ID: 1106744982

View in Genome Browser
Species Human (GRCh38)
Location 13:32692579-32692601
Sequence TTGGTAACAAGGAGATTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106744977_1106744982 23 Left 1106744977 13:32692533-32692555 CCTGATGGTAGCTGTCTTTTTCT 0: 1
1: 0
2: 1
3: 13
4: 244
Right 1106744982 13:32692579-32692601 TTGGTAACAAGGAGATTTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106744982 Original CRISPR TTGGTAACAAGGAGATTTGT GGG Intronic
905833807 1:41098787-41098809 TTGGTGACATGTACATTTGTGGG - Intronic
906556053 1:46715216-46715238 TTGATATCAAAGAGATCTGTAGG + Intronic
907170381 1:52457677-52457699 TTGGCACAAAGTAGATTTGTAGG - Intronic
907976924 1:59440291-59440313 TTTGCAAGAAGGAGCTTTGTGGG - Intronic
909417914 1:75428386-75428408 TTGCTAACAAGGATAATTGATGG - Intronic
911296863 1:96128262-96128284 CTGGTAACAAAGAGACTGGTGGG + Intergenic
913338795 1:117735484-117735506 AGGGGAACAAGGAAATTTGTGGG - Intergenic
914686478 1:149984327-149984349 TTGAGGACAAGGAGATTTGCAGG - Intronic
915677446 1:157544779-157544801 TTGGTCAAAAGGAGATTCCTTGG - Intronic
916611751 1:166398320-166398342 GTGGTGAAAATGAGATTTGTAGG + Intergenic
916897478 1:169180345-169180367 GTGCTGACAAGGGGATTTGTGGG - Intronic
917995452 1:180434007-180434029 TGGTTTACAAGGAGATGTGTAGG - Intronic
918580170 1:186117482-186117504 TTGGTTACTAGGAAATCTGTAGG - Exonic
920939629 1:210469436-210469458 TGAGGAATAAGGAGATTTGTCGG - Intronic
921799494 1:219385771-219385793 TTGCTAACAAAGAATTTTGTAGG + Intergenic
921821242 1:219619564-219619586 TTGGTACATAGGAGATGTGTAGG - Intergenic
923462626 1:234220391-234220413 GTGGTGACAAGGAGACATGTTGG + Intronic
923894078 1:238249749-238249771 ATGGTAACAACAAGTTTTGTGGG + Intergenic
924904530 1:248437868-248437890 TAAGTAACAAGGAGAACTGTTGG - Intergenic
924923357 1:248654182-248654204 TAAGTAACAAGGAGAACTGTTGG + Intergenic
1066304391 10:34125888-34125910 TTGCCAACAAGGAGACTTGCTGG - Intronic
1069497184 10:68916053-68916075 ATGGTAAAAAGAAGCTTTGTGGG + Intronic
1073169746 10:101495218-101495240 TTGGTAACATGTTGCTTTGTTGG + Intronic
1076380133 10:130019304-130019326 TTGGTGACCAGGACATGTGTAGG + Intergenic
1078663487 11:13305857-13305879 CTTGAAACAGGGAGATTTGTTGG + Intronic
1078865586 11:15294328-15294350 TAGGCCAAAAGGAGATTTGTTGG + Intergenic
1081873497 11:46393618-46393640 TTGGGAACAAGGGGACTTGGTGG + Intergenic
1083950754 11:65954483-65954505 TTCCTAATAAGCAGATTTGTGGG + Intronic
1086857534 11:91883387-91883409 TGGGAAAGAAAGAGATTTGTAGG - Intergenic
1088657425 11:112013990-112014012 TTTTTAACAAGCAGTTTTGTGGG + Intronic
1091081853 11:132678374-132678396 ATAGTAAAAAGGACATTTGTTGG - Intronic
1091194569 11:133720089-133720111 CTGGTAAGGAGGAGATTTGGAGG + Intergenic
1091769180 12:3140289-3140311 TTGGTACCAAGGAAACTTGTAGG + Intronic
1092686616 12:11055940-11055962 TTGGCAGCAACGAGATTTTTAGG - Intronic
1094089281 12:26630018-26630040 TTGGTAGCAAAGGGATTTGCAGG + Intronic
1094245257 12:28284160-28284182 TTGGAAAAAAGGAGTTTTCTAGG + Intronic
1098990545 12:77060766-77060788 CTGGAAAGAAGGAGAGTTGTTGG - Intronic
1100368933 12:93947343-93947365 CTGATAAGAAGGAGATTAGTAGG - Intergenic
1102941595 12:116947346-116947368 GTGTTAACAAGGAGAATTCTAGG + Intronic
1106744982 13:32692579-32692601 TTGGTAACAAGGAGATTTGTGGG + Intronic
1111063674 13:83060383-83060405 TTGAAAACAAGGAATTTTGTTGG - Intergenic
1113375584 13:109762472-109762494 TTGGTGACAATGAGATGGGTGGG + Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1117916983 14:60688088-60688110 TTAGTAAGAAGGATATTTATTGG - Intergenic
1118059449 14:62118956-62118978 TCTGTAAAAAGGACATTTGTGGG + Intergenic
1119077250 14:71653794-71653816 TTGGTATCTAGCAGGTTTGTCGG - Intronic
1121183159 14:91944777-91944799 TTGGTAACCAGGGGCTTAGTGGG + Intronic
1124356067 15:28995759-28995781 TTGATCACCAGGAGATTTTTCGG + Exonic
1124916201 15:33977091-33977113 TTGGTACCAAGGAGATAGGAAGG + Intronic
1125189414 15:36972675-36972697 TTGGAAACCAGGAGAGGTGTTGG - Intronic
1127341443 15:58048934-58048956 AGGGAAACAAGGAAATTTGTGGG - Intronic
1128535757 15:68489002-68489024 GGGGTAGCAAGGAGAATTGTTGG + Intergenic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1134424663 16:14128920-14128942 CTGATAACAAGGAGATTTTTGGG - Intronic
1138156916 16:54714278-54714300 TTTGTAACAGGGAGAGTTTTAGG - Intergenic
1139129051 16:64118296-64118318 TTGATAACATGGCCATTTGTTGG + Intergenic
1144574265 17:16419054-16419076 TTGGTGACAAGGTGATTGTTGGG - Intronic
1148537500 17:48452667-48452689 TTGGTAAGGATGAGCTTTGTGGG + Intergenic
1152332885 17:79683762-79683784 TTGCCAAGAAGGAGAGTTGTCGG - Intergenic
1153294500 18:3532719-3532741 TTTGAAACAAGGAAATTTGGTGG - Intronic
1154105994 18:11523573-11523595 TGGGTAACAGGGAGTTTTGAGGG - Intergenic
1154956284 18:21258847-21258869 TTATTAACTAGGATATTTGTTGG - Intronic
1157754768 18:50207943-50207965 TCCTTAACAAGGAGAATTGTAGG + Intergenic
1159006945 18:63021848-63021870 TTAGTAGTAAGGACATTTGTGGG + Intergenic
1164735166 19:30535975-30535997 TCGGTGTCAGGGAGATTTGTGGG - Intronic
1167979810 19:53265604-53265626 TTGGAAAGAAAGAGATTTGGGGG - Intergenic
925136082 2:1525572-1525594 TTGGTCATAGGGAGATTTGGGGG - Intronic
928294360 2:30069962-30069984 GTGGTAAAGAGCAGATTTGTGGG + Intergenic
928517721 2:32059883-32059905 ATACTAACAAGGAGATTTGTTGG - Intergenic
928764727 2:34630851-34630873 TTGGTAACAACATGATCTGTAGG - Intergenic
930676440 2:54205661-54205683 TTGGTAAAAAGGAGATACTTGGG - Intronic
931550352 2:63438371-63438393 ATGGTAACAATGTGATTTCTTGG - Intronic
931848249 2:66226811-66226833 TTGGTAGCAAGAAGACTTGATGG + Intergenic
933135725 2:78732761-78732783 TTGGTAACCTTGAGATTTGGAGG - Intergenic
934965822 2:98721147-98721169 TGGTTAACAAGGACTTTTGTTGG - Intronic
935388680 2:102527850-102527872 TTGGAAACAATGATATTTCTTGG + Intronic
935581982 2:104763896-104763918 TTGGTACCAAGGAGCTTCCTTGG - Intergenic
936065156 2:109325684-109325706 TTGGAAACCAGGAGATGAGTGGG - Intronic
941842954 2:170107416-170107438 TTGTTAAGAAGGAAATTTGAAGG + Intergenic
942118451 2:172751815-172751837 TTGGTAACAAGGCCTTTTTTTGG + Intronic
942681142 2:178479535-178479557 TTGGAAACAAGGCGAATTGATGG - Intergenic
1168759664 20:341237-341259 TTGGCAACAAGGAGGTCAGTGGG - Intergenic
1172028404 20:31965359-31965381 CTGGGCACAAGGAGATTTGGTGG + Intergenic
1173599472 20:44283049-44283071 TTGGTAACCAGGAGCTCTGTGGG - Intergenic
1175422597 20:58844072-58844094 TTGGTAAGAATGAGGTTTTTTGG + Intronic
1175658806 20:60794484-60794506 TGGGCACCAAGGAGATTTGGGGG - Intergenic
1175677676 20:60960827-60960849 TTGGTAACAAGGAAAGTAGGGGG - Intergenic
1177569509 21:22869993-22870015 TTGGTGACAAAGAAATTTGGGGG - Intergenic
1179269269 21:39837676-39837698 TAGGTAACAAGCAGATTCGATGG - Intergenic
1181895153 22:26100672-26100694 ATGGCAAGAAGGGGATTTGTAGG - Intergenic
1182252068 22:29008734-29008756 TGGTTAACAAGGATAGTTGTTGG - Intronic
950439805 3:13003699-13003721 TTGGTAAAAAGGACATTACTGGG + Intronic
951231964 3:20189373-20189395 TTAGTAACAAGCAGTTTTATTGG - Intergenic
952051529 3:29390069-29390091 GTGGTATCAAGGGGTTTTGTAGG - Intronic
952947417 3:38487719-38487741 TTGGTAACACAAAGATTTGCTGG + Exonic
960170243 3:114452527-114452549 TTGATAACAAGGAGTCTTTTCGG - Intronic
960237056 3:115295757-115295779 GTGGCAAAAAGGAGTTTTGTGGG + Intergenic
960589514 3:119352038-119352060 TTTGTTATTAGGAGATTTGTAGG - Intronic
960810747 3:121624956-121624978 TTGGGACTGAGGAGATTTGTTGG - Intronic
964108278 3:153062376-153062398 TTGACAACAAGGAGATATGCAGG + Intergenic
964505616 3:157395680-157395702 TTGGTGACAAAGAAATTTTTGGG - Intronic
967410860 3:189165465-189165487 TTGTTGACATGGAGATTTCTAGG + Intronic
970038753 4:11771958-11771980 ATGGAAAAAAGGAGATTTGAGGG + Intergenic
970505414 4:16724328-16724350 TTGGATGCAGGGAGATTTGTGGG + Intronic
973256448 4:48118037-48118059 TTGGTGACAAGGAGATCTTGGGG - Intronic
974887302 4:67835309-67835331 TTGTAAACAAAGAGATTTGTAGG - Intronic
975624619 4:76332710-76332732 TTAGTGACAAGGACATTTATAGG + Intronic
977182810 4:93898489-93898511 TGTGTAACAACGAGTTTTGTGGG - Intergenic
977300118 4:95257834-95257856 TTGATAAAAAGGATATTTGCAGG + Intronic
978441829 4:108741412-108741434 TTGGTTAAAAGAAGATTTCTTGG + Intergenic
979190135 4:117846729-117846751 TGGGTAACAAGGTGCATTGTCGG - Intergenic
981454742 4:144940432-144940454 TTGGCAATTAGGAGATTTGGGGG - Intergenic
981812824 4:148794958-148794980 TTGGAGACAAAGAGATATGTTGG + Intergenic
984418178 4:179487054-179487076 TTGTTGACAAGGAAATTTGGGGG - Intergenic
987045863 5:14107576-14107598 TTGGTTACATGGATATTTGACGG - Intergenic
987810787 5:22832798-22832820 TTTGTATCAAAGATATTTGTTGG - Intronic
991423771 5:66469142-66469164 TTGGTAACAAACAGATTTTATGG - Intergenic
993699970 5:91107254-91107276 TTGGTTCAAAGGAGATTTTTTGG + Intronic
993788071 5:92169289-92169311 TTGGTAAAAGGTAGTTTTGTTGG - Intergenic
994406300 5:99349911-99349933 TTGAAAACAAGGAAATTTATGGG + Intergenic
995254519 5:110031154-110031176 TTTGAAATAAGGAGATTTATTGG + Intergenic
995418972 5:111941092-111941114 TTGGTAACCCAGAGATTTCTGGG - Intronic
995698633 5:114907539-114907561 TTGGTAAGAAAAAGATTTTTGGG - Intergenic
997024646 5:130044362-130044384 TTGATAACATGGGGTTTTGTAGG + Intronic
999819879 5:155216055-155216077 GTGGTAGCAATGAGATTTGGAGG + Intergenic
1000963184 5:167624794-167624816 TTCATAACAAGAAGAGTTGTTGG + Intronic
1007114083 6:39330991-39331013 TTGGCAAAAAGGGGACTTGTGGG - Exonic
1007718512 6:43870939-43870961 TTAGTAACAGGCAGATTTCTGGG - Intergenic
1008180453 6:48321645-48321667 TTTTTAAAAAGGAGCTTTGTAGG - Intergenic
1012389234 6:98718347-98718369 TTTGTAACAAGGTGAATTCTTGG + Intergenic
1013612031 6:111804655-111804677 TTGGTAACAAGGGGATACTTAGG + Intronic
1013883427 6:114933216-114933238 TTGGAAGCAAGGGGATATGTTGG + Intergenic
1013996960 6:116320336-116320358 TTGGTAAAAATGAGATTTTCTGG + Intronic
1015460068 6:133480334-133480356 TTGTCAACAAGGTGATTTCTGGG + Intronic
1015648748 6:135428736-135428758 TTAGTAGCAAGGAAGTTTGTAGG - Exonic
1015945930 6:138501048-138501070 TTAGACACAAGGAGAGTTGTGGG + Intronic
1016169975 6:141000758-141000780 TTGCTAACTAGGAAATTTATAGG - Intergenic
1018151401 6:160943423-160943445 TAGGTATCAAGGTGATTTGGGGG - Intergenic
1018593245 6:165451337-165451359 TTGGGAGCAGGGAGATTAGTTGG - Intronic
1020152285 7:5692004-5692026 TTGAAAACATGGAGATTTGTAGG - Intronic
1022119175 7:27290662-27290684 ATGGTAAGAAGCAGATTTGGTGG + Intergenic
1022626948 7:32046420-32046442 TTGGGAACAATCAGATCTGTTGG - Intronic
1030594358 7:111519357-111519379 TTGGTATAAAGGGGATTTATTGG - Intronic
1033720277 7:144051371-144051393 TTGCTCCCAATGAGATTTGTAGG + Exonic
1034470089 7:151250278-151250300 TTGGTAGCAAGGGGATCTCTAGG - Intronic
1035733183 8:1866868-1866890 ATGGTAACAGTGAGATATGTGGG + Intronic
1040617108 8:49047804-49047826 GTGTTAACAAAGAGATTTCTAGG + Intergenic
1040891535 8:52322242-52322264 GTGGTAAAAATGAGAATTGTAGG - Intronic
1043352815 8:79381246-79381268 TTGAAGACAAGGAGATTTGTTGG + Intergenic
1043921585 8:85989564-85989586 AGGGGCACAAGGAGATTTGTGGG - Intronic
1044168597 8:89020628-89020650 GTGGCAACAAGGAGATGTGAGGG + Intergenic
1044520904 8:93198291-93198313 TTGGTCACAAGGCTATGTGTCGG - Intergenic
1047825251 8:128566123-128566145 TTGGAAAAAAGGAGGGTTGTTGG + Intergenic
1048104355 8:131391422-131391444 TTTTTAAAAAGGAGTTTTGTAGG - Intergenic
1050166734 9:2772322-2772344 TAGGTATCAAGGAGATGTGGTGG + Intronic
1051204800 9:14675086-14675108 TTGATCATAATGAGATTTGTTGG - Intronic
1051468018 9:17403084-17403106 TTGGTGACAGGGAGGTCTGTGGG + Intronic
1057109814 9:92458259-92458281 TTGGTAACAGTGAGATTTCTGGG + Intronic
1058854434 9:109046708-109046730 TTGGTATCACTGATATTTGTAGG + Intronic
1059265708 9:113028388-113028410 CTGGTCAAAAGGAAATTTGTAGG + Intergenic
1060156561 9:121324455-121324477 CTGGTAACAGGGAGATGTGTAGG + Intronic
1185931280 X:4206046-4206068 TTGGGAAGAAGGAGGTTGGTAGG + Intergenic
1187622589 X:21074850-21074872 TTGGTATCAAAGAGAACTGTTGG - Intergenic
1189683313 X:43538606-43538628 TTGGTTACAAGCAGTTTTTTGGG + Intergenic
1191759433 X:64630521-64630543 TTGGTGACAAAGAAATTTGGAGG + Intergenic
1194758373 X:97764386-97764408 GTGACAAAAAGGAGATTTGTTGG + Intergenic
1195916249 X:109939076-109939098 TTGCCTACCAGGAGATTTGTTGG + Intergenic
1196056703 X:111363619-111363641 TTTGAAACTAGGAGGTTTGTAGG - Intronic
1198263009 X:134983267-134983289 TTGGTAACAAGAAGGTTTTGGGG - Intergenic
1199532347 X:148864338-148864360 TGGATAACTAGGAGTTTTGTTGG + Intronic
1201651498 Y:16293592-16293614 ATGGTAAAAAAAAGATTTGTAGG + Intergenic