ID: 1106741672

View in Genome Browser
Species Human (GRCh38)
Location 13:32650197-32650219
Sequence TGGACCTTGAACAAACTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106741672 Original CRISPR TGGACCTTGAACAAACTTTG TGG Intronic
903500922 1:23799861-23799883 TCCACCCTGAACAAACTCTGCGG + Intronic
903947528 1:26973055-26973077 TGGGCCTTGGCCAAACTCTGGGG - Intergenic
904448423 1:30594750-30594772 TGCAACATGGACAAACTTTGAGG + Intergenic
907908835 1:58809592-58809614 TTGTCCTTGAACAAACTATTGGG + Intergenic
907930230 1:58992280-58992302 TGGACCTTGAGGTGACTTTGAGG - Intergenic
910169052 1:84358483-84358505 TGGAACTTCAACAGATTTTGTGG - Intronic
914383607 1:147145204-147145226 TGTACAATGAACAAACTTGGAGG - Intergenic
916828767 1:168469561-168469583 GGGACTTGGAACAAACTTTCTGG + Intergenic
917771308 1:178282215-178282237 TGGACCTTGAATTATCTTTGGGG + Intronic
918363184 1:183779693-183779715 CAGACCTAGAGCAAACTTTGGGG - Intronic
918453136 1:184680235-184680257 TGGACCTTGAATTATTTTTGTGG - Intergenic
919117026 1:193293427-193293449 ATGACCTTGAACAAACTATATGG - Intergenic
920904776 1:210152276-210152298 TGGAGCCTGAACAAACTTGTTGG - Intronic
923345214 1:233045042-233045064 TGGACCTTGATCATTCTTTTGGG + Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1064174100 10:13059262-13059284 TGGACCTTTGAACAACTTTGCGG + Intronic
1065691861 10:28342378-28342400 TGGAACTTAAACAAACTTACAGG - Intergenic
1066453533 10:35552785-35552807 TGGATCTTAAACAGACTCTGTGG - Intronic
1076169518 10:128307853-128307875 TGGGCCTTGAGCAAACTGGGGGG + Intergenic
1077987354 11:7366839-7366861 TGGCACTTGAACACAATTTGTGG - Intronic
1078965008 11:16329243-16329265 AGGACATTCAACAAACTTTTGGG - Intronic
1079019833 11:16900642-16900664 TGGTCCTTGAACAAACTCAAAGG + Intronic
1079841227 11:25401999-25402021 TGTATTTTGAACAAGCTTTGAGG + Intergenic
1080881950 11:36329710-36329732 TGGACCTTTAAAAGCCTTTGAGG + Intronic
1081796419 11:45823574-45823596 TGGGCCTGTAATAAACTTTGAGG - Intergenic
1082946822 11:58770299-58770321 TGGGCCTGTAATAAACTTTGAGG - Intergenic
1088951016 11:114569930-114569952 TGGGCCTATAATAAACTTTGAGG - Intergenic
1090710789 11:129383070-129383092 AGGACTTTGTACAAACTTGGTGG + Intronic
1091528402 12:1329771-1329793 TGGACCATGAAGAAATATTGAGG + Intronic
1099468958 12:83022854-83022876 TGGATCTTGAAGAACTTTTGTGG + Intronic
1100079450 12:90830126-90830148 TGAACTTTGAACAAAGTTTATGG - Intergenic
1100110033 12:91229575-91229597 TGGACCTTGAATAATCTGAGTGG + Intergenic
1100424976 12:94475762-94475784 TGGACCTTGAAAAAACTTTACGG + Intergenic
1104542706 12:129682271-129682293 TGAACCTTGAGCACACTTGGTGG - Intronic
1105337857 13:19491217-19491239 GGGACCTTCCACAAAATTTGAGG - Intronic
1105418002 13:20229818-20229840 TGTCCCCTGAATAAACTTTGTGG + Intronic
1106741672 13:32650197-32650219 TGGACCTTGAACAAACTTTGTGG + Intronic
1110485077 13:76029860-76029882 TGGAACTTGAACCAAATTTATGG + Intergenic
1111624407 13:90765501-90765523 TGGTCCTGGAAAAAACATTGTGG - Intergenic
1112019312 13:95357985-95358007 TGTAGGCTGAACAAACTTTGTGG - Intergenic
1114904607 14:27110947-27110969 TGGATCTAGAATGAACTTTGGGG - Intergenic
1115346629 14:32349692-32349714 CGAAGCTTCAACAAACTTTGAGG + Intronic
1115534053 14:34356140-34356162 TTCATCTTGTACAAACTTTGAGG - Intronic
1115757341 14:36542731-36542753 TGAACCTGAAACAAACTTTGTGG - Intergenic
1118216104 14:63809854-63809876 TTGACCTCAAACTAACTTTGAGG + Intergenic
1119488597 14:75010065-75010087 TAGACTATGAACAAACTTTGGGG - Exonic
1121038016 14:90722677-90722699 GTGACCCTGAACAAACTTGGTGG - Intronic
1125316519 15:38438183-38438205 TGGGCCTGTAATAAACTTTGAGG + Intergenic
1125590955 15:40854188-40854210 TGGTCCTTCCACAAACTCTGAGG - Intronic
1126086232 15:45013389-45013411 TGGGCCCTGAACAAAATCTGAGG + Intergenic
1126961116 15:53995479-53995501 TGAACATTGAAAAAACTTTCAGG - Intergenic
1127140371 15:55969735-55969757 TGGGCCTTGAATAAACATCGGGG + Intronic
1131606894 15:93914986-93915008 TGGCCCTTGAACTCACTTTTTGG - Intergenic
1137321585 16:47388870-47388892 TGGGCCTGTAATAAACTTTGAGG - Intronic
1137354353 16:47745348-47745370 TAGAACTTGAATCAACTTTGAGG - Intergenic
1138475298 16:57267220-57267242 TAGAACTTGAACATATTTTGGGG - Intronic
1138597908 16:58038929-58038951 TGGACCTTGAATTCACTCTGGGG - Intronic
1139183433 16:64773969-64773991 GGCAACTTGAATAAACTTTGAGG - Intergenic
1140689444 16:77467595-77467617 TGGACCTTGAATAAATTGTATGG - Intergenic
1141480036 16:84300328-84300350 TGGACCTTGGAGAAACCGTGTGG - Intronic
1141704976 16:85659854-85659876 GGGTCCTTGAAGACACTTTGAGG + Intronic
1145242543 17:21248328-21248350 AGGACCTTGGTCAAGCTTTGGGG - Intronic
1154400639 18:14033529-14033551 TGGGCCTTGAACCAAATTTGGGG - Intergenic
1156735018 18:40245746-40245768 TGGTCCTTTTACAAACTTTTAGG - Intergenic
1159801416 18:72904915-72904937 TGGACCTTCAAAAATCTTTTAGG - Intergenic
1163446649 19:17350982-17351004 TCAACCTGGAACAAACGTTGGGG - Intergenic
1166166473 19:40992901-40992923 TGGGCCTGTAATAAACTTTGAGG + Intronic
1166166812 19:40996099-40996121 TGGGCCTGTAATAAACTTTGAGG + Intronic
942701996 2:178722488-178722510 AGGACATTGAACAAACTGTGGGG - Exonic
944822229 2:203442370-203442392 GGCTCTTTGAACAAACTTTGAGG + Exonic
1169154181 20:3315361-3315383 TGGAACATGAACAAGCATTGCGG - Intronic
1170377738 20:15719251-15719273 GGGATTTTGAACAAGCTTTGAGG + Intronic
1170548873 20:17458380-17458402 TGGAGGTAGAACAAACTCTGAGG - Intronic
1173036011 20:39411268-39411290 TTGGCCTTGAACAATCTTTCTGG - Intergenic
1173703290 20:45092175-45092197 TGGATTTGGCACAAACTTTGTGG - Intergenic
1177613905 21:23491138-23491160 AGGACTTTGTAGAAACTTTGGGG + Intergenic
1177644768 21:23887260-23887282 TGGACATTGAGAAGACTTTGAGG + Intergenic
1181884875 22:26012695-26012717 TGGACCTTTTAGAAAATTTGAGG + Intronic
1183340657 22:37279096-37279118 TGGACCATGAAGAGAATTTGAGG + Intergenic
1184359268 22:44004491-44004513 TGGGCCTGTAACAAACTTTGAGG - Intronic
1185363422 22:50423035-50423057 TGTCCCATGAACACACTTTGGGG - Intronic
949263462 3:2129722-2129744 ATGACCTTGAACAACCTTTCTGG + Intronic
953645518 3:44750218-44750240 TTGACCTTAAACTAACTTTTTGG + Exonic
959086045 3:101851656-101851678 TTGACTTTGGAAAAACTTTGGGG - Intronic
959844259 3:111014740-111014762 TGTACCTCTAACAAACTTTCAGG - Intergenic
960760563 3:121070336-121070358 TGGGCCTCTAATAAACTTTGAGG + Intronic
961041248 3:123679992-123680014 TGGAGCTTGAACAAATACTGAGG + Intronic
961333015 3:126154076-126154098 TGGACTTTGTGCAAACCTTGAGG - Intronic
961709683 3:128818453-128818475 TGGACCTTGACATGACTTTGAGG + Intergenic
962016833 3:131449587-131449609 TGGACATTGTACTAACTCTGGGG - Intergenic
964235098 3:154516339-154516361 TACAACTTGAACAAACCTTGAGG - Intergenic
964542508 3:157795252-157795274 TGGACCTTAATTAAAATTTGTGG + Intergenic
967182629 3:186919598-186919620 TGGTCCTTGGCCAAAGTTTGGGG + Intergenic
967369535 3:188728889-188728911 TGTACCATGAACAAATTTAGAGG + Intronic
967559701 3:190903510-190903532 TGGACCTTGTATAAACATAGAGG + Intergenic
973090271 4:46126922-46126944 TGATCCCTGAACAAATTTTGGGG - Intergenic
973207218 4:47574464-47574486 TGGATGTTGGACAACCTTTGAGG + Intronic
974714811 4:65654358-65654380 TGGAACTTGAACAAAAGTTAAGG - Intronic
977088951 4:92645613-92645635 AGGAGCATGAAGAAACTTTGTGG - Intronic
981362088 4:143858738-143858760 TCCACCTTGTAAAAACTTTGTGG + Intergenic
981372821 4:143979573-143979595 TCCACCTTGCAAAAACTTTGTGG + Intergenic
981381910 4:144082813-144082835 TCCACCTTGCAAAAACTTTGTGG + Intergenic
987849566 5:23333021-23333043 CAAACCTTGGACAAACTTTGGGG + Intergenic
988203263 5:28097543-28097565 TCGACCTTGAAATTACTTTGGGG - Intergenic
991470647 5:66965539-66965561 TGGACCTTGAAAAATATTGGAGG + Intronic
994474818 5:100253393-100253415 TAGAAATTCAACAAACTTTGAGG - Intergenic
995013971 5:107289375-107289397 TGGCCCATGAACAAGCTTTCGGG - Intergenic
995056280 5:107762730-107762752 TAGGCCATGTACAAACTTTGGGG - Intergenic
996446233 5:123554706-123554728 TGAACCTACAACAATCTTTGTGG + Intronic
998056258 5:139080577-139080599 TAGACCCTGAACAAAATTTGAGG - Intronic
1000403287 5:160856098-160856120 TGTACCTAGAAAAAACTTTTTGG + Intergenic
1009493849 6:64326290-64326312 TGGGCCTGTAATAAACTTTGAGG - Intronic
1009495021 6:64335349-64335371 TGGGCCTGTAATAAACTTTGAGG - Intronic
1015812036 6:137170435-137170457 TGGGCCTGTAATAAACTTTGAGG - Intronic
1015854018 6:137604282-137604304 TGCACCTTGCACAGATTTTGGGG - Intergenic
1017692537 6:156981174-156981196 TGGACCTGGAGCAATCTTAGAGG - Intronic
1018691114 6:166344872-166344894 TGGCTCTTGAAAAAACTATGTGG - Intergenic
1020700193 7:11472253-11472275 TTGACCTTGAATAAGATTTGGGG - Intronic
1023071309 7:36437329-36437351 TACAACATGAACAAACTTTGAGG - Intronic
1029459483 7:100686869-100686891 TGGACCCTCAAGAAACGTTGGGG + Intronic
1033100010 7:138461285-138461307 TGGACCTGGACAAAGCTTTGTGG - Intronic
1034567518 7:151927154-151927176 TGGCCCTTGAACACACATTTTGG + Intergenic
1038320650 8:26523611-26523633 TACAACATGAACAAACTTTGAGG - Intronic
1039734121 8:40311843-40311865 TTAACCTTGAATTAACTTTGAGG + Intergenic
1039916194 8:41862057-41862079 TGGAACTGGAACAAAATTTCGGG + Intronic
1040696185 8:50001770-50001792 TTAACCTTGAACAAGCTATGAGG - Intronic
1041411839 8:57564855-57564877 TGGTTCTTGAACAAACTCTGGGG - Intergenic
1046974313 8:120256583-120256605 TTAACCTGGAACAAACATTGAGG + Intronic
1047803728 8:128336770-128336792 TTCAACTTAAACAAACTTTGAGG - Intergenic
1056818334 9:89817763-89817785 TGGGCCTGGAGCCAACTTTGAGG + Intergenic
1058464802 9:105216565-105216587 TGGACTTTGAACAATCCCTGTGG + Intergenic
1185827712 X:3268190-3268212 TTGACAATGAAAAAACTTTGTGG - Intergenic
1188828525 X:34867293-34867315 TGGATCTTTCAGAAACTTTGTGG + Intergenic
1189155841 X:38756101-38756123 TGGTGCTTGAAGAAGCTTTGGGG - Intergenic
1189664356 X:43337510-43337532 TTGACCTTAAACTAAATTTGAGG + Intergenic
1190948222 X:55116766-55116788 TGGGCCTGTAATAAACTTTGAGG - Intronic
1191841813 X:65518620-65518642 TGGACCCAGAACAAACTCTGTGG + Intronic
1193815507 X:86101006-86101028 TGAACCTTGGGCAAACCTTGAGG - Intergenic
1195380147 X:104262760-104262782 TGGCCCTTGTACAAAATATGTGG - Intergenic
1196128522 X:112126125-112126147 TTAACCTTGAACAAAATATGGGG + Intergenic
1197570146 X:128140578-128140600 TGGGTCATGAACAAACTTTTTGG - Intergenic
1198033329 X:132776856-132776878 TGGACCTTTAAAAAACTGAGTGG - Intronic
1201377462 Y:13338870-13338892 TGGGCCTGTAATAAACTTTGAGG - Intronic