ID: 1106741594

View in Genome Browser
Species Human (GRCh38)
Location 13:32648944-32648966
Sequence GGGGCTATAATGTATCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106741591_1106741594 -5 Left 1106741591 13:32648926-32648948 CCCCTGTGGAAATCACATGGGGC 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1106741594 13:32648944-32648966 GGGGCTATAATGTATCTTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 119
1106741592_1106741594 -6 Left 1106741592 13:32648927-32648949 CCCTGTGGAAATCACATGGGGCT 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1106741594 13:32648944-32648966 GGGGCTATAATGTATCTTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 119
1106741593_1106741594 -7 Left 1106741593 13:32648928-32648950 CCTGTGGAAATCACATGGGGCTA 0: 1
1: 0
2: 1
3: 5
4: 70
Right 1106741594 13:32648944-32648966 GGGGCTATAATGTATCTTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106741594 Original CRISPR GGGGCTATAATGTATCTTGT TGG Intronic
906701475 1:47861346-47861368 GGTGCTGTCATGTATATTGTAGG - Intronic
910297687 1:85667313-85667335 GGGGCTAATATGTATCTTTATGG - Intronic
911332183 1:96537997-96538019 GGGGCTATAATTCTGCTTGTAGG - Intergenic
915796360 1:158738511-158738533 GGGGCTAGCATGTCTCTGGTTGG - Intergenic
917036996 1:170759064-170759086 AGAGCTATATTGTATGTTGTGGG + Intergenic
917076938 1:171215249-171215271 GGGACAAGAATGTATCTTGGGGG + Intergenic
917794584 1:178523755-178523777 GGGCCTAAGATGGATCTTGTTGG + Intronic
920455421 1:206097577-206097599 GTGTCTAGAATGTATCATGTAGG + Intronic
1070311905 10:75279984-75280006 GGGGTTAAAATGAATTTTGTGGG + Intergenic
1070404621 10:76083851-76083873 GGGGCTCTAGTGCATCTTGTGGG + Intronic
1071587228 10:86835749-86835771 TGAGCTTTAAAGTATCTTGTTGG + Intronic
1073950666 10:108805279-108805301 GAGCCTATAATCTATCTTCTGGG - Intergenic
1074557856 10:114508358-114508380 GGAGCTAGAATGTATCTTAAAGG - Intronic
1077628431 11:3794134-3794156 GGGGCTCTGTTGTATATTGTAGG - Intronic
1079639592 11:22788407-22788429 GGGGCTATCCTGTGTATTGTAGG + Intronic
1081624457 11:44640741-44640763 AGGGTTATAAAGTTTCTTGTTGG + Intergenic
1089224247 11:116902791-116902813 GGGGGTAAAAGGTGTCTTGTAGG - Intronic
1094068559 12:26387386-26387408 GTGACTATATTGTATCTTTTAGG - Intronic
1098502865 12:71214194-71214216 GGGCCAATAATCTATCTTCTGGG - Intronic
1100378216 12:94037428-94037450 GGTGCTATATTCTATCTTGCGGG - Intergenic
1101782525 12:107848626-107848648 GGGGCTAGCATGTCTCTGGTTGG - Intergenic
1103277454 12:119724637-119724659 GTGGCTATAAAGTGTCATGTTGG + Intronic
1106741594 13:32648944-32648966 GGGGCTATAATGTATCTTGTTGG + Intronic
1111300747 13:86347149-86347171 GAGGCTATAATGAATCAAGTAGG + Intergenic
1113244925 13:108384264-108384286 GGGGCTATCCTATATGTTGTAGG + Intergenic
1116055352 14:39857330-39857352 GGGACTATTATGTATCTGGGTGG + Intergenic
1119055827 14:71418878-71418900 AGGGCTTTATTGTATCTTTTTGG + Intronic
1120118368 14:80647711-80647733 GGGGCTATACTGCACGTTGTAGG - Intronic
1121854746 14:97256897-97256919 GGGGCTGTAATGTGCTTTGTAGG - Intergenic
1123720343 15:23055541-23055563 GGGGCTAGCATGTCTCTGGTCGG + Intergenic
1124684781 15:31772779-31772801 GGGCTTATAAAGTATATTGTAGG - Intronic
1127043629 15:55003204-55003226 AGGGCTTTAATGTATCTTTGAGG - Intergenic
1127321627 15:57852309-57852331 GGGGCTATACTGTGATTTGTAGG - Intergenic
1129092884 15:73170158-73170180 TGGACTATAATGTACCTAGTGGG + Intronic
1135053814 16:19213999-19214021 GGGGCTGTCTTGTACCTTGTAGG + Intronic
1137451541 16:48579110-48579132 GGGGCTGTACTGTGTATTGTAGG - Intronic
1138759891 16:59530781-59530803 GGGGCTAAACTATATCATGTGGG - Intergenic
1140041158 16:71409173-71409195 GGGGCTAGCATGTCTCTGGTTGG - Intergenic
1146765427 17:35516517-35516539 GGGGCTATCCTGTACCTTCTAGG + Intronic
1147227774 17:38993439-38993461 GGGGCTGTCCTGTATATTGTAGG + Intergenic
1149433716 17:56616276-56616298 GGGGCTGTCCTGTATCTTGCAGG + Intergenic
1152595322 17:81235002-81235024 GGGGCTAGCATGTCTCTGGTTGG - Intronic
1156413984 18:36867613-36867635 GTGGCTTTCATGTATCTTGGAGG + Intronic
1159194689 18:65097614-65097636 GGTTCTAAAATGTATCTTCTTGG + Intergenic
1159437227 18:68434287-68434309 AGAGCTTTAATGGATCTTGTAGG + Intergenic
1160363626 18:78305908-78305930 GGGGCTAAAATGGAACTTGAAGG + Intergenic
1163162750 19:15475417-15475439 GGGGCAATAAGGGATCTGGTCGG - Intronic
1163525550 19:17818826-17818848 GGGGCTGTCCTGTATATTGTAGG - Intronic
1165548862 19:36566097-36566119 GGGGCCAGAATTTATCTTCTAGG - Intronic
1166896812 19:46028288-46028310 GGGCCTATTGTGTATCTTGTTGG + Intergenic
925963185 2:9038160-9038182 AGGGGTACAATGTTTCTTGTTGG + Intergenic
926243306 2:11104491-11104513 GGGACTTGAATGTATCTTTTTGG + Intergenic
928217700 2:29376019-29376041 GGGGCTAGCATGTCTCTGGTTGG - Intronic
929852481 2:45604995-45605017 GGGGCTATCTTTTTTCTTGTAGG - Intronic
931441303 2:62292754-62292776 GGGGCAAGAATGAATCTGGTGGG - Intergenic
934233318 2:90206662-90206684 GGGGCTATTATCTGTCATGTTGG + Intergenic
934694115 2:96386283-96386305 GGGGATACAAAGTTTCTTGTAGG - Intergenic
942905132 2:181171484-181171506 GGGTCAATAAAGTATCTTGCTGG + Intergenic
943709014 2:191068548-191068570 TGGCCTAAAATGTATCTTGAAGG - Intronic
946957386 2:224945906-224945928 GGGGCTATCCTGTACCGTGTAGG - Intronic
947495945 2:230637170-230637192 GGGACTGTCCTGTATCTTGTAGG + Intergenic
1172004498 20:31809458-31809480 GGGGCTGTGATGTGTCTTTTGGG + Intergenic
1172546158 20:35763268-35763290 GGGGCAATGATGTAGCTTGTAGG - Intergenic
1173043566 20:39488712-39488734 GGGGCTAGGATGTCTCTGGTGGG - Intergenic
1174542490 20:51300623-51300645 GGGGCTAGCATGTCTCTGGTCGG + Intergenic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1176671751 21:9741211-9741233 GGGGCTTTCCTGTGTCTTGTAGG + Intergenic
1177898341 21:26882484-26882506 GGGGATATAATGGATATGGTTGG - Intergenic
1178831998 21:36063871-36063893 GGGGCTAGCATGTCTCTGGTCGG - Intronic
1180732608 22:17993481-17993503 GGGGCAATAATGGATCTGCTTGG + Intronic
952249367 3:31635256-31635278 GTGCCTATAATTTATCCTGTGGG + Intronic
954295171 3:49670466-49670488 GGGGCGATGATGTATCCTGTGGG - Exonic
957501627 3:81065991-81066013 GGGGCTGGAATGTCTCTGGTTGG - Intergenic
957502099 3:81070062-81070084 GGGGCTGGAATGTCTCTGGTTGG - Intergenic
960086304 3:113595190-113595212 GGGGCTATTCTGTATCTTATAGG + Intronic
960266857 3:115630043-115630065 GGGGCTGTAATGTTGGTTGTTGG - Intronic
962948646 3:140197723-140197745 GGGGCTATCCTGTATATTGTAGG - Intronic
964054100 3:152431177-152431199 GGGGCTGTCTTGTATGTTGTAGG + Intronic
965091196 3:164164070-164164092 TAAGCTATTATGTATCTTGTAGG + Intergenic
966028421 3:175315108-175315130 GGAGCTATAATGTAGCTTGATGG + Intronic
969027715 4:4187035-4187057 GGGGCTGTCCTGTATGTTGTAGG + Intergenic
970109867 4:12625760-12625782 TGGGCTACAATGTTTCCTGTTGG - Intergenic
972932511 4:44090870-44090892 GGAGCTATAATCTATTATGTTGG - Intergenic
973143119 4:46793310-46793332 GGGGCTAGCATGTCTCTGGTTGG + Intronic
973246859 4:48018366-48018388 GGAGCTTAAATGTTTCTTGTTGG - Intronic
975989314 4:80240731-80240753 GGGGCTCTTCTGTATATTGTAGG - Intergenic
977405161 4:96588461-96588483 GGTGCTTTAATATATCTCGTTGG + Intergenic
981948970 4:150383053-150383075 TGGGCTATTAAGTATCTTTTTGG - Intronic
982486489 4:155972315-155972337 GGGGCTGTCCTGTATCTTGTAGG - Intergenic
984158037 4:176216088-176216110 GGGACTATAATATTTCTTTTAGG - Intronic
984600858 4:181725159-181725181 TGGGCAGTAATGTATTTTGTAGG - Intergenic
985402989 4:189610616-189610638 GGGGCTTTCCTGTGTCTTGTAGG - Intergenic
989162520 5:38405068-38405090 GGCCCTATAAGGTATCTTGGGGG - Intronic
990174653 5:53093438-53093460 GGGGCTGTCCTGTACCTTGTAGG + Exonic
990717476 5:58654198-58654220 TGGACTATAATATATCATGTAGG + Intronic
992083853 5:73260303-73260325 AGGACTACAATGTATCTTTTTGG - Intergenic
993472705 5:88325328-88325350 GGGGCCATACTGAAACTTGTTGG - Intergenic
997794631 5:136796378-136796400 TGGGCTAGAAAGTTTCTTGTGGG + Intergenic
997926800 5:138037813-138037835 GGGGATAGAATATATCTTTTTGG - Intronic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1004567215 6:16808980-16809002 AGGGCTTGAATGTATCTTTTAGG + Intergenic
1005016963 6:21383730-21383752 TGGGATATATTGTATATTGTGGG - Intergenic
1010166206 6:72917935-72917957 GGGGCTGTCCTGTGTCTTGTAGG + Intronic
1010583006 6:77622678-77622700 GGGGCTATTCTGTGTATTGTAGG + Intergenic
1010622230 6:78090537-78090559 GGGGCTAGCATGTCTCTGGTTGG + Intergenic
1011951322 6:92968871-92968893 GGGGCTGTCTTGTATGTTGTAGG - Intergenic
1012919838 6:105209978-105210000 GGGGCTATCCTGTGTGTTGTAGG - Intergenic
1012939814 6:105403946-105403968 GGGGCTATAAAGTCTCTTCTGGG - Intergenic
1014316536 6:119872707-119872729 GGGGTTATAATGTATTTGGTTGG - Intergenic
1016576847 6:145578789-145578811 AGGGGAATAAGGTATCTTGTAGG - Intronic
1016919059 6:149273147-149273169 GGGGCTGTCCAGTATCTTGTAGG - Intronic
1018397834 6:163393727-163393749 GGGGCTATAATTTCACTTCTGGG - Intergenic
1020787176 7:12587881-12587903 GGGGCTGGAGTGTATCTTGCAGG - Intronic
1043022969 8:75027687-75027709 GGAGAGATAATGTATTTTGTAGG - Intronic
1043271278 8:78336810-78336832 GAGTCTATAATGTATCTCTTTGG - Intergenic
1046856726 8:119040732-119040754 GGTGCTTTACTGTCTCTTGTTGG - Intronic
1048711482 8:137216898-137216920 AGGGTTAGAATGTTTCTTGTTGG - Intergenic
1053296011 9:36913358-36913380 GGGGCCAGACTGTATCTTGCTGG - Intronic
1054778714 9:69146806-69146828 GGGGCTGTCCTGTACCTTGTGGG - Intronic
1059586444 9:115612575-115612597 GGGATAATAATGTGTCTTGTAGG - Intergenic
1186704077 X:12123651-12123673 GGGGCTGTCTTGTATATTGTTGG + Intergenic
1186754842 X:12659488-12659510 GGGGCTGTCATGTGTGTTGTAGG + Intronic
1188963035 X:36516917-36516939 GGGGCTGTATTGTGTATTGTGGG + Intergenic
1189105766 X:38233725-38233747 GGGCCTAAAATGGGTCTTGTTGG - Intronic
1191961027 X:66702601-66702623 GGGGATATTAAGTATCTTCTGGG - Intergenic
1192574260 X:72230265-72230287 GGGGCTAGCATGTCTCTGGTTGG - Intronic
1194135272 X:90133348-90133370 GGGGCTAGCATGTCTCTGGTTGG + Intergenic
1195086632 X:101419511-101419533 GGGGATATGATCTATTTTGTGGG + Intronic
1197128891 X:122980783-122980805 GGGGGTCTAATGTAACATGTGGG - Intergenic
1197943048 X:131809712-131809734 TGGGCTACAATTTATTTTGTTGG + Intergenic