AAGGAGGATGTCAAGCCCTGGGG + Intronic
997756706 5:136406364-136406386 CAGATGGAGGACAGGCTCTGAGG + Intergenic
997907255 5:137830704-137830726 CAGAAGGATGTCAGCCCCTAAGG - Intergenic
998533918 5:142911377-142911399 GAGCAGGTGGACAGGCCCTGGGG - Intronic
998538459 5:142956286-142956308 CAGAAGCATGCCAGGCACAGTGG + Intronic
998617042 5:143752019-143752041 AAGAAGGGAGACAGGCCCTGGGG + Intergenic
998629763 5:143884952-143884974 CAGAAGCAGGAAAGTCCCTGAGG - Intergenic
999640877 5:153672125-153672147 CTGAAGGAGAACAGTCCCTGAGG + Intronic
1000988425 5:167886427-167886449 CAGAAGGATGAGAGGATATGTGG + Intronic
1001442877 5:171758912-171758934 GAGAATGATGACAGGAGCTGGGG + Intergenic
1001850868 5:174963735-174963757 CAGAAGCCTGACAGGGCTTGAGG + Intergenic
1002296227 5:178232726-178232748 CGGAAGGCTGCCAGGCCCAGTGG - Exonic
1002782397 6:377407-377429 CAGAAGGCCGAGAGGCCCAGAGG + Intergenic
1004780085 6:18898434-18898456 CAGAGTGGTGACAGGCCATGGGG + Intergenic
1005411086 6:25547608-25547630 CAGAAGTGTGCCAGGCCCTGGGG + Intronic
1006362570 6:33594991-33595013 CAGCATGAAGGCAGGCCCTGGGG + Intergenic
1006504217 6:34477513-34477535 CAGAAAGATGAGGGCCCCTGAGG + Intronic
1006802714 6:36769550-36769572 CCGAGGGCTGACAGGCCCTGAGG + Intronic
1006934843 6:37710162-37710184 CAGAAGGTACAAAGGCCCTGAGG + Intergenic
1007932826 6:45707861-45707883 CAGAAGGCACACAGGCCCTGTGG + Intergenic
1010864655 6:80959988-80960010 AAGAAGGATGACAGTGTCTGGGG - Intergenic
1013999641 6:116349693-116349715 TAGAAGGAGGCCAGGCCATGAGG - Intronic
1014822832 6:126011915-126011937 CAGTAGGTTCACAGGCCCAGTGG - Intronic
1014824317 6:126031592-126031614 CAGAAGCATGAGAGGCATTGTGG + Intronic
1016370239 6:143366157-143366179 AAGAAGGAGGAGAGTCCCTGAGG - Intergenic
1017044774 6:150337277-150337299 CAGCATGAGGAAAGGCCCTGTGG + Intergenic
1017756245 6:157531916-157531938 CAGAACGAGGCCAGGCCCTCTGG - Intronic
1018398176 6:163397088-163397110 CAGAAGGAAGCCAGGCCGCGAGG - Intergenic
1018685096 6:166298094-166298116 GAGAAGGAGGACAGGCGCTGAGG - Intergenic
1018845310 6:167551708-167551730 AAGAAGGAAGCCAGGGCCTGTGG + Intergenic
1019308780 7:348811-348833 CAGAGGGAAGAAAGGCCCAGGGG + Intergenic
1019950421 7:4367782-4367804 CAGAAGAATAACAGGCACAGAGG + Intergenic
1020536609 7:9405448-9405470 CAGAAGAATGAAAGGCCCAGAGG - Intergenic
1022119853 7:27297558-27297580 CAGAGAGATGACAGTCCCTGCGG - Intergenic
1022274956 7:28846215-28846237 CTGAAGGATGAGATGCCATGTGG + Intergenic
1023324285 7:39035885-39035907 CAAAAGGCTGCCAGGACCTGTGG - Intronic
1023962406 7:44937839-44937861 CAGGTGGATGAGAGACCCTGAGG + Intergenic
1026433617 7:70373166-70373188 AAGAAGGATGAGAGGGTCTGTGG + Intronic
1027050568 7:75018940-75018962 CACAAAGATGTCAGGCACTGAGG - Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1027858797 7:83548362-83548384 TATAAAGAAGACAGGCCCTGGGG - Intronic
1028596104 7:92547389-92547411 CAGGAGGCAGACAGGCTCTGGGG + Intergenic
1028614313 7:92748291-92748313 CAGAAGGAAGAAAGGCCTTTAGG + Intronic
1029003933 7:97187171-97187193 CAGAAGTATGCAAGGCTCTGAGG - Intergenic
1029382482 7:100222730-100222752 CACAAAGATGTCAGGCACTGAGG + Intronic
1029659734 7:101952061-101952083 CAGCAGCATCACAGGACCTGGGG + Intronic
1031186081 7:118481657-118481679 CACAAAGAAGAAAGGCCCTGTGG + Intergenic
1034391156 7:150788581-150788603 CAGAATGCCGACAGGCCCAGAGG - Intergenic
1034462126 7:151203825-151203847 CATCAGAATGACAGGACCTGGGG + Intronic
1034587253 7:152105424-152105446 CAGAATCAGGACAGGCGCTGAGG - Intronic
1034894423 7:154866835-154866857 CAGAAGGTTGCCAGGCCTTCTGG + Intronic
1035146259 7:156820789-156820811 CAGAAGGAGGGAAGGCTCTGCGG + Intronic
1035454980 7:159002200-159002222 CAGAAGGATGAGAGGCTATCTGG + Intergenic
1035643605 8:1201477-1201499 CAGAAGGAAGCCAGGTCCTGGGG + Intergenic
1036699134 8:11000172-11000194 TAGAAGGAAGACAGGACCAGGGG - Intronic
1037608729 8:20458859-20458881 CAGCAGGGTACCAGGCCCTGGGG - Intergenic
1038426798 8:27469150-27469172 CACAAAGAGCACAGGCCCTGTGG + Intronic
1038523403 8:28252758-28252780 CTGAAGGATGAGAGACCATGGGG + Intergenic
1039793680 8:40895036-40895058 CAGAAGGATGACAGGGATGGAGG + Intronic
1042568769 8:70139911-70139933 CAAAAAGATGCCAGGCACTGTGG - Intronic
1043538867 8:81236630-81236652 CAGTAGGATTACAGGCATTGTGG + Intergenic
1043553546 8:81403087-81403109 CAGGAGGATGAAAGGACCTGGGG - Intergenic
1043869233 8:85412745-85412767 CAGCATGCTGAAAGGCCCTGAGG + Intronic
1048441355 8:134461904-134461926 CAGATGGATGACAGGCACGGGGG + Intergenic
1048567155 8:135613558-135613580 CAGAAGGATGGCAGGAACTCGGG - Intronic
1049097542 8:140557862-140557884 CAGAAGGACGAGAGGGCCTGTGG - Intronic
1057050212 9:91917805-91917827 CAGAAGGATGCCCTGCACTGTGG - Intronic
1057202348 9:93148563-93148585 AAGAAGGATGCCAGGCACAGTGG - Intergenic
1057942542 9:99297600-99297622 AAGAGGGAGGACAGGACCTGTGG - Intergenic
1058929989 9:109709517-109709539 ATGAAGGAAGACTGGCCCTGAGG - Intronic
1058992632 9:110269367-110269389 CTGGAGGATGAAAGGCCATGTGG - Intergenic
1059389022 9:113987209-113987231 CAGAAGGATGTGGGGCCCTTAGG + Intronic
1059427889 9:114232415-114232437 AAGTGGGAAGACAGGCCCTGGGG + Intronic
1060673130 9:125488229-125488251 CAGAAGGATAACAGCACCTGAGG + Intronic
1060777981 9:126390671-126390693 CAGAAGGAGGCCAGGCGCGGTGG + Intronic
1060794943 9:126507135-126507157 TAGAAGGCTGACAGGCCAGGTGG - Intergenic
1060798321 9:126527431-126527453 CAGGGAGATGGCAGGCCCTGTGG - Intergenic
1061247812 9:129410071-129410093 CAGAAGGATGGGAGGACCGGAGG + Intergenic
1061766762 9:132886458-132886480 AAGTGGGATGACAGGCACTGTGG + Intronic
1062357986 9:136174032-136174054 CAGCAGGCTCAAAGGCCCTGAGG + Intergenic
1186611553 X:11142816-11142838 CAGAAGGGAAAGAGGCCCTGTGG + Intronic
1186836627 X:13444734-13444756 GAGAAGTATCACAGGCCCAGGGG - Intergenic
1188405044 X:29797471-29797493 CAGAAGGATGAGGGGGCCTGAGG - Intronic
1189366096 X:40389858-40389880 CTGAAGGATGACCTGCCATGTGG + Intergenic
1195963980 X:110413576-110413598 CAGAATGATGTCAGGACTTGGGG - Intronic
1197714302 X:129695253-129695275 CAGCAGGTTCAAAGGCCCTGAGG - Intergenic
1198271827 X:135062562-135062584 CAGAGGACTGACAGGGCCTGAGG + Intergenic
1198713530 X:139531785-139531807 CAGAAAGCTGACTGGCCCTGTGG + Intronic
1199225716 X:145370872-145370894 CAGCAGGACAACAGACCCTGTGG + Intergenic
1199545250 X:149002070-149002092 AAGAAGGACCACAGGCCCTCAGG + Intergenic
1199639699 X:149848166-149848188 CAGAGGGATCACAGTCTCTGTGG + Intergenic