ID: 1106722845

View in Genome Browser
Species Human (GRCh38)
Location 13:32453808-32453830
Sequence CTGGTGACTCTGAGCTCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106722841_1106722845 13 Left 1106722841 13:32453772-32453794 CCTTCTTCTCAAAGAACTGTGGT 0: 1
1: 1
2: 7
3: 34
4: 283
Right 1106722845 13:32453808-32453830 CTGGTGACTCTGAGCTCAAAGGG 0: 1
1: 0
2: 1
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106722845 Original CRISPR CTGGTGACTCTGAGCTCAAA GGG Intronic
900233013 1:1571675-1571697 CTGGCCACTCTGAACTAAAAAGG + Intronic
901885374 1:12218991-12219013 ATGGTGATTCTGAGCTCCAGAGG - Intergenic
903657485 1:24958202-24958224 CTAGTAACACTGACCTCAAAGGG - Intronic
906793003 1:48674962-48674984 CTGGTGACTCTGAGCTTTTTGGG + Intronic
909846825 1:80404582-80404604 CAGCTAACTCTGAGCTCAATGGG - Intergenic
910495496 1:87822299-87822321 ATACTGACTCTGACCTCAAAAGG - Intergenic
911705173 1:101002968-101002990 ATGGTGACTTTGAGTTCTAAAGG + Intronic
914213731 1:145605932-145605954 CTGGGGACTCAGAGCCCAGATGG + Intergenic
914465674 1:147926337-147926359 CTGGGGACTCAGAGCCCAGATGG + Intergenic
916337777 1:163692637-163692659 CGGGTGGCTCTCAGCTGAAAGGG + Intergenic
917060487 1:171032656-171032678 CTGGGATCTCTGAGCTCAAGGGG + Intronic
917494208 1:175525361-175525383 CTGATCAGTCAGAGCTCAAATGG - Intronic
918168816 1:181975574-181975596 CTGGGATCTCTGACCTCAAAAGG - Intergenic
918261735 1:182802366-182802388 CAGCTGACTCTGAGTTTAAAAGG - Intronic
918745611 1:188194946-188194968 CAGTTGACTCTGAGTTAAAAGGG + Intergenic
919666487 1:200297657-200297679 CTGGTGTCATTGAGCTCAATGGG - Intergenic
921096536 1:211891428-211891450 AGGGTTACTCTGAGTTCAAAAGG - Intergenic
922898529 1:229118997-229119019 CTGGGGACCCAGAGCTCACAAGG + Intergenic
1063431326 10:5991259-5991281 CTGGTGAGTCTGATTTTAAAGGG + Intergenic
1063986463 10:11509232-11509254 CCAGTGATTCTGACCTCAAAGGG + Intronic
1068126800 10:52851000-52851022 CTGGGACCTCTGACCTCAAAGGG + Intergenic
1070540355 10:77411242-77411264 GTGCTTACTCTGAGCTCACAGGG - Intronic
1074783904 10:116821855-116821877 CTGGTGTTTCTGAGCTGTAAAGG - Intergenic
1075948860 10:126460407-126460429 CTGGGCACTCTGAGCTCCCAAGG - Intronic
1076625187 10:131817434-131817456 GTGGTGACTCAGAGCTGAAGGGG + Intergenic
1077445989 11:2591164-2591186 CTGGTGCCTGCGAGCACAAAGGG - Intronic
1078689331 11:13563197-13563219 CTGGTGGCTCTCAGCTCTGAAGG - Intergenic
1080384862 11:31805249-31805271 CTGGGGAGTCTGAGCTCCAAGGG + Intronic
1083175181 11:60945276-60945298 CTGTTGGCTGTGAGCTCAGATGG - Intronic
1083827749 11:65212728-65212750 CTGAAGACTCTGAGCCCAACAGG - Intergenic
1091186304 11:133650782-133650804 CTGGTGACCCTCATGTCAAATGG - Intergenic
1096501149 12:52064430-52064452 CTGGTGAATGTGGCCTCAAATGG - Intergenic
1101928713 12:108994693-108994715 CTGGAGACTCTGAAGTCAGATGG - Intronic
1102297879 12:111750915-111750937 CTGGTCAGTCTTAACTCAAAAGG - Intronic
1104406566 12:128522491-128522513 CTTCTGAATCTGAGCTCCAATGG - Intronic
1106722845 13:32453808-32453830 CTGGTGACTCTGAGCTCAAAGGG + Intronic
1107401579 13:40074491-40074513 CTGCGGTCTCTGAGCACAAAGGG - Intergenic
1112463043 13:99619886-99619908 CTGGTCAAATTGAGCTCAAATGG - Intronic
1112709439 13:102110721-102110743 TTGGTGACTGTGAGATCTAAGGG - Intronic
1118055700 14:62077476-62077498 CTGGTGATTTTGAGCACACAGGG + Intronic
1118309234 14:64680547-64680569 CTGGGGCCTCTGAGAGCAAACGG - Intergenic
1120920313 14:89749071-89749093 CTGGTGACTCAGGGCTCCAAAGG + Intergenic
1121179670 14:91919440-91919462 CAGGGGTCTCTGACCTCAAAAGG + Intronic
1121709782 14:96029069-96029091 CTGGAGACGCTGGGCTTAAATGG - Intergenic
1121820543 14:96962304-96962326 CTGGTGTCTCTGAGATGAGAAGG + Intergenic
1127798995 15:62461826-62461848 CTGGTCACTCTGCGCTCACCAGG - Intronic
1128647802 15:69389784-69389806 CTGGTCGCTCTGACCTCAGATGG + Intronic
1130201274 15:81829308-81829330 ATGGTGACTCAGAGTTCCAAGGG + Intergenic
1130287863 15:82570703-82570725 CTGGTCACTCTCAACACAAAGGG + Intronic
1131529576 15:93180088-93180110 CTGCTGCTTCTGAGCTGAAAGGG + Intergenic
1132323024 15:100940985-100941007 CTGGGGACTCTGAGGCCCAAGGG + Intronic
1132476831 16:143550-143572 CAGCTGAGGCTGAGCTCAAAGGG - Intergenic
1133206146 16:4234994-4235016 CTGGTGACTCGCAGCACAGATGG - Intronic
1137282171 16:46986913-46986935 CTAATGACTTCGAGCTCAAATGG - Intergenic
1138262158 16:55631536-55631558 CTGGTGGCTTTGAGCTGAAGGGG + Intergenic
1139065670 16:63310806-63310828 CTAGGGACTCTGACTTCAAAAGG - Intergenic
1140963816 16:79944426-79944448 CAGGTGACTCACAGGTCAAATGG - Intergenic
1141977815 16:87529233-87529255 CTGGTGCAGCTGAGCTCCAAAGG - Intergenic
1143769883 17:9161902-9161924 CAGGTGACTCTGGGTTCAAGTGG + Intronic
1147880776 17:43652000-43652022 CTGGAGCCTCTGAGTTCAGATGG + Intronic
1152797999 17:82317342-82317364 CTGGGGGCTCTGAGCTCATGGGG + Intronic
1152997558 18:422094-422116 CTGGTGACTCTTACCTTACAGGG - Intronic
1153947155 18:10028248-10028270 CTGGTAACTGTCAGGTCAAAAGG - Intergenic
1159810582 18:73013910-73013932 CTTTTGACTCTGTGCTCACAAGG + Intergenic
1160198445 18:76776871-76776893 CGGGTGACTCTGAGTACAATGGG + Intergenic
1160715978 19:576991-577013 CTGGGGAGTCTGACCTCAGAAGG + Intronic
1161251685 19:3284303-3284325 GTGGTGACTGTGACTTCAAAGGG - Intronic
1161527055 19:4762708-4762730 GTGGGGACTCTGGTCTCAAAAGG + Intergenic
1165043539 19:33085933-33085955 TTGGTGCTTCTGATCTCAAAGGG - Intronic
1166209286 19:41295720-41295742 TTGGTGACCATGAGTTCAAAGGG + Intronic
1166972371 19:46577838-46577860 ATGGTGACTCAGAGCTCCCAAGG + Intronic
1167729505 19:51243161-51243183 CTGGGGACTGTGAGCTCCACTGG + Intronic
1168133631 19:54336803-54336825 CTGTCCACTCTGAGCTCAAAGGG - Intronic
925026277 2:609744-609766 CTGGTGATGCTCAGCTCAAGAGG - Intergenic
926545804 2:14238322-14238344 AAGGTAACTCTGGGCTCAAATGG + Intergenic
936535892 2:113310863-113310885 CTGGTGACGCTGAGGGCAACAGG - Intergenic
937198733 2:120182917-120182939 CAGGTGTGTCTGAGTTCAAAAGG + Intergenic
938017599 2:127880452-127880474 CTGGTGACTTTAAGCACTAAGGG - Intronic
939530308 2:143351540-143351562 CTGGTGACTCTGACCACCTAGGG - Intronic
944655725 2:201874923-201874945 CTGGTCAGTATGAGCTCAACTGG - Intronic
947475794 2:230446706-230446728 TGGGTGACTCAGAGCTCAGAGGG - Intronic
947858976 2:233345401-233345423 CTGGCGACCCTGACCTCAATGGG + Intronic
1169174941 20:3502777-3502799 CTGGTGTCTCTGGGCTGAAGAGG - Intronic
1170613861 20:17934109-17934131 GGGGTTACTCTGAGCACAAAAGG - Intergenic
1172814813 20:37678054-37678076 CCTGTGGCTCTCAGCTCAAATGG + Intergenic
1173653420 20:44682383-44682405 TAGGTGGCTCTGAGCTCAGAGGG + Intergenic
1173955479 20:47029134-47029156 CAGGGGACTCTGAGCTCAGAAGG + Intronic
1174028432 20:47599640-47599662 CTCATGACACTGATCTCAAAAGG + Intronic
1175945776 20:62558067-62558089 CTGGGGACTCTGAGCACTAAAGG - Intronic
1177828283 21:26108091-26108113 CCAGTGACTCTGAGCTGTAAGGG - Intronic
1177965731 21:27724650-27724672 CTGGTGACCTTGAACTGAAAGGG - Intergenic
1179054825 21:37921723-37921745 CTGGGAGCTCTGAGCTAAAATGG + Intergenic
1180070910 21:45435462-45435484 CTGGTGGGTCTGTGCTCAGAGGG - Intronic
1181099649 22:20530794-20530816 CAGGTGACTCAGAGCTCCAATGG + Intronic
1181524144 22:23469479-23469501 CTGTTGACTCCTAGCTTAAAGGG - Intergenic
1183707413 22:39482905-39482927 CTGGTGAGTCCGTGCTCAGAAGG + Intronic
1183737322 22:39651122-39651144 CTGGTGACCCTGAGGTCCAACGG + Intronic
1183740355 22:39665418-39665440 CTGGTGACTCTGGGCTGAGTAGG + Intronic
1184210423 22:43032098-43032120 CTGGTGACTCTAGTCTCCAATGG - Intergenic
951913337 3:27773979-27774001 ATGGTGACTTTCAGATCAAATGG + Intergenic
952826361 3:37528334-37528356 CTGGTGAGTTGGAGCTCAACAGG + Intronic
952834882 3:37594132-37594154 CTGCTGACCCAGAGCTCAGATGG - Intronic
954301548 3:49703215-49703237 CTGCTGGCTCTGACCTGAAATGG + Intronic
954559546 3:51544969-51544991 ATGGTGACACTGAGCTCAGATGG - Intronic
955148941 3:56347694-56347716 CTAGGGCCTCTGAGCTCAAGAGG - Intronic
955899886 3:63741256-63741278 CTGGTGTCTCTGAGCTGAAAAGG + Intergenic
959144032 3:102522726-102522748 CATTTGGCTCTGAGCTCAAATGG + Intergenic
960149156 3:114232814-114232836 CTGGTGCCTCTGAGCTTCACAGG - Intergenic
967279868 3:187811556-187811578 CTGGTGACTCTCAGCTGCTATGG + Intergenic
970232334 4:13923466-13923488 CTGGTGACTCTGAGAATAACTGG - Intergenic
971599579 4:28575307-28575329 CTTCTCACTCTGAGCTCACATGG + Intergenic
972436933 4:39044419-39044441 CTGTTGTCTCAGAGCTTAAAGGG - Intergenic
975261262 4:72302413-72302435 ATAGTGACTTAGAGCTCAAAAGG + Intronic
978423790 4:108561461-108561483 CTGGGGCCTCTGATCTAAAATGG + Intergenic
979771862 4:124535597-124535619 GCGGTGACACAGAGCTCAAAAGG - Intergenic
980184723 4:129446833-129446855 CTGGGATCTCTGACCTCAAAGGG - Intergenic
980839009 4:138234098-138234120 CACTTGACTCTGAGCTCTAAGGG + Intronic
984351537 4:178600785-178600807 CCCGTGACTCTTAGCTCAATTGG - Intergenic
984893526 4:184514906-184514928 CTGGTAACAATGAGCTGAAATGG + Intergenic
985517030 5:352320-352342 ATGGTCACTCTGAGGTTAAATGG + Intronic
985517044 5:352394-352416 ATGGTCACTCTGAGGTTAAATGG + Intronic
985517076 5:352579-352601 ATGGTCACTCTGAGTTTAAATGG + Intronic
985517118 5:352801-352823 ATGGTCACTCTGAGGTTAAATGG + Intronic
988285618 5:29212587-29212609 CTGGTGATTCTTGACTCAAATGG - Intergenic
992230862 5:74662649-74662671 CTGGTGACAGTGTGGTCAAAGGG - Intronic
992610046 5:78499818-78499840 TTGGTGACACTCAGATCAAATGG - Intronic
993679014 5:90851993-90852015 ATGGTGACTCTCAGCCTAAAAGG - Intronic
993766584 5:91866426-91866448 CTTGTGACTCAGAACACAAATGG + Intergenic
994859632 5:105171905-105171927 CTGGTGAGTCTGTACTGAAAAGG + Intergenic
1001040604 5:168332230-168332252 CTGATGACTCAGAGCTGAGAAGG + Intronic
1001701492 5:173709932-173709954 GCGGGGACTCTGAGCTCAGATGG - Intergenic
1004280617 6:14276547-14276569 CTGGTCACTCTGGTCTCAAGGGG + Intergenic
1005273433 6:24190851-24190873 CTGCTGTCTCTGAACTAAAAGGG - Intronic
1005346303 6:24894080-24894102 CTGTTGACTTTGACCTCTAATGG - Intronic
1006577903 6:35059402-35059424 CTTGAGCCTCTGAGCACAAAGGG + Intronic
1007162164 6:39800572-39800594 CTGGGGACTCAGTCCTCAAAGGG - Intronic
1007461988 6:42025706-42025728 CTTGTGACTCAGAGCCCAAAAGG - Intronic
1008356874 6:50565490-50565512 ATGGTGGCTCTGGGCTCTAATGG - Intergenic
1008669121 6:53748708-53748730 CTAGAGACACTGGGCTCAAATGG + Intergenic
1015629383 6:135216027-135216049 TTGGTGGCTGTAAGCTCAAAAGG - Intronic
1015660093 6:135565949-135565971 CTGGGATCTCTGACCTCAAAGGG + Intergenic
1018231661 6:161681763-161681785 CTTGGGACTGTGAGCTCCAAAGG - Intronic
1018698920 6:166412062-166412084 CTGGTGACACGGAGCTCTCAAGG + Exonic
1022379370 7:29845318-29845340 CTGCTGTCACTGAGCTCAAGGGG - Intronic
1027944119 7:84723350-84723372 CTGGAAACTCTGACCTCAAGGGG - Intergenic
1028851842 7:95546593-95546615 CGGCTGAGTCTGGGCTCAAAAGG - Intergenic
1034244568 7:149634762-149634784 GTGGTGAGTCTGAGGGCAAAAGG - Intergenic
1034731758 7:153393003-153393025 CTGATGGCTCTGAGCTGAAAGGG + Intergenic
1039496723 8:37986065-37986087 CTGCTGCCTTTGATCTCAAATGG - Intergenic
1041248430 8:55911521-55911543 CTGGTGACCCTGAACTCGTAGGG + Intronic
1046056064 8:109080607-109080629 CTGGTACCCCTGAGCTTAAAAGG + Intergenic
1046521733 8:115333898-115333920 CAGGTGAGTCTGAGATCACATGG - Intergenic
1048965161 8:139609598-139609620 CTGATGACTCACAGCTCAACTGG + Intronic
1049680346 8:143915367-143915389 CTGGTGTCCCTGGGCCCAAAGGG + Exonic
1051878741 9:21818239-21818261 CTGGTCATTTTCAGCTCAAATGG + Intronic
1053207511 9:36199166-36199188 CTGGTTAATGTGAGCTAAAAAGG - Intronic
1054854840 9:69887802-69887824 CTGGTGGCTCAGAGCTTAAAAGG - Intronic
1056544338 9:87601352-87601374 CTTGTGACTCTGAGCTCCCAAGG + Intronic
1057014659 9:91641258-91641280 CTGAGGAATCTGAGCTCAAAAGG + Intronic
1057966516 9:99509135-99509157 CTTGTGACTCTAAGATAAAAGGG + Intergenic
1059475814 9:114546821-114546843 CTGGGGATTCTGGGCTCAGAAGG + Intergenic
1060172924 9:121476454-121476476 CTGGGGAATCTTAGCTCCAAAGG - Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060484232 9:124037074-124037096 CTGGTGAAACTCAGCTCACAGGG + Intergenic
1061620113 9:131806495-131806517 CTGGTGTCTCTGGGCTCAGCAGG - Intergenic
1062668940 9:137694979-137695001 CTGGTGAGTGTGAGGTCAGAGGG - Intronic
1188805227 X:34579583-34579605 ATGTTTTCTCTGAGCTCAAAGGG - Intergenic
1190412740 X:50153237-50153259 CTGTGGAGTCTGAGCTCACAGGG - Intergenic
1193886931 X:86994086-86994108 CTGGTTATTCTGGGCTCAAGGGG - Intergenic
1194374542 X:93115463-93115485 CTGGTGTATCTGATTTCAAATGG + Intergenic
1195235865 X:102897743-102897765 CTGCTGTCTCTGAGCTCAGCAGG + Intergenic
1199045524 X:143166610-143166632 TTGATGACTTTGAGGTCAAATGG + Intergenic
1200682565 Y:6229521-6229543 CTGGTGTATCTGATTTCAAATGG + Intergenic