ID: 1106731082

View in Genome Browser
Species Human (GRCh38)
Location 13:32542012-32542034
Sequence CAGAATGTGCTACTTTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106731076_1106731082 27 Left 1106731076 13:32541962-32541984 CCTTGGCTTCTCAAAGTGCTGGG 0: 236
1: 8114
2: 98512
3: 218071
4: 233980
Right 1106731082 13:32542012-32542034 CAGAATGTGCTACTTTTTGTAGG 0: 1
1: 0
2: 2
3: 19
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106731082 Original CRISPR CAGAATGTGCTACTTTTTGT AGG Intergenic
904351807 1:29913123-29913145 CAGTATGTTATCCTTTTTGTAGG - Intergenic
905140064 1:35836280-35836302 CAGGATGTACTATTTTGTGTTGG + Intronic
905707522 1:40072515-40072537 CAAAATATGCAACTTTTTTTTGG + Exonic
907030820 1:51169595-51169617 CAGAACTTTCTACTTTTTTTCGG + Intergenic
908996048 1:70156001-70156023 CATATTGTGCTACATTTTCTGGG + Intronic
910670267 1:89765118-89765140 CAAAAAGTACTCCTTTTTGTTGG - Intronic
914341384 1:146763305-146763327 CAGAATTCTCAACTTTTTGTAGG - Intergenic
914744647 1:150492860-150492882 CGGAAGGTGATACTTTCTGTCGG + Intronic
914869663 1:151462260-151462282 GAGAATTTGCTATTTTATGTGGG + Intergenic
916905986 1:169283824-169283846 CTGAATGGGCTTCTCTTTGTGGG + Intronic
917762679 1:178180510-178180532 CATACTAGGCTACTTTTTGTGGG - Intronic
920803333 1:209209574-209209596 CGGAATGTTCTATTTTTTGTTGG - Intergenic
921507509 1:215990451-215990473 CACAATGTTCTACTTTTTATTGG - Intronic
921831702 1:219734412-219734434 CAGAATGTCCTACTTTGGCTTGG - Intronic
923086161 1:230705011-230705033 CAGAATGTCCTTCCTTTTGAAGG - Intronic
923872269 1:238008603-238008625 CAGAAGGTGATACTCTTGGTGGG + Intergenic
1063956198 10:11269958-11269980 TAGAATGTGCTTCTGTTTTTTGG + Intronic
1064502991 10:15994849-15994871 CAGAATTTCCTTCTTTTTGAAGG + Intergenic
1065245877 10:23757045-23757067 CAGAATTTTCTACTTTTTTAAGG + Intronic
1067430170 10:46237492-46237514 CTGCCTGTGCTAGTTTTTGTGGG + Intergenic
1068877622 10:62013752-62013774 CAGAATTTGCTTCTTTTTTAAGG + Intronic
1069705044 10:70453736-70453758 CATAACATACTACTTTTTGTTGG - Intergenic
1071022866 10:81079942-81079964 ATGAATGTCCTATTTTTTGTTGG + Intergenic
1073822149 10:107275962-107275984 CATAATGAGCAGCTTTTTGTTGG + Intergenic
1074426175 10:113353494-113353516 CAAAATGTGCCCCTTTTTGAGGG - Intergenic
1081009667 11:37794186-37794208 CAGAATTTTCTTATTTTTGTGGG - Intergenic
1082254262 11:50015066-50015088 CAGAATGTTCTAGTCATTGTGGG - Intergenic
1083365054 11:62137482-62137504 CAGAATAAGCTGCTTTGTGTTGG + Intronic
1084823569 11:71712018-71712040 CAGATTGTGTTGCTTTTCGTGGG - Intergenic
1087643310 11:100778906-100778928 AAGACTGGGCTATTTTTTGTTGG - Intronic
1090816431 11:130301017-130301039 CAGAATGTTTTGATTTTTGTTGG + Intronic
1091261296 11:134236627-134236649 CAGAATGTCCTTCCTTTTGAAGG - Intronic
1092419529 12:8318876-8318898 CAGATTGTGTTGCTTTTCGTGGG + Intergenic
1095477225 12:42597835-42597857 CAGGAGCTGCTACTTTTTATAGG - Intergenic
1095542135 12:43322834-43322856 GAGAATGTGTTTCTTTTTGCCGG + Intergenic
1096451811 12:51749185-51749207 CACATTGTCTTACTTTTTGTAGG + Intronic
1097065006 12:56314811-56314833 CAGAGTGAGCTACTTTGTTTGGG + Intronic
1097462858 12:59884704-59884726 CAGAATCTGCTTCTTTTTTAAGG + Intergenic
1100071344 12:90723073-90723095 CAGAATCTGCTTCTTTTTAAAGG - Intergenic
1101111328 12:101489419-101489441 CAGAATGTCCTTCTTTTTAAAGG - Intergenic
1101203194 12:102458399-102458421 CAGAACATGATCCTTTTTGTTGG - Intronic
1101643926 12:106610637-106610659 CAGAATTTTCTTCTTTTTGAAGG + Intronic
1103140732 12:118545759-118545781 CTGAATGTGCCAGTTTTAGTAGG + Intergenic
1103734130 12:123048196-123048218 CAGAATGTCCTTCTTTTTTGAGG - Intronic
1104436522 12:128761335-128761357 CTGAATGTGCTTCTCCTTGTTGG - Intergenic
1106278689 13:28242051-28242073 TAGTATGTGTTACTTTTTCTAGG - Intronic
1106731082 13:32542012-32542034 CAGAATGTGCTACTTTTTGTAGG + Intergenic
1107477098 13:40747916-40747938 CATAAAGTGTTACTTTTTATAGG - Intronic
1109102244 13:58199859-58199881 CAGCAAGTGTTACTTTTTCTTGG - Intergenic
1109115750 13:58381374-58381396 CAAAATATGCTACTTATTCTCGG + Intergenic
1109278222 13:60325492-60325514 CAGAAGGAGCTAATTATTGTGGG + Intergenic
1110528339 13:76566461-76566483 CAGAATTTCCTTCTTTTTGAAGG - Intergenic
1110773106 13:79374170-79374192 CAGAATGTACCACTTTATGCTGG + Intronic
1110974044 13:81807257-81807279 CAGAATTTCCTACTTTTTAAAGG - Intergenic
1111282385 13:86043725-86043747 CAGAATGTTCTGCTTTTTAATGG - Intergenic
1111415114 13:87930195-87930217 CAGAATTTTCTTCTTTTTGAAGG - Intergenic
1111617827 13:90683586-90683608 TAGAATGTGTTATTTTTGGTGGG - Intergenic
1111735461 13:92133350-92133372 CAGAATGAGCTCCTTTTGGAAGG + Intronic
1113297990 13:108983428-108983450 GAGAATGTGCAACTCTTTTTTGG - Intronic
1114400945 14:22409968-22409990 CACAATCAGCTTCTTTTTGTGGG + Intergenic
1116194269 14:41702429-41702451 CTGAATGTGATTCTTCTTGTTGG + Intronic
1118711651 14:68524454-68524476 CACAATGTGCTTCTATTTCTTGG - Intronic
1121824380 14:96998748-96998770 CAGCATGTGCTGCTGTTTGCTGG + Intergenic
1123180807 14:106468399-106468421 CAGAAAGTGCTACCATTTATGGG - Intergenic
1123190901 14:106568878-106568900 CAGAAGATGCTTATTTTTGTAGG + Intergenic
1202946089 14_KI270726v1_random:28259-28281 CAGAAAGTGCTACCATTTATGGG + Intergenic
1123674898 15:22701054-22701076 CAGAATGAGCTCCTTTTGGAAGG + Intergenic
1124326912 15:28774034-28774056 CAGAATGAGCTCCTTTTGGAAGG + Intergenic
1124528912 15:30485950-30485972 CAGAATGAGCTCCTTTTGGAAGG + Intergenic
1124769745 15:32521736-32521758 CAGAATGAGCTCCTTTTGGAAGG - Intergenic
1127214172 15:56806964-56806986 CAAAATGTGCTTCTTTTTTAAGG - Intronic
1128433428 15:67622192-67622214 GAGAATGTGCTGTTTTATGTAGG + Intronic
1130778638 15:87010964-87010986 CAGACTCTGCTACATTTTCTAGG - Intronic
1130930822 15:88426320-88426342 AAGCATATGCTACATTTTGTAGG - Intergenic
1131748461 15:95477630-95477652 CAGCATGTGCTAGATTCTGTTGG - Intergenic
1133670388 16:8013010-8013032 CTGAATGTGCTACTGTTTGTGGG - Intergenic
1133965470 16:10528139-10528161 AAGAATGTTCTACTTTATGCCGG + Intergenic
1134798979 16:17067167-17067189 CTGAAGGTGCTTCTTTTTCTTGG - Intergenic
1139010783 16:62631281-62631303 CAGAGAGTGTTACTTTTTTTTGG + Intergenic
1139992898 16:70954137-70954159 CAGAATTCTCAACTTTTTGTAGG + Intronic
1141237729 16:82234683-82234705 GAGTATATGCTAATTTTTGTGGG - Intergenic
1143559571 17:7685421-7685443 CATTATGTGCTCATTTTTGTCGG - Intronic
1144194930 17:12882793-12882815 CATAATGTGCTAATTTTTTTAGG + Intronic
1146605392 17:34253286-34253308 GAGACTGTGCAACTTTGTGTAGG - Intergenic
1147868233 17:43568209-43568231 AAGAAAGTGCTAGTTTTGGTTGG + Intronic
1148021450 17:44556648-44556670 CATAATGGGCTCCTTTGTGTTGG + Intergenic
1148318752 17:46730259-46730281 TAGAATGTGAGACTTTTTCTAGG + Intronic
1149561159 17:57608867-57608889 CAAAATGTCCTGCTTTTTGTGGG + Intronic
1150425104 17:65070960-65070982 CAGTATATGCAACTTTGTGTTGG - Intergenic
1153337963 18:3944031-3944053 CAGTATGTGGTACTTTTTAATGG + Intronic
1155753647 18:29461945-29461967 TTGAATTTGCTCCTTTTTGTGGG - Intergenic
1155813020 18:30262040-30262062 CATAATGTACAACATTTTGTTGG - Intergenic
1155935784 18:31752219-31752241 CAGAATTTGCTTCTTTTTTGAGG - Intergenic
1156928470 18:42612038-42612060 TAGACTGTGTTACTTTTTGTTGG + Intergenic
1157693956 18:49705898-49705920 CAGAATTTCCTTCTTTTTGAAGG + Intergenic
1158931769 18:62330103-62330125 CAGAGTGTGCTACAGGTTGTGGG - Intronic
1159237044 18:65689410-65689432 CAGAATGTCCTTCTTTTTGAAGG + Intergenic
1159533536 18:69685990-69686012 CAGAATGTGATAGTACTTGTAGG + Intronic
1159620454 18:70631646-70631668 CAAAATGTTCTCCTTTTTGATGG + Intronic
1163293531 19:16396770-16396792 CAGAATTTGCTTCCTTTTGAAGG - Intronic
1168137875 19:54363615-54363637 CAGAATGTCCTTCCTTTTTTAGG - Intronic
1168160147 19:54505013-54505035 CAGAATGTCCTTCCTTTTTTAGG + Intronic
1168555793 19:57338817-57338839 CAGACTGTCATACTTTTGGTTGG + Intergenic
926556143 2:14360361-14360383 CAGAATGAGCTAGGTTTTATGGG - Intergenic
927388162 2:22560582-22560604 CAGAATATACTACTGGTTGTCGG - Intergenic
928842337 2:35625210-35625232 CTGAATGTACAACTTTCTGTAGG - Intergenic
930944407 2:57055361-57055383 CAGAATGTTGTTCTTTTTGATGG + Intergenic
931400011 2:61923142-61923164 CAGAAACTGCTACTTTTTATGGG + Intronic
932275134 2:70445813-70445835 AAGAAGGTTCTACTCTTTGTAGG - Intergenic
933481935 2:82869084-82869106 CAGATTGTGCTACTTTATTAAGG - Intergenic
935188776 2:100758832-100758854 CAGAATTTGCTTCTTTTTTAAGG - Intergenic
935677918 2:105611603-105611625 CAGATTGTCCTATATTTTGTTGG - Intergenic
936889202 2:117349527-117349549 CAGGAGGTGCAATTTTTTGTGGG + Intergenic
940742547 2:157526168-157526190 CAAAATGTGCTACTTTTGAAAGG + Intergenic
941322227 2:164070262-164070284 CAGCATGTTTTAGTTTTTGTTGG + Intergenic
945517779 2:210784231-210784253 ATGAATGTGGTACTTTTAGTAGG + Intergenic
946499902 2:220236460-220236482 CAGTATGTGGTACTTTGTTTTGG - Intergenic
948776671 2:240292684-240292706 CAGAGAGTGCTATTTTGTGTTGG + Intergenic
1169439374 20:5621343-5621365 CAGAATGAGCTGCTGTTTGCAGG + Intergenic
1169626497 20:7577022-7577044 CAGAATTTCCTACTTTTTAAAGG - Intergenic
1169684696 20:8258166-8258188 AAGAATGTGCCACTTTTCTTAGG - Intronic
1171937609 20:31290145-31290167 AAGAATGTGATGCTTTTGGTTGG - Intergenic
1172181236 20:33004829-33004851 AATAAAGTTCTACTTTTTGTTGG + Intergenic
1174752695 20:53127562-53127584 AAGAATGGGCTACTTTGGGTAGG + Intronic
1174943039 20:54953097-54953119 CAGAATCTGCTTCTTTTTTAAGG - Intergenic
1176410903 21:6448936-6448958 CAGAATGTTCTAGCTCTTGTTGG + Intergenic
1177194959 21:17894432-17894454 CAGTATGTGCATCTTATTGTGGG + Intergenic
1178009480 21:28266746-28266768 CTCATTGTGCTAATTTTTGTGGG + Intergenic
1179686396 21:43057258-43057280 CAGAATGTTCTAGCTCTTGTTGG + Intronic
1181862796 22:25832438-25832460 CAGAATGTCCTTCCTTTTGAAGG - Intronic
1183339045 22:37268118-37268140 CACAATGTGCAACTTTTTTAAGG + Intergenic
1184969631 22:48006580-48006602 CAGACTTTTCTCCTTTTTGTTGG + Intergenic
1184997663 22:48221952-48221974 CAACATTTGCTACTTTTTATAGG - Intergenic
949188465 3:1221657-1221679 CAGAATTTGCTTCATATTGTGGG + Intronic
952101374 3:30017172-30017194 CAGAATGTGCTCCCTCTTGCAGG - Intergenic
952310042 3:32180395-32180417 AAGGATGTGCTAGTTTTTCTTGG + Intergenic
953393279 3:42546324-42546346 CAGACTGTGCTACTTTGTTAGGG - Intergenic
953920922 3:46950668-46950690 CTGAAAGTGCTACATTTTTTTGG + Intronic
954094103 3:48309498-48309520 CAGAAGGTGTTATTTTTGGTTGG + Intronic
955621389 3:60868113-60868135 CAGAATGAGCTACTGCCTGTGGG + Intronic
956926855 3:73998787-73998809 CAGGATGTGCTAGTTTATGCTGG + Intergenic
957005437 3:74940376-74940398 CATAATGTCCTATTTTTTGTTGG - Intergenic
958179006 3:90033395-90033417 CAGACAGCTCTACTTTTTGTTGG - Intergenic
958941482 3:100320181-100320203 CAGAATGTGGAACATTCTGTAGG - Intronic
961631745 3:128305484-128305506 CTGAATTTGATACTTTTTGGGGG + Intronic
961897220 3:130178071-130178093 CAGATTGTGTTGCTTTTCGTGGG + Intergenic
962751336 3:138436436-138436458 CAGAATGTGATTCTATTTGCAGG - Intronic
963587631 3:147213125-147213147 CAGAGTCAGCTACATTTTGTAGG + Intergenic
963986719 3:151604259-151604281 CAGAATGTGCTGATGTTTATTGG + Intergenic
965647586 3:170900072-170900094 CAGAATGTGGTATTTTTGGCTGG + Intronic
965733388 3:171795879-171795901 AACACTGTGCTACTTTTTATGGG + Intronic
965981076 3:174691486-174691508 CAGCAAGTCCTAATTTTTGTTGG + Intronic
966184619 3:177216618-177216640 CATACTGGGCTAATTTTTGTGGG - Intergenic
966491869 3:180536793-180536815 CAGAATCTCCTACTTTTTAATGG - Intergenic
966556117 3:181261981-181262003 CAGAATCTCCTTCTTTTTGAAGG + Intergenic
966894669 3:184434880-184434902 CAGAATGTCCTTCTTTTTAAAGG + Intronic
967898092 3:194417022-194417044 CAGAACGAGATACTGTTTGTGGG + Intronic
968145646 3:196296455-196296477 CAGAGTTTGCTCCTTTTTCTGGG - Intronic
969746221 4:9074428-9074450 CAGATTGTGTTGCTTTTCGTGGG - Intergenic
969805578 4:9605842-9605864 CAGATTGTGTTGCTTTTCGTGGG - Intergenic
969954610 4:10875736-10875758 CAGAGTGTGAGAATTTTTGTGGG + Intergenic
970462631 4:16290560-16290582 CAGAATGAGATTCTTTTTCTTGG - Intergenic
971612901 4:28748364-28748386 CTCAATGTACTACTTTATGTCGG + Intergenic
972100982 4:35416680-35416702 AAAAATGTGGTACTTTTTTTTGG + Intergenic
972259940 4:37397591-37397613 CAGAACGAGCTACTTTATGGGGG - Intronic
972708380 4:41568491-41568513 CATAATGTTCTACTTATTTTTGG + Intronic
974144165 4:57925535-57925557 CAGAATGTGCTTCAGTTTCTAGG - Intergenic
974636435 4:64569272-64569294 CACAATGAGCTACTTCTCGTAGG - Intergenic
975003933 4:69263712-69263734 CAGAATGTTAAAGTTTTTGTAGG - Intergenic
977156159 4:93576422-93576444 CACAAAATGCTACTTTTTGGGGG + Intronic
978405243 4:108372183-108372205 CAGGATGAGCTTCCTTTTGTGGG - Intergenic
978430216 4:108625769-108625791 CATAATGTCCTTCTCTTTGTGGG + Intronic
978731728 4:112035650-112035672 CAGAATTTGCTTCTTTTTAATGG - Intergenic
978976064 4:114875112-114875134 CAGTATGTGCTAATTTCAGTAGG + Intronic
979233992 4:118378522-118378544 CATGATGTGCTATTTTTTATAGG - Intergenic
979585094 4:122405904-122405926 CAGAATTTTCTTCTTTTTGGGGG + Intronic
979989546 4:127358767-127358789 CAGAACTTGCTCCATTTTGTCGG + Intergenic
981490103 4:145330485-145330507 CAGAATCTTCTTCTTTTTGAAGG - Intergenic
981758532 4:148168182-148168204 CAGCATGGGCTCCTTTTTGTGGG + Intronic
983462385 4:168043791-168043813 CAATGTATGCTACTTTTTGTTGG - Intergenic
986163809 5:5254971-5254993 CTGAATCTGCTGCTTTTTGAAGG + Intronic
986898790 5:12405942-12405964 CCTGTTGTGCTACTTTTTGTAGG + Intergenic
989262709 5:39436335-39436357 CAGAATGTGGTACTTTTTATGGG + Intronic
990020529 5:51121086-51121108 CAAAATATTCTACTTTTTTTTGG - Intergenic
991647895 5:68819445-68819467 CAGAATTTGCTGCTTTTGGGAGG - Intergenic
992084358 5:73264710-73264732 CAGAATGTGCTTCCTTTTAATGG - Intergenic
992714272 5:79494209-79494231 CAGAATGTGTAATTTTTGGTTGG - Intronic
995177028 5:109190208-109190230 CAGAATGTGCAAGTTGATGTAGG + Exonic
995451599 5:112308280-112308302 CATAATGTGAGACTTGTTGTGGG - Intronic
995680375 5:114711559-114711581 CAAAATCTACTACTTTTTCTAGG - Intergenic
997401008 5:133602310-133602332 CAGCATCTGCTCCTTCTTGTTGG + Intronic
999037906 5:148374120-148374142 AAAAATGTGCTATTTTTTGTGGG + Intergenic
999037910 5:148374193-148374215 AAAAATGTGCTATTTTTTGTGGG + Intergenic
999902254 5:156097015-156097037 AAAAATGTGCTACTTTCTTTTGG + Intronic
999917527 5:156279599-156279621 CAGAATGTGTTCCTCTTTTTTGG + Intronic
1001438940 5:171723491-171723513 CAGAATTTGATTCTTTTTTTAGG + Intergenic
1002188188 5:177465245-177465267 CAGAATTTCCTTCTTTTTGAAGG - Intronic
1002355162 5:178621949-178621971 CAGAATATTCTAATTTTTGAAGG - Intronic
1003410825 6:5861466-5861488 CAGAATGTCCTTCTTTTTAAAGG - Intergenic
1003554580 6:7128390-7128412 CTGAAAGTGCTGCTTTTAGTGGG + Intronic
1004808750 6:19235071-19235093 CAGTCTGTGCTACTTTTTTGTGG - Intergenic
1005277240 6:24232325-24232347 GAGAATGTCCTTCTGTTTGTAGG - Intronic
1005738191 6:28768392-28768414 CAGATTGTGTTACTCTTTGTAGG + Intergenic
1005769719 6:29055413-29055435 CAGAATTTCCTTCTTTTTGATGG + Intergenic
1006779480 6:36622634-36622656 CTGAATGTGTTACTTTATGTTGG - Intergenic
1008047509 6:46866320-46866342 CTGAATGTGCCACTTTTTGAAGG + Intronic
1008300314 6:49830157-49830179 AAGAATGTGCTACCTTTGTTTGG + Intergenic
1009927546 6:70138318-70138340 CAAAATGTAGTTCTTTTTGTGGG + Intronic
1010984128 6:82402760-82402782 CAGAATGTTCACATTTTTGTGGG - Intergenic
1011173813 6:84537668-84537690 AAGAATGTACCTCTTTTTGTCGG - Intergenic
1012503577 6:99918286-99918308 CAGAAATTACTGCTTTTTGTGGG - Intergenic
1014327078 6:120011498-120011520 TATATTGTGCTACTTTTTCTTGG + Intergenic
1016524082 6:144980353-144980375 CAGAATTTGCTTCTTTTTTAAGG + Intergenic
1016854239 6:148650433-148650455 CAGAATTTCCTTCTTTTTGAAGG - Intergenic
1016947724 6:149549813-149549835 CAGAATGGGCCACTTCTTGAGGG - Intergenic
1017406497 6:154125441-154125463 AAGAATGTAATACTTTTAGTTGG - Intronic
1017833853 6:158158284-158158306 CAGTGTGTGCCACTTTTTGGTGG + Exonic
1020516762 7:9131324-9131346 CAGAATTTCCTACTTTTTAATGG + Intergenic
1020917516 7:14214738-14214760 GAAATTGTGCTACATTTTGTGGG - Intronic
1021495121 7:21266042-21266064 CAGGATGTCCCACTATTTGTAGG - Intergenic
1021751708 7:23807363-23807385 AAGATTGTGCTACTTTCTTTAGG + Intronic
1022040980 7:26580951-26580973 CAGAAATTGGCACTTTTTGTGGG + Intergenic
1022445400 7:30466303-30466325 CAGAATGTGTTGCTTTGGGTAGG + Intronic
1024672960 7:51613255-51613277 CAGAATATGCTATTTTTCTTTGG + Intergenic
1027409544 7:77900582-77900604 CATAATGTGTTACATTTTGTTGG + Intronic
1028205975 7:88017948-88017970 AAGAATGTGGTACTTTGTGAAGG - Intronic
1028278666 7:88893002-88893024 CAGAGTGTGTTGCCTTTTGTGGG + Intronic
1029989391 7:104949245-104949267 CTGAATGTGCCTCATTTTGTAGG + Intergenic
1030044486 7:105482733-105482755 TGGAATTTTCTACTTTTTGTGGG + Intronic
1030232103 7:107219501-107219523 CAGGATTTGCTTCTTTTTGAAGG - Intronic
1032503896 7:132421266-132421288 CAGAATGTCCTTCTTTTTAAAGG + Intronic
1032855891 7:135833176-135833198 CAGAACATCCTACTCTTTGTTGG + Intergenic
1033328727 7:140400367-140400389 CAGAATTTGCTACCTTTTTTAGG - Intronic
1033571607 7:142634550-142634572 CTGTTTGTGCTACTTTTTGTTGG - Intergenic
1034196633 7:149253518-149253540 TAGAATGTGATCTTTTTTGTTGG + Intronic
1035813987 8:2518667-2518689 CAGAAGGTGCTACCTTTTGATGG - Intergenic
1036368723 8:8144346-8144368 CAGATTGTGTTGCTTTTCGTGGG - Intergenic
1036431986 8:8700278-8700300 CAGAATGTCCTTCCTTTTGAAGG - Intergenic
1036882165 8:12521296-12521318 CAGATTGTGTTGCTTTTCGTGGG + Intergenic
1038521977 8:28241757-28241779 CAGTATGTGGTACTTTGTGATGG + Intergenic
1039784635 8:40822906-40822928 GAGAATGTGTTAGTGTTTGTTGG - Intronic
1040578227 8:48673287-48673309 CATTATTTGCAACTTTTTGTTGG + Intergenic
1041406168 8:57501699-57501721 CAGATTGTGATGCTTTTCGTAGG + Intergenic
1041732844 8:61079640-61079662 CAGACTGTGATGCTTTTTGAGGG + Intronic
1042231543 8:66560130-66560152 CAGAATGTGCTAGGTTTGATTGG - Intergenic
1043550572 8:81367666-81367688 CAGAATTTTCTACTTTTTTAAGG - Intergenic
1044591979 8:93922208-93922230 CAGCATATGCTACCTTTTGCAGG + Exonic
1045633654 8:104157635-104157657 CAGAATTTGCTTCTTTTTTAAGG + Intronic
1046482386 8:114839242-114839264 TGGAATGTGCTACTTTATTTAGG - Intergenic
1046811799 8:118541071-118541093 CAGCATGTGGTAGTTTTTCTTGG - Intronic
1050841344 9:10152831-10152853 CAGAATTTCCTTCTTTTTGGGGG - Intronic
1051309375 9:15753187-15753209 CAGAAGGTGCTGCTCATTGTGGG + Intronic
1051485044 9:17598990-17599012 CACAATGTACTACTTATTGCTGG - Intronic
1052688936 9:31790595-31790617 CAGAATCTCCTATATTTTGTAGG + Intergenic
1052884135 9:33626787-33626809 CTCTTTGTGCTACTTTTTGTTGG - Intergenic
1053096168 9:35329807-35329829 CAGACTGTTCTACTTTGTTTTGG + Intronic
1055987840 9:82070280-82070302 CAGAATTTCCTTCTTTTTGAAGG + Intergenic
1056506386 9:87262106-87262128 CAGTATTTCCTTCTTTTTGTGGG + Intergenic
1056710613 9:88989973-88989995 CTGAATGTGCTTCCCTTTGTTGG - Intergenic
1057729820 9:97598618-97598640 CAGAATGTCCAACTTCTTGGGGG - Intronic
1058188155 9:101880278-101880300 TAGCATGTGCTTTTTTTTGTTGG + Intergenic
1186600650 X:11033730-11033752 GAGAATGTGGTACATATTGTGGG + Intergenic
1189085869 X:38023210-38023232 GAGAATGTGCTGGCTTTTGTGGG - Intronic
1189535660 X:41932948-41932970 CAGAATGTCCTTCTTTTTTAAGG - Intergenic
1189888216 X:45571592-45571614 GAGAATGTTCTACAATTTGTTGG - Intergenic
1190068205 X:47257753-47257775 CAGAATGTGCAACTTTTAAAAGG - Intergenic
1190856961 X:54305563-54305585 CAGAATGTGGGACATTCTGTAGG - Intronic
1192151110 X:68712964-68712986 CAGTATGTGCAGCTTTTTGAAGG + Exonic
1192232692 X:69276963-69276985 CAGAATGAAGAACTTTTTGTAGG + Intergenic
1192421153 X:71032339-71032361 CAGATTATGCTTCTTTTTGTAGG - Intergenic
1193254278 X:79328006-79328028 CAGAATTTGCTTCTTTTTTAAGG + Intergenic
1194062050 X:89215635-89215657 CAGATTGTGCTAATTTTTCAGGG - Intergenic
1195528116 X:105917875-105917897 CTGAATTTTCTTCTTTTTGTTGG + Intronic
1197620873 X:128746496-128746518 AAGAAAGTGTTACTTTCTGTTGG + Intergenic
1198596458 X:138241243-138241265 CAGAATGTGCTCATTTTGATTGG - Intergenic
1198913921 X:141645120-141645142 CATAATGTTTTATTTTTTGTGGG + Intronic
1198925983 X:141796160-141796182 CAGAAAGTGCTATATTATGTAGG + Intergenic
1199440612 X:147863926-147863948 CAGTATGTGCTACTTTGTTATGG + Intergenic
1199663901 X:150081533-150081555 CAGACTGTGCTACTTTGTTATGG - Intergenic
1200715974 Y:6544936-6544958 CAGATTGTGCTAATTTTTCAGGG - Intergenic
1201865178 Y:18645014-18645036 CAGAATGCTCTATTTTTTTTAGG - Intergenic