ID: 1106736410

View in Genome Browser
Species Human (GRCh38)
Location 13:32592089-32592111
Sequence CAGGATAAGCAGATGGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106736410 Original CRISPR CAGGATAAGCAGATGGTACA AGG (reversed) Intronic
901158253 1:7155048-7155070 CAGGATGAGTAAAAGGTACACGG + Intronic
902713599 1:18257100-18257122 CATGATAAGCTGATGGGCCAGGG + Intronic
905907217 1:41627113-41627135 CAGGGCATGCAGATGGCACAGGG + Intronic
907727269 1:57031354-57031376 CAGTATTATCAGATGGAACATGG - Intronic
909670372 1:78181991-78182013 CAGGATAGGCAGAGGATACCTGG - Intergenic
910430966 1:87159409-87159431 CAGCCTAAACAGTTGGTACAAGG + Intronic
915102975 1:153513908-153513930 CAAGATGAACAGATGGTCCAAGG + Intergenic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
916544584 1:165791378-165791400 CAGGAAATACAGAGGGTACAGGG + Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918816022 1:189184491-189184513 CAGCAAAAGCAAATGGTAAAAGG - Intergenic
920154325 1:203936156-203936178 AAGGATAAGCAGAGGTTATAAGG - Intergenic
1063498284 10:6530092-6530114 CTGGATATGCATATGGGACAGGG + Intronic
1063638829 10:7811843-7811865 CAGGATATGCAAATAGGACATGG + Intergenic
1063778597 10:9293764-9293786 CAGGTAAAGCATATGTTACATGG + Intergenic
1066122270 10:32300864-32300886 CAGTATAACAAGATGTTACAGGG + Intronic
1067045627 10:42983671-42983693 CAGGAAGGGCAGATGGCACAGGG + Intergenic
1067336725 10:45373178-45373200 CAGTATGAGGAGATGCTACAGGG + Intergenic
1068374213 10:56156450-56156472 AAGGAAAAGCAGATCCTACAAGG - Intergenic
1069667388 10:70172009-70172031 CAGGATGAGCGGAGGGTAGAGGG - Intergenic
1070490524 10:76971627-76971649 CAGAGGAAGCAGGTGGTACAGGG - Intronic
1073305221 10:102497943-102497965 AAGGCTGAGCAGGTGGTACACGG + Intronic
1074243297 10:111661379-111661401 CAAAATAAGCAGAAAGTACAGGG + Intergenic
1076271370 10:129155193-129155215 CAGGAGAAGCAGGTGGAACAAGG + Intergenic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1080181076 11:29426775-29426797 CAAGATAAGCAGACGGTAGCAGG + Intergenic
1081634830 11:44714158-44714180 CAGAATAAGCAGATGGGAGAAGG + Intergenic
1083016353 11:59458097-59458119 CAGGAGAAGAAGAGGGTATAAGG + Intergenic
1083782038 11:64923755-64923777 CTGGATGAGCAGCTGGTCCATGG - Intronic
1083878559 11:65537327-65537349 CAGGCTAGGCAGATGGTGCCTGG + Intronic
1088910054 11:114183939-114183961 CAGGCCAAGCACCTGGTACACGG - Intronic
1089554733 11:119310131-119310153 CAGGAAAAGGTGATGGGACAGGG + Intronic
1090256904 11:125290945-125290967 CAGGAGAAGCTGATGGGAGAAGG + Intronic
1093096367 12:14976267-14976289 CAGCATGAGCAGGTGGTCCAGGG + Intronic
1094408450 12:30144473-30144495 CAGGATAAGAACATGCAACAGGG - Intergenic
1097080298 12:56425484-56425506 CAGAATAAGCAGATGCTATGAGG + Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1102776102 12:115520813-115520835 CATGATATCCATATGGTACATGG - Intergenic
1103342024 12:120225855-120225877 CAGGACAGGCAGCTGGGACAAGG - Intronic
1103806472 12:123577546-123577568 CAGGACAAACAGCTGGCACATGG - Intergenic
1104238178 12:126960169-126960191 GAGGAAAAGCAGAAGGTTCAGGG - Intergenic
1104973564 12:132542132-132542154 CAGGATGACCAGATGGCACAGGG + Intronic
1105265064 13:18808501-18808523 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1106736410 13:32592089-32592111 CAGGATAAGCAGATGGTACAAGG - Intronic
1117203080 14:53412391-53412413 CAGGATTAGGAGATTGTAAATGG + Intergenic
1119548355 14:75489911-75489933 CAAGATTATCAGCTGGTACATGG - Intergenic
1120728271 14:87971231-87971253 CAGGATCAGCAGATGGTATATGG + Intronic
1121659360 14:95623502-95623524 CAGAAAAAGCAGATGGTGCAGGG + Intergenic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1202833407 14_GL000009v2_random:59614-59636 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1202906407 14_GL000194v1_random:76084-76106 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1123552633 15:21397851-21397873 CAGAAAAAGCAGATGGCACTGGG - Intergenic
1123552741 15:21398491-21398513 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1123552956 15:21399771-21399793 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1123553269 15:21401681-21401703 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1123588879 15:21835239-21835261 CAGAAAAAGCAGATGGCACTGGG - Intergenic
1123588987 15:21835879-21835901 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1123589089 15:21836520-21836542 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1123589202 15:21837159-21837181 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1123589515 15:21839069-21839091 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1124661642 15:31554794-31554816 CAGGATCAGCTGATGGCAAAAGG + Intronic
1125610545 15:40966455-40966477 AAGGATAAGCAGGTGGTCCCTGG - Intergenic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1128536469 15:68494468-68494490 CTTGATAAGCAGATTCTACATGG - Intergenic
1130437449 15:83915229-83915251 CAGGAGAAGAAGATGAAACAGGG - Intronic
1130790203 15:87146422-87146444 CATGATAAACAGATGCTACTGGG + Intergenic
1202960982 15_KI270727v1_random:125071-125093 CAGAAAAAGCAGATGGCACTGGG - Intergenic
1202961091 15_KI270727v1_random:125711-125733 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1202961192 15_KI270727v1_random:126352-126374 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1202961305 15_KI270727v1_random:126991-127013 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1202961618 15_KI270727v1_random:128901-128923 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1134572482 16:15303208-15303230 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1134729902 16:16452832-16452854 CAGGGTAGGCAGATGGGAGAGGG + Intergenic
1134937530 16:18259064-18259086 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1135284421 16:21181123-21181145 TGGGATATGCAGATGGGACAGGG + Intergenic
1135548615 16:23381557-23381579 CAGGAGAATCACATGGTCCAAGG + Intergenic
1136178901 16:28537679-28537701 GAGGAAAAGCAGGTGGTAAAAGG + Intronic
1139962530 16:70726161-70726183 GAGGATAAGTGGATGGTTCACGG + Intronic
1146624819 17:34427203-34427225 CAGAATAAGCAGCTGGTAGATGG + Intergenic
1151192637 17:72409632-72409654 CATGAAAAGCAGCTGGCACATGG + Intergenic
1152938129 17:83152426-83152448 CAGGAGAGGGAGATGGTCCAGGG + Intergenic
1152938165 17:83152563-83152585 CAGGAGAGGGAGATGGTCCAGGG + Intergenic
1152938197 17:83152693-83152715 CAGGAGAGGGAGATGGTCCAGGG + Intergenic
1154453544 18:14501248-14501270 CAGGAAAAGCAGATGGCACTGGG - Intergenic
1154453654 18:14501888-14501910 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1154453751 18:14502529-14502551 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1154453957 18:14503798-14503820 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1155622019 18:27790155-27790177 CAGGATTAGCTGATTCTACAGGG - Intergenic
1156508705 18:37616807-37616829 CAGGAGTAGCTGCTGGTACAGGG - Intergenic
1156717482 18:40028396-40028418 CAGGATAGGCAGATTCAACATGG + Intergenic
1157558387 18:48628579-48628601 GAGGATAAGTGGATGGTACGTGG - Intronic
1158323452 18:56289054-56289076 AAGGATAAACAGATGGGTCAAGG + Intergenic
1159159423 18:64624024-64624046 CAGGATAATCAGAGGTGACAAGG - Intergenic
1159536053 18:69716547-69716569 CAGGAAAAGCAGTGTGTACACGG - Intronic
1161515456 19:4693788-4693810 GAGAAAAAGCAGATGGTGCAGGG - Intronic
1165733257 19:38159688-38159710 GAGGTTAAGCAGCTGGTCCAAGG - Intronic
1167850662 19:52198988-52199010 GAGGACAATGAGATGGTACAGGG - Intronic
1202639265 1_KI270706v1_random:68081-68103 GAGGAAAAGCAGATGGCACTGGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG + Intergenic
927220632 2:20705291-20705313 GAGGATAAGGAGATGGGATAGGG - Intronic
931517879 2:63060234-63060256 CAGTATAAGCAGAGAATACAAGG - Intergenic
933350943 2:81151523-81151545 CAGGATTAGCACAGGGTACTGGG - Intergenic
934494723 2:94787540-94787562 GAGGAAAAGCAGATGGCACTGGG - Intergenic
936587120 2:113767872-113767894 CAGGATAAGGAAATGGAACTTGG + Intergenic
937494618 2:122404677-122404699 CAGGATAAGTAGATGGAGCAAGG - Intergenic
942695407 2:178636966-178636988 CAGGAAAATGAGATGGTATAAGG + Intronic
943439393 2:187907815-187907837 AAGGATAAGAAGATAGTAGAAGG + Intergenic
944317707 2:198301030-198301052 CAGGACAAGGAGATGGTTCCTGG - Intronic
945176988 2:207053031-207053053 CAGGAAGAGCAGATGCCACAAGG + Intergenic
946630890 2:221667366-221667388 CAGGACAGGCAGAAGATACAGGG + Intergenic
947168889 2:227290843-227290865 CAGGTTATTCAGAAGGTACAAGG + Exonic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
1169388853 20:5173274-5173296 GCGGTTAAGCAGATGGTACGCGG + Intronic
1170010835 20:11721896-11721918 AAGCAAAAGCAGATGGAACAAGG + Intergenic
1170485740 20:16814338-16814360 CAGGATAATCTGATTGTCCAGGG + Intergenic
1171853189 20:30322815-30322837 CAGGATAAAAAGATGCTTCAAGG + Intergenic
1171885859 20:30652196-30652218 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1172953946 20:38742088-38742110 CAGGTTAAGTAGATGGAGCAGGG - Intergenic
1172993199 20:39050761-39050783 CAGGAGAAGCAGATGGGCCATGG + Intergenic
1173918918 20:46729349-46729371 CAGGACAAGCCGATGGTGCCTGG - Exonic
1174160195 20:48545173-48545195 CAGGATTAGCAGATGCTGGAAGG - Intergenic
1175642408 20:60642062-60642084 CAGGCTTAGCAAATGGTTCAGGG + Intergenic
1175912667 20:62412236-62412258 CAGGATAAGCCGCTGCCACAAGG - Intronic
1176625752 21:9090883-9090905 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1176647589 21:9365690-9365712 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1176820214 21:13649498-13649520 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1176820317 21:13650137-13650159 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1176820430 21:13650776-13650798 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1176820528 21:13651417-13651439 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1176820637 21:13652057-13652079 CAGGAAGAGCAGATGGCACTGGG + Intergenic
1179574520 21:42299510-42299532 CAGGACCAGGAAATGGTACATGG + Intergenic
1179642083 21:42754347-42754369 CAGGATGAGCAGATGGCTCGGGG - Intronic
1180362684 22:11913783-11913805 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1181451805 22:23027670-23027692 CAGGGTAAACAGATCTTACATGG - Intergenic
1182910621 22:33981231-33981253 CAGGAGAGGCAGATGGGGCAGGG - Intergenic
950449472 3:13057613-13057635 CAGGAGAAGCACCTGGCACAGGG + Intronic
952304866 3:32136777-32136799 AAGGCTTAGGAGATGGTACAGGG - Intronic
952408162 3:33024026-33024048 CAGGATGAGCAGATGAGACATGG - Intronic
952609246 3:35187501-35187523 AAGTATAAGCAGATCGTATATGG - Intergenic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
956223749 3:66933344-66933366 CAAGGTAAGCAGAAGGGACAAGG - Intergenic
956601039 3:71022808-71022830 AAGGATATGCAGATGGCATAGGG + Intronic
957041233 3:75337042-75337064 CAGGCCATGCTGATGGTACAAGG - Intergenic
959926525 3:111927772-111927794 CTTGATAAACAGATGGTTCAAGG - Intronic
965151792 3:164987170-164987192 GATGATAATCAGATGGCACAGGG - Exonic
967321819 3:188201944-188201966 CAGGTCAAGCAGAGGGGACAAGG + Intronic
967757837 3:193190343-193190365 AAGAACCAGCAGATGGTACAAGG - Intergenic
1202739289 3_GL000221v1_random:39297-39319 GAGGAAAAGCAGATGGCACTGGG + Intergenic
968856769 4:3130938-3130960 CAGGACAAGCAGAAGCTACTTGG - Intronic
969217418 4:5733421-5733443 CAGGAAAAGCATATGGTAGGTGG + Exonic
971181404 4:24331409-24331431 CAGGATAAGGAGATGGTGAGTGG - Intergenic
973369503 4:49234441-49234463 GAGGAAAAGCAGATGGCACTGGG - Intergenic
973391528 4:49560975-49560997 GAGGAAAAGCAGATGGCACTGGG + Intergenic
973809743 4:54558140-54558162 CTGGCTAAGCAGGTGGGACATGG - Intergenic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
975854462 4:78608535-78608557 CAGAATAAGAAGATCTTACAGGG - Intronic
977049640 4:92113133-92113155 GAGCAGAAGCAGAGGGTACACGG - Intergenic
977090609 4:92670811-92670833 GAGGATAAGTAGTTGGTCCAAGG + Intronic
979778974 4:124625406-124625428 CAGCATAAGCAGAGGTCACATGG - Intergenic
980816674 4:137956006-137956028 CATGTAAAGCAGATGTTACATGG + Intergenic
981690509 4:147503393-147503415 CAGGACAAGCAGAAGTCACAGGG + Intronic
982076928 4:151747121-151747143 CATGGTAAGCACTTGGTACATGG + Intronic
982814299 4:159866932-159866954 CAGGATAAGGAGATACAACAAGG + Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
1202766615 4_GL000008v2_random:153951-153973 GAGGAAAAGCAGATGGCACTGGG - Intergenic
986798378 5:11234445-11234467 CAGGATAATCAGGTAGTTCAAGG + Intronic
989260203 5:39411010-39411032 CAGAGTAAGCAGATGGGATAAGG + Intronic
991931406 5:71756437-71756459 CATGATGAGCAGATGGAAAAAGG - Intergenic
992429040 5:76689840-76689862 CAGTATAAGCAGATGACAGAGGG + Intronic
994521144 5:100837530-100837552 CAGAATAAACATATGGTTCAAGG - Intronic
994549525 5:101213181-101213203 CAGAAAAAGCAGGTGGTAGAAGG + Intergenic
995457708 5:112369477-112369499 TAGGATAAGTAGATGGGACCTGG - Intronic
995918705 5:117284142-117284164 CAGGAGAAGCAGATTGAACACGG - Intergenic
1002971101 6:2021035-2021057 CAGGAGAAGCAGCTGGGAGAAGG - Intronic
1004254468 6:14050330-14050352 CAGCATAACTAGATGGCACAAGG - Intergenic
1007296104 6:40822090-40822112 CAGATTAAGCAGATCTTACACGG - Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1009176138 6:60461570-60461592 CATTATAAGCAGAGAGTACAAGG + Intergenic
1011847664 6:91586557-91586579 CAAGATAAGAAGATGTTGCAAGG - Intergenic
1013736697 6:113235517-113235539 CATGTTCAGCAGATGGTATATGG + Intergenic
1014016019 6:116531063-116531085 CAGGATAATTAGATAGAACATGG - Intronic
1014330363 6:120056165-120056187 TAGGACAAGGAGCTGGTACAGGG + Intergenic
1015464805 6:133536993-133537015 AAGGATAAGAAGAAGGAACATGG - Intergenic
1016352335 6:143181852-143181874 CAGGATAAGAAGTTGGAAAAGGG + Intronic
1021605422 7:22404934-22404956 CAGGATAAATAAATGGTAAATGG + Intergenic
1021773086 7:24024757-24024779 CAGGCTGAACAGATGGAACACGG - Intergenic
1024547414 7:50534178-50534200 GAGGATAAGGAGTAGGTACAAGG - Intronic
1028338678 7:89691076-89691098 CAGGAAAAACTGATGCTACAAGG + Intergenic
1029032241 7:97480851-97480873 CAGAACAGGCTGATGGTACAAGG - Intergenic
1029930696 7:104367550-104367572 GATGTTAAGCAGATGGAACAGGG + Intronic
1041417574 8:57628877-57628899 CAGGATAAGCAGAAGGGAAGAGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043728519 8:83644625-83644647 CAGGATGATCAGATGTCACATGG + Intergenic
1044079288 8:87864095-87864117 CAGGATAGGCAGACTATACAGGG - Intergenic
1045513011 8:102829318-102829340 CATTAAAAGCAGATGGTTCATGG + Exonic
1048925410 8:139266785-139266807 CATGATAAGCAGTGGGTACTGGG - Intergenic
1049736694 8:144211391-144211413 CTGGGTAAGCAAATGGTACCTGG - Intronic
1050262986 9:3860604-3860626 CAGGAGAAGCAGATGGGCAAAGG + Intronic
1050782209 9:9351402-9351424 CAGGAAAAGCAGAAAGTACTTGG + Intronic
1052877209 9:33575908-33575930 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1053498793 9:38568486-38568508 GAGGAAAAGCAGATGGCACTGGG - Intronic
1053662396 9:40292819-40292841 GAGGAAAAGCAGATGGCACTGGG + Intronic
1053912850 9:42922984-42923006 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1054154165 9:61628658-61628680 CAGGATAAAAAGATGATTCAAGG - Intergenic
1054374527 9:64439048-64439070 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1054522214 9:66083465-66083487 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1057161846 9:92894784-92894806 AAGGAAAAGCAGATGGCACTGGG - Intergenic
1057678245 9:97152979-97153001 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058709760 9:107669053-107669075 GAGGATAAGAAGCTGGTCCACGG + Intergenic
1061621308 9:131812968-131812990 GGGGAAAAGCAGCTGGTACAGGG - Intergenic
1203526722 Un_GL000213v1:97504-97526 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1203526821 Un_GL000213v1:98145-98167 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1203526940 Un_GL000213v1:98784-98806 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1203527146 Un_GL000213v1:100053-100075 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1203748926 Un_GL000218v1:61304-61326 GAGGAAAAGCAGATGGCACTGGG + Intergenic
1203547370 Un_KI270743v1:138829-138851 GAGGAAAAGCAGATGGCACTGGG - Intergenic
1185502864 X:611876-611898 CATGATAAGCAGATAAAACAAGG - Intergenic
1185542521 X:914319-914341 CTAGATAGGCAGATAGTACAGGG + Intergenic
1188923964 X:36016269-36016291 CAGGATGAGGGGATGGTATATGG - Intergenic
1188986411 X:36772258-36772280 AAGAATTGGCAGATGGTACATGG - Intergenic
1188986504 X:36773011-36773033 GAGGATAAGCCATTGGTACATGG - Intergenic
1194280261 X:91943114-91943136 GAGGATAAACAGTTGGAACATGG + Intronic
1197889549 X:131255590-131255612 CAGGAGAAACAGGTGGTATATGG - Intergenic
1200597738 Y:5166608-5166630 GAGGATAAACAGTTGGAACATGG + Intronic
1201162284 Y:11176310-11176332 GAGGAAAAGCAGATGGCACTGGG + Intergenic