ID: 1106726905

View in Genome Browser
Species Human (GRCh38)
Location 13:32495622-32495644
Sequence GAGCTGGCCTGGTACCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 1, 2: 9, 3: 19, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106726899_1106726905 9 Left 1106726899 13:32495590-32495612 CCAGTTCCTGTTCTTTCATGTCT 0: 1
1: 0
2: 2
3: 60
4: 815
Right 1106726905 13:32495622-32495644 GAGCTGGCCTGGTACCCAGCAGG 0: 1
1: 1
2: 9
3: 19
4: 220
1106726900_1106726905 3 Left 1106726900 13:32495596-32495618 CCTGTTCTTTCATGTCTCCTCTG 0: 1
1: 1
2: 2
3: 32
4: 393
Right 1106726905 13:32495622-32495644 GAGCTGGCCTGGTACCCAGCAGG 0: 1
1: 1
2: 9
3: 19
4: 220
1106726897_1106726905 28 Left 1106726897 13:32495571-32495593 CCAGTCCAGATTACTGAATCCAG 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1106726905 13:32495622-32495644 GAGCTGGCCTGGTACCCAGCAGG 0: 1
1: 1
2: 9
3: 19
4: 220
1106726898_1106726905 23 Left 1106726898 13:32495576-32495598 CCAGATTACTGAATCCAGTTCCT 0: 1
1: 0
2: 0
3: 6
4: 160
Right 1106726905 13:32495622-32495644 GAGCTGGCCTGGTACCCAGCAGG 0: 1
1: 1
2: 9
3: 19
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106726905 Original CRISPR GAGCTGGCCTGGTACCCAGC AGG Intronic
900564015 1:3323583-3323605 TCCCTGGCCTGGGACCCAGCAGG - Intronic
900604670 1:3518631-3518653 GAGCTGGCCTGGAAACCACTGGG - Intronic
901813690 1:11782016-11782038 GGGCTGGCCTGGTCACCAGCAGG + Intronic
901817250 1:11801340-11801362 GACGTGACCTGGCACCCAGCAGG - Exonic
901882661 1:12203303-12203325 GCCCTGGTCTGGTGCCCAGCTGG - Intronic
903259177 1:22122062-22122084 GGTCTGGCCTGTTCCCCAGCTGG + Intronic
904078878 1:27859338-27859360 GAGCCCGCCTGGAGCCCAGCGGG + Intergenic
904500671 1:30911049-30911071 TACCTGGCCTGGCACACAGCAGG - Intergenic
905414697 1:37795745-37795767 GTCCTGTCCTGGTACCCACCTGG + Exonic
905890567 1:41516193-41516215 GCGTTGGCCTGGATCCCAGCAGG - Intronic
907899604 1:58725930-58725952 GAGCTTTCCTGGAACCCAGAAGG + Intergenic
910851234 1:91651504-91651526 GAGAGTGCCTGGTACACAGCTGG + Intergenic
912547826 1:110463776-110463798 GGGCTGGCCTGGTACAGGGCAGG + Intergenic
912785870 1:112603743-112603765 CAGCTGTGCTGGTACCCTGCAGG - Intronic
913323895 1:117609768-117609790 GAGCTGGCCTGGCACACAGAAGG + Intronic
914713284 1:150234632-150234654 GAGCAGGGCTGGTGGCCAGCGGG - Intronic
915285105 1:154847327-154847349 GAGCTGGGCCGGCACCCAGCTGG + Intronic
916022232 1:160802480-160802502 GAGCTGGCCTCCAACCCTGCGGG + Intronic
917068973 1:171128354-171128376 GGGCTGGCCTGGTACCGGGGTGG - Intergenic
917356525 1:174131648-174131670 GAGTGGGCATGGTAGCCAGCTGG - Intergenic
920340593 1:205272936-205272958 GACCTCTCCTGGTACTCAGCAGG - Exonic
920390952 1:205600696-205600718 GAGCTGTCCAGATACCCAGATGG + Exonic
920398366 1:205662228-205662250 GAGCAGGGCTGGTCCACAGCAGG - Intronic
921220711 1:212971872-212971894 GCACTGGCCTGGTACACAGATGG - Intronic
921924470 1:220699933-220699955 GTGCAGGCCTGGAACCCGGCAGG - Intergenic
924312869 1:242763954-242763976 GACCTGCCCTGGTGCCAAGCAGG + Intergenic
1063127175 10:3145540-3145562 GAGCTGCTCTGGCACCCACCAGG + Intronic
1065676356 10:28178588-28178610 GAGCTGGTCTTGAACCCAGGTGG - Intronic
1067052119 10:43027722-43027744 AGGCTGGCCTTGTGCCCAGCTGG + Intergenic
1067836625 10:49645547-49645569 GAGCAGGCCTGGCCCCCAACAGG + Intronic
1069573168 10:69506777-69506799 GGGCTGCCCTGATTCCCAGCAGG + Intronic
1070913725 10:80139370-80139392 GAGGAGGCCTGGAATCCAGCTGG - Intronic
1071144951 10:82557876-82557898 GAGCTGGCTTTGCACCCAGAAGG + Intronic
1071513702 10:86283127-86283149 GAGTTGGCCAGGCACACAGCAGG - Intronic
1071728126 10:88219970-88219992 GAGCTGAGCTGGTACCCTGATGG + Intergenic
1072169756 10:92848300-92848322 GCGGCGGCCGGGTACCCAGCTGG - Intronic
1076652044 10:131996662-131996684 GTGCAGGCCCGGTGCCCAGCTGG - Intergenic
1077429297 11:2508087-2508109 GAGCTGGCCTGGGCCCCAGCAGG + Intronic
1077455030 11:2673307-2673329 AAGCTGGCCTGGTAGCCTGTGGG - Intronic
1078165777 11:8883129-8883151 GAGCTGTTCAGGTACCCATCTGG - Intronic
1082118789 11:48356312-48356334 GGGCTGGCCTGGTACTAGGCAGG + Intergenic
1082245245 11:49913884-49913906 TAGCGAGCATGGTACCCAGCAGG - Intergenic
1082806605 11:57455709-57455731 GAGCAGGCCTGGTGACCAGTGGG + Intergenic
1083615387 11:64023624-64023646 CTGCTGGGGTGGTACCCAGCTGG + Intronic
1083630498 11:64092656-64092678 GTGCCTCCCTGGTACCCAGCTGG - Intronic
1083898577 11:65632698-65632720 GAGCTGGCCTGGCACATATCAGG - Intronic
1084694524 11:70745676-70745698 GAGCTGGCCTGGCCCCCACCTGG + Intronic
1084810223 11:71607507-71607529 GACCAGGCCTGGTCCCGAGCAGG + Intergenic
1086061088 11:82700662-82700684 GACCATGCCTGGTACCCAGTGGG - Intergenic
1089359103 11:117874660-117874682 GAGCTGGCCTGATCCTCTGCTGG + Intronic
1092123954 12:6063047-6063069 GAGGTCACCTGGAACCCAGCAGG + Exonic
1092523465 12:9295297-9295319 GAGCTGGGCTAGAACTCAGCCGG + Intergenic
1092543831 12:9436602-9436624 GAGCTGGGCTAGAACTCAGCCGG - Intergenic
1094044121 12:26148196-26148218 GAGATGACCTGGCACTCAGCTGG - Intronic
1094509115 12:31085449-31085471 GAGCTGGGCTAGAACTCAGCTGG + Intronic
1095042246 12:37455728-37455750 GAGTGGGGCTGGGACCCAGCAGG + Intergenic
1095925986 12:47579705-47579727 GATCTGGGCTGGTACAAAGCTGG + Intergenic
1101278946 12:103230384-103230406 AAGCTGGCTTGGTACCAAGGAGG + Intergenic
1101589414 12:106112631-106112653 GAGCTGGCTTGGTTCCCATGGGG - Intronic
1101804180 12:108048975-108048997 GACATGGCCTGGTTCCTAGCAGG + Intergenic
1102238771 12:111310706-111310728 GACCTGGCGTGGTGGCCAGCGGG - Intronic
1102253179 12:111401326-111401348 GGCCTGGCCTGGCCCCCAGCTGG - Intergenic
1102854630 12:116282694-116282716 GAGATTGCCTGCTGCCCAGCGGG + Intergenic
1106434127 13:29708693-29708715 GAGCTGGCCGGGGGACCAGCAGG - Intergenic
1106726905 13:32495622-32495644 GAGCTGGCCTGGTACCCAGCAGG + Intronic
1110702454 13:78564869-78564891 GAGCTTCCCTGGTAACTAGCTGG - Intergenic
1113468385 13:110527689-110527711 AAGCTGGACTGGACCCCAGCAGG + Intronic
1115576254 14:34714717-34714739 GGGCACGCCTGGTCCCCAGCCGG + Intronic
1117603579 14:57400940-57400962 GAGCTGGAGTGGTCTCCAGCTGG - Intronic
1121001374 14:90454160-90454182 GAGGCAGCCTGGTACCCAGGAGG - Intergenic
1121422429 14:93824941-93824963 CCGCTGCCCTGGTACACAGCAGG + Intergenic
1122865457 14:104601977-104601999 CAGCTGGCCTGCATCCCAGCCGG + Intronic
1122898355 14:104771625-104771647 GGGCAGCCCTGGGACCCAGCTGG - Intronic
1124087287 15:26562712-26562734 CAGCTGGCCTGGGAATCAGCTGG + Intronic
1124665828 15:31591547-31591569 GAGCTGGCCTTGGACTCAGCTGG + Intronic
1125410847 15:39404745-39404767 GTCCTGGGCTGGTTCCCAGCTGG - Intergenic
1125967173 15:43883788-43883810 GAGCAGGGATGGTTCCCAGCCGG - Exonic
1128704153 15:69826315-69826337 GAGCTGGCAAGGGAACCAGCAGG - Intergenic
1129262834 15:74378398-74378420 CAGCGGGCCTGGAACCCATCTGG - Intergenic
1129325840 15:74799946-74799968 GAGCTGGCCTGGGAAGCTGCAGG - Intronic
1129718844 15:77866789-77866811 GAGCTGTCCTGGTGCCCAGCAGG + Intergenic
1130460085 15:84154071-84154093 GAGCTGTCCTGGTGCCCAGCAGG - Intergenic
1131268906 15:90934937-90934959 GAGCGGGCCTGGGCCCCTGCGGG - Intronic
1132958800 16:2610974-2610996 GAGGTGGCCAGGAAGCCAGCGGG - Intergenic
1132965176 16:2649665-2649687 GAGCAGGCCTTGAAGCCAGCTGG + Intergenic
1133323502 16:4929422-4929444 GAGCTGGCGTGGGGCACAGCTGG - Intronic
1133758789 16:8781802-8781824 GAGATGGACTGGCACCCAGGAGG - Exonic
1134334427 16:13284531-13284553 GAGCTGACCAGGTAATCAGCAGG - Intergenic
1136995926 16:35188019-35188041 CAGCTGGCCTGGGACCCATCAGG - Intergenic
1137728557 16:50673385-50673407 GAGCCGGCCTGGGACCCCGCAGG - Exonic
1140476454 16:75241670-75241692 TGGGTGGCCTGGTACCCAGGAGG - Intronic
1141715941 16:85726915-85726937 GAGCTGGCCTGGCACAGAGCGGG - Intronic
1142428515 16:90013456-90013478 GGGCTGGCCAGGGACGCAGCTGG + Intronic
1142811648 17:2398268-2398290 GAGCTATCCTGGTGCCCAGACGG - Intronic
1143115564 17:4580112-4580134 GCACTGCCCTGGGACCCAGCTGG + Intergenic
1143295320 17:5867154-5867176 GAGCTGGGCTGGCCTCCAGCGGG + Intronic
1144656710 17:17042004-17042026 GAGGGGGCCTGGTACACAGTAGG + Intergenic
1144670686 17:17131072-17131094 GAGCTGCCCAGGGACCCATCAGG - Intronic
1145311697 17:21704379-21704401 GAGCTGGGCTGCTTCCCCGCAGG - Exonic
1145785128 17:27588570-27588592 CAGCCGGGCTGGTACCCAGATGG + Intronic
1147423101 17:40332224-40332246 GCCCTGGCCTGGCGCCCAGCTGG - Intronic
1152586106 17:81190193-81190215 GGGGAGGCCTGGTACCCAGATGG + Intronic
1153291855 18:3509522-3509544 CAGCTGCCCTGCTACCCACCAGG + Intronic
1154346798 18:13549389-13549411 GAGCTGCCATGGTCCCCAGCTGG + Intronic
1157159782 18:45303225-45303247 CAGCTGGCTTGGTTACCAGCTGG + Intronic
1157794483 18:50560867-50560889 GAGCCGGCCCGGGACCCAGCTGG - Intronic
1158903394 18:61987224-61987246 GAGCAGGCCTGTTTCTCAGCGGG + Intergenic
1160880025 19:1315541-1315563 GACCTGTCCAGGTCCCCAGCAGG + Intergenic
1161714207 19:5866354-5866376 CAGCTGGCAAGGTCCCCAGCAGG + Exonic
1162380052 19:10326342-10326364 TAGCAGGCCTGGTACGTAGCAGG + Intronic
1162803927 19:13126843-13126865 GACCTGGCCAGGTACACAGTGGG - Intronic
1163651174 19:18518891-18518913 GTGTTGACCTGGTAGCCAGCTGG - Intronic
1164596408 19:29533305-29533327 CAGCTTGCCTGGATCCCAGCGGG + Intronic
1166007424 19:39917042-39917064 GACAGGGCCTGGTACGCAGCAGG + Intronic
1166229927 19:41420822-41420844 GTGCAGGCCTGGCACCCAGTGGG - Intronic
1166999434 19:46737188-46737210 GAGCTGGGCTTGAACCCAGTCGG - Intronic
1167402761 19:49283857-49283879 GACCAGGCCTGGTACACAGATGG + Intergenic
1168266529 19:55226700-55226722 GACCAGGCCTGGTGCCCAGTGGG - Intronic
925036995 2:695262-695284 GAGCTGGCATGGAGCCCAGTGGG - Intergenic
925210782 2:2043734-2043756 GAGCAGGCCTGCTACCCTGGAGG + Intronic
925387614 2:3473134-3473156 CAGCCTGCCTGGTTCCCAGCAGG + Intronic
925393810 2:3518570-3518592 GAGCTGGCTTGGGTCCCGGCTGG - Intronic
927826643 2:26313943-26313965 GGACAGGCCTGGAACCCAGCAGG + Intronic
928205944 2:29283471-29283493 GAGCTGACATGGTACCGAGATGG + Intronic
930186964 2:48420312-48420334 AAGGTGGCCTGGAGCCCAGCAGG + Intergenic
930591115 2:53327558-53327580 GAGCTGGGCAAGTAACCAGCTGG - Intergenic
931271881 2:60710792-60710814 GAGCTGGCCTGGCACACAGCTGG + Intergenic
932454221 2:71836002-71836024 GAGATGGCGTGGTACCCATGGGG + Intergenic
932659847 2:73642479-73642501 GAGCTGGGCTGTAACACAGCAGG + Intergenic
932666414 2:73702155-73702177 GAGCTGGGCTGTAACACAGCAGG + Intergenic
933667078 2:84971914-84971936 GAGCCGGCCCGGGACCCGGCAGG + Intronic
936523942 2:113230209-113230231 GTGCTGGCCTTGTGCCCTGCAGG + Intronic
937459521 2:122074035-122074057 CACAAGGCCTGGTACCCAGCAGG - Intergenic
941394988 2:164963153-164963175 GATCAGTCTTGGTACCCAGCTGG - Intergenic
942251484 2:174051116-174051138 GAGCAGGCCTGGTATATAGCAGG - Intergenic
944190251 2:196995288-196995310 GAGCTAGTCTGGCACACAGCAGG + Intronic
945198058 2:207255879-207255901 AGGCCGCCCTGGTACCCAGCCGG + Intergenic
947335631 2:229079968-229079990 GAGCTTGCCTGGGACTCTGCCGG + Intronic
947723368 2:232382090-232382112 GAGCCTGCCTGGTACCCACTGGG - Exonic
948214154 2:236216173-236216195 GAGCTGGCCTTGGTCTCAGCTGG + Intronic
1169201265 20:3711310-3711332 GAGCTGGCCTGGTACACAGTGGG + Intergenic
1169219615 20:3814417-3814439 GAGCTCCACTGGTGCCCAGCTGG - Intergenic
1169379824 20:5096696-5096718 CAGCTGGCCTGCTAGGCAGCTGG + Intronic
1170751704 20:19154097-19154119 ATGCTGGCCTGGAATCCAGCTGG + Intergenic
1172011246 20:31847092-31847114 GAGCTGGCCTGGTACAGAGTGGG - Intergenic
1172095476 20:32458055-32458077 GAGCTGGTCTGGTTCCCGGGTGG - Intronic
1172641942 20:36445749-36445771 GGGCTGGCCTGGGCCACAGCGGG - Intronic
1173580397 20:44142924-44142946 CACCTGGCCTAGCACCCAGCAGG - Intronic
1173748218 20:45454512-45454534 GAGCTGTCCTGACACTCAGCGGG - Intergenic
1174338955 20:49884100-49884122 GGGCTGGCCTGCTACGCAGCTGG + Intronic
1174352578 20:49979237-49979259 CAGGTGGCCTGGGACCCGGCAGG - Intergenic
1174353803 20:49985484-49985506 GAGCTGGGCAGGCACCCAGGAGG - Intronic
1175820662 20:61907191-61907213 GAGCTGACCTGGTGCCCGGGGGG - Intronic
1175868316 20:62193497-62193519 GGGCTGGCCTGAAGCCCAGCCGG + Exonic
1179979057 21:44887074-44887096 GGCCTGGCCTGGAATCCAGCAGG - Intronic
1181017744 22:20080701-20080723 GTGCTCGCCTGGGACCCTGCCGG + Intronic
1181433635 22:22897646-22897668 GGGATGGCCTTGTGCCCAGCAGG - Intergenic
1181876235 22:25943123-25943145 GAGCTGGGCTGGGAGCCAGGAGG - Intronic
1181974975 22:26722538-26722560 GGGTGGGCCTGGGACCCAGCAGG + Intergenic
1182125820 22:27815305-27815327 GGGCTGGCCTGGCACACAGTAGG - Intergenic
1182489656 22:30662940-30662962 GAGGTGGCCTGGGACCCCCCAGG + Exonic
1183184763 22:36285583-36285605 GAGCTGGCCTTGGACCCAGCCGG - Intronic
1183278938 22:36922088-36922110 GGTCTGGCCTGGCTCCCAGCTGG + Exonic
1183733396 22:39630605-39630627 GAGCATGCCTGGTTTCCAGCGGG + Intronic
1183942824 22:41305747-41305769 GTGCTGGGCCGGCACCCAGCAGG - Intronic
1184072065 22:42152609-42152631 GAGCAGGCCCTGTGCCCAGCTGG - Intergenic
1184095114 22:42312282-42312304 GGGCTGTCCTGGTACCAGGCAGG - Intronic
1184164475 22:42719775-42719797 GACCTGGCCTGAGACCCACCAGG + Intronic
1184746941 22:46461685-46461707 GCGCTGGCCTGGTATACAGTAGG + Intronic
1184912532 22:47546014-47546036 AAGCTGCTCTGGTACCCAGAAGG + Intergenic
1185113647 22:48919022-48919044 GAGCTGTGCTGGTGCCCAGATGG + Intergenic
949402990 3:3684681-3684703 GAGCAGCCCTGCTGCCCAGCTGG + Intergenic
949901935 3:8822359-8822381 GAACTGGCCTGGTTCCCTGAGGG + Intronic
950454086 3:13082460-13082482 CAGCTGGCCTGGTACCCAGCGGG + Intergenic
952917079 3:38254803-38254825 GAGATGGTCTGGTGCCTAGCTGG + Exonic
954635587 3:52069107-52069129 GAGTGGGCCTTGTAGCCAGCTGG + Intergenic
954912314 3:54121053-54121075 GAGCCGGCCTGGCTCCTAGCCGG + Intergenic
966418091 3:179709738-179709760 GATCTGGACTGATACCCAGCTGG + Intronic
968016396 3:195338028-195338050 GAGATAGCCTGATACCCATCTGG - Intronic
968089240 3:195889890-195889912 GGGATGGCTTGGTCCCCAGCCGG - Intronic
968601734 4:1512951-1512973 GAGCTGTCCTGGGGCCCTGCTGG - Intergenic
968632400 4:1658797-1658819 GAGCTTGCCGGGCACCCGGCAGG - Intronic
968944916 4:3658597-3658619 GAGCTGGCCGGGGTGCCAGCGGG - Intergenic
970852540 4:20618201-20618223 GAGCTCGCCTGGCCTCCAGCTGG + Intronic
972696888 4:41455465-41455487 CAGCTGACCTTGCACCCAGCAGG - Intronic
974760279 4:66266010-66266032 GAGTGGGCACGGTACCCAGCCGG + Intergenic
976127401 4:81848719-81848741 CAGATGGCCTGGAACCCAGGGGG - Intronic
979142848 4:117200765-117200787 GAGCTGGCCTTGGAGCCAGTTGG + Intergenic
979539400 4:121863939-121863961 TGTGTGGCCTGGTACCCAGCAGG - Intronic
982931538 4:161413954-161413976 TAGCTAGCATGGTACCCAGTAGG - Intronic
984695037 4:182770603-182770625 GACCTGGCCAGGTCCCCACCTGG + Intronic
984807682 4:183766550-183766572 GAGCTGGCCCAATAACCAGCTGG + Intergenic
985627235 5:995392-995414 GAGCTGGCTTGGTGTCCGGCTGG - Intergenic
987999353 5:25330118-25330140 GAGCTGGCCTGGGGCAGAGCCGG + Intergenic
988852318 5:35192005-35192027 GAGAGGGCCTGGAACCCAACTGG - Intronic
992071414 5:73152557-73152579 ATGCTGCCCTGGGACCCAGCTGG - Intergenic
994051754 5:95369925-95369947 AAGCTGTCCTAGTAACCAGCTGG + Intergenic
995566376 5:113435773-113435795 GAGCTGGGCAGGTCCCCAGGAGG - Intronic
995709607 5:115021556-115021578 TATCTGGCCTGGTTCCTAGCAGG + Intergenic
997255931 5:132427962-132427984 TGGCTGGCCTGGCACCCAGCAGG - Intronic
997374216 5:133385164-133385186 GACTAGGCCTGGTACACAGCAGG + Intronic
997633221 5:135385621-135385643 GGGCTGGCCTGGCACCCAGCAGG + Intronic
999205743 5:149846714-149846736 CGCCTGGCCTGGCACCCAGCCGG - Intronic
1001295564 5:170496393-170496415 GAGCTGGCCTTGAACTCAGCTGG - Intronic
1002692514 5:181059898-181059920 GCGCTGGCCTGGGATCCAGGGGG - Exonic
1002777765 6:343146-343168 AAGGTGGCTTGGTACACAGCAGG - Intronic
1003824382 6:9936821-9936843 GAGCTGGCCTTGTTTACAGCCGG - Intronic
1005303868 6:24495378-24495400 GAGCTGGCCGGGGACACGGCGGG + Intronic
1007104376 6:39273488-39273510 GGCCTGTGCTGGTACCCAGCAGG + Intergenic
1007313006 6:40961623-40961645 GAGCTGGTCTGGGACCTTGCAGG - Intergenic
1007871520 6:45044718-45044740 CACCTGGCCTGAAACCCAGCAGG - Intronic
1008420538 6:51294148-51294170 GGGCTGGCATGGTATTCAGCAGG - Intergenic
1008420543 6:51294176-51294198 GGGCTGGCATGGTATTCAGCAGG - Intergenic
1017006031 6:150028606-150028628 CAGCTGGTCTGGGCCCCAGCAGG + Intergenic
1017781702 6:157720513-157720535 GCAATGGCCTGGGACCCAGCTGG + Intronic
1021188881 7:17597439-17597461 GTGGTGACCTGGAACCCAGCGGG + Intergenic
1026489572 7:70851102-70851124 GAGCTGACCAGGCACCCTGCAGG - Intergenic
1026669818 7:72380190-72380212 GGGCTTGACTGGTATCCAGCTGG - Intronic
1026896578 7:74013170-74013192 GACCTGGCCTGGTCCCCGTCTGG - Intergenic
1027624313 7:80528436-80528458 GAGCTGGCCTGGCACTGGGCAGG - Intronic
1032097187 7:128945483-128945505 GACATGGCCTGGCACACAGCTGG + Intronic
1032400593 7:131621775-131621797 GAGCTGGGCTGGCATCCAGTAGG + Intergenic
1033602280 7:142896921-142896943 GGTCTGGCCTGGGACCCAGAGGG + Intergenic
1034104569 7:148479328-148479350 GAGCCGGCCTGGCACACAGCTGG + Intergenic
1034240690 7:149608638-149608660 GTGCTGGAGTGGTACCCAGAGGG - Intergenic
1034998156 7:155591422-155591444 GAACTGGCCTGGTGCTCAGGTGG + Intergenic
1037601898 8:20403810-20403832 AAGCTGTCCTGGAGCCCAGCAGG + Intergenic
1040478480 8:47802320-47802342 GAGCTGGTCTGGGAACCAGCTGG + Intronic
1047799733 8:128296425-128296447 GCTCTGGCCTGGTGCCCAGTGGG - Intergenic
1049346811 8:142143609-142143631 GTGCTGGCGTGGAAGCCAGCAGG + Intergenic
1052379771 9:27757523-27757545 TAGCATGCCTGGTACCCAGTGGG - Intergenic
1058766430 9:108186894-108186916 GAGTAGGACTGGTACCCAGGAGG - Intergenic
1059393684 9:114017300-114017322 AAGCAGGCCTGGGACTCAGCTGG - Intronic
1059428041 9:114233341-114233363 GGGTTGGCATGGCACCCAGCTGG - Intronic
1060274733 9:122173803-122173825 GAGCTGGACTGCTTCCTAGCTGG + Intronic
1061376029 9:130225354-130225376 GTGCTGGCCTCAGACCCAGCTGG + Intronic
1061933731 9:133846322-133846344 GAGCGGGGCTGGTAGCCAACAGG - Intronic
1062119772 9:134827977-134827999 GAGCTGGCCTTGTGCCAAGAAGG - Intronic
1062158091 9:135065307-135065329 GGGCTGGCATGGTGCCCAGCAGG - Intergenic
1062324395 9:136005233-136005255 GAGGGGGCCTGGGACCCACCTGG + Intergenic
1062433570 9:136536257-136536279 TGGCTGGCCTGGTGCCCTGCAGG + Intronic
1186750828 X:12619803-12619825 GAACTGGCCTATTTCCCAGCAGG - Intronic
1189794718 X:44635022-44635044 GAGCTGGGTTGGTACCCACAGGG - Intergenic
1195770376 X:108344913-108344935 CATCTGGCCTGTTACCCAGATGG + Intronic
1198466222 X:136907074-136907096 GGACTGGCTTGGTGCCCAGCAGG + Intergenic
1199670790 X:150146635-150146657 GAGCTGGCCTGGAGCCCAACTGG - Intergenic
1200259113 X:154602543-154602565 GAGCTGGACAGGTCCCCAGAGGG - Intergenic
1200818140 Y:7554956-7554978 GAGTGAGCCTGCTACCCAGCCGG + Intergenic
1202379165 Y:24261102-24261124 GAGCTGTCCTGGTGCCCAGCAGG + Intergenic
1202491617 Y:25409019-25409041 GAGCTGTCCTGGTGCCCAGCAGG - Intergenic