ID: 1106750200

View in Genome Browser
Species Human (GRCh38)
Location 13:32756349-32756371
Sequence CTTCCTCTGTAGAAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 345}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106750200 Original CRISPR CTTCCTCTGTAGAAGGAGAA TGG Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900699680 1:4038033-4038055 ATTCCTCTTGAGAATGAGAATGG + Intergenic
901654241 1:10760230-10760252 CAGCCTCTGGAGATGGAGAAAGG + Intronic
901714012 1:11138653-11138675 CTTCCTTTTAAGAAGGAGGAAGG + Intronic
902330412 1:15728546-15728568 CTTGCCCTGCAGTAGGAGAATGG - Intronic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902854619 1:19192219-19192241 CTCCCTCTTTAGTACGAGAAAGG + Exonic
903260783 1:22130666-22130688 CCTCATCTGTAGTAAGAGAAGGG + Intronic
904703983 1:32376736-32376758 GCTCCTCTGTAGAGAGAGAAAGG + Exonic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
907315877 1:53572268-53572290 CTCCATCTGTAAAATGAGAATGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907747986 1:57233809-57233831 CTTCCTCTGCAAACTGAGAAAGG + Intronic
910111869 1:83692136-83692158 CTTCCTCCGGTGAAGGAGAATGG - Intergenic
910492316 1:87786127-87786149 TTTCCTCTTTACAAGAAGAATGG + Intergenic
910759627 1:90721139-90721161 TTTCCTTAGAAGAAGGAGAAGGG + Intergenic
913350198 1:117849889-117849911 TTTTCTCTGTAAAAGCAGAAAGG + Intergenic
914421183 1:147529683-147529705 CTCCCACTGTAGATGGAAAAAGG + Intergenic
916513196 1:165491638-165491660 CTTCCTCTGTAAATGGAATATGG + Intergenic
918978316 1:191520690-191520712 CTTTCTCTCTAGAAGGAAGAAGG - Intergenic
920349696 1:205329655-205329677 TTCCATCTGTAGAAGGAGACTGG - Intergenic
920397882 1:205659845-205659867 CTTCCTCAGGAGTGGGAGAAGGG + Intronic
920659411 1:207902655-207902677 CTTCCTCTGGAGAGAGAAAAGGG - Intronic
921071907 1:211667226-211667248 CTTTCTCTTTAAAAAGAGAATGG + Exonic
921951007 1:220929945-220929967 CTACCTCTGTAAAAGAAGAAAGG - Intergenic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
1065633187 10:27703174-27703196 CATTCTCTGTAGGAGGAAAAAGG + Intronic
1065760666 10:28979881-28979903 TTTCCTTTGTAAATGGAGAAAGG + Intergenic
1065830095 10:29607631-29607653 CTTCCTCTGTAGTCTGTGAATGG + Intronic
1067471070 10:46538290-46538312 CTTCATCTATAGAATGAGGATGG - Intergenic
1067698123 10:48549937-48549959 TGTCCTCTGTGGCAGGAGAATGG - Intronic
1067741877 10:48901734-48901756 ATGCCTCTGCAGCAGGAGAAAGG + Intronic
1069718045 10:70533146-70533168 CTTCCTCTGAGGAAGGCGAGAGG - Intronic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071489733 10:86128168-86128190 TTTCCTCTGTGAGAGGAGAATGG + Intronic
1072293463 10:93988024-93988046 CTTCCTCTGTAGAAGACTCAAGG + Intergenic
1074317633 10:112373868-112373890 CTACCTCAGGGGAAGGAGAAGGG - Intergenic
1074869914 10:117568301-117568323 CTTCCTGTGCAGTAGGACAAAGG - Intergenic
1074909286 10:117892905-117892927 GTTCCTGTGGAGAAGGAGAGAGG - Intergenic
1075182686 10:120225935-120225957 CTTCCTCTGGAGACGTTGAAGGG - Intergenic
1076425450 10:130364277-130364299 CCTGCTCTGGAGAAGGAGCAAGG - Intergenic
1076624525 10:131813320-131813342 ATTCCTCTGAAGAAGGACACAGG - Intergenic
1076796009 10:132798847-132798869 CGTCCTCTGTGGCGGGAGAAGGG + Intergenic
1078184100 11:9036979-9037001 CTTTCTCTCTGGAAGGAAAATGG - Intronic
1079222773 11:18578280-18578302 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1079545756 11:21630057-21630079 CTTCCTTGGTAGGAGGAGATTGG + Intergenic
1079934034 11:26596283-26596305 CTGCCTCTGTAGAAGGATTTTGG + Intronic
1081852165 11:46281383-46281405 CTTCCTCTGGCTAAGGGGAAGGG + Intronic
1082980305 11:59114766-59114788 CTGACACTGTAGAGGGAGAAAGG + Intronic
1083178988 11:60972258-60972280 CTGCCTCTCTGGAAGGTGAACGG - Intronic
1083436508 11:62647023-62647045 CGTCCCCTGTCGAAGGAGAGTGG + Exonic
1083572093 11:63766299-63766321 CTTGCCCTGAAGAAGGGGAAAGG + Exonic
1083840647 11:65302320-65302342 CTTCCTCTGAAGCAGGAGCGGGG - Intronic
1084373194 11:68758425-68758447 CTTCCTCTGTGGATGGAACAAGG - Intronic
1084416949 11:69037964-69037986 CTTCCTCTTGCGAAGGAGACTGG - Intergenic
1084769239 11:71331930-71331952 CCCCTCCTGTAGAAGGAGAATGG + Intergenic
1085044748 11:73346389-73346411 CTTCCTCTGTAGCAGGGTGATGG + Intronic
1085067479 11:73510555-73510577 CTTCCTCTGTAAAATGAGCAGGG + Intronic
1085091415 11:73718151-73718173 CTTCCTCTACAGAGAGAGAATGG + Intronic
1085576789 11:77612334-77612356 CTTCCACTGTAGAAGCTGAAAGG + Intronic
1085829714 11:79886468-79886490 CTTTCTCTGAAGAGGCAGAATGG + Intergenic
1088030840 11:105248285-105248307 CTTCCCCTCTACAAAGAGAATGG + Intergenic
1088577010 11:111282152-111282174 TTTTCTCTGTACAAAGAGAAAGG - Intronic
1089086085 11:115818022-115818044 CCTCCTCTGGAGCAGGGGAAGGG + Intergenic
1089147959 11:116344131-116344153 CTTACTCTGAAGATGGAGGAAGG - Intergenic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089674261 11:120079534-120079556 CTCCCTCTCTAGGAGGAGGAAGG - Intergenic
1090098319 11:123767002-123767024 CTTCTTCAATAGGAGGAGAAAGG - Intergenic
1091223088 11:133942155-133942177 TTTCCTCTCGAGAAGGAGGATGG + Intronic
1091320167 11:134643721-134643743 CCTCCTCTGTAAAATGAGAATGG + Intergenic
1091800911 12:3323988-3324010 CTTCCTCTGTAGAACAGGGAGGG - Intergenic
1092967179 12:13655499-13655521 CATCCTCAATAGAATGAGAATGG + Intronic
1093823640 12:23653685-23653707 CTCACACTGTAGAAGGAGCAAGG + Intronic
1096026035 12:48362059-48362081 ATTTCTCTGGAGAAGGAGAGGGG - Intergenic
1096240295 12:49956203-49956225 CCTCCTCAGGAGAAGGGGAAGGG + Exonic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096370803 12:51067519-51067541 CTTACTCTGTTGACGGAGGAGGG + Intronic
1096586593 12:52626641-52626663 CTACTTCTGTGAAAGGAGAAAGG + Intergenic
1098025048 12:66192593-66192615 CTTCCTCTCAAGAAAGAAAAGGG + Intronic
1098739744 12:74157581-74157603 CTCCCTATCTAGTAGGAGAAGGG + Intergenic
1099644969 12:85341436-85341458 CTGCCTTTGAAGAAGGAGGAAGG - Intergenic
1099813893 12:87620777-87620799 CTTGATCTGTATAAGCAGAAAGG - Intergenic
1101084013 12:101216894-101216916 CTTCCACTGTAGTATGAAAAAGG + Intergenic
1101136341 12:101747654-101747676 CTTCATCTGTAGGAGGAGGCAGG + Intronic
1101208461 12:102512759-102512781 CCTTCTGTTTAGAAGGAGAAAGG - Intergenic
1104586760 12:130053908-130053930 CCTCTTCTGTGGCAGGAGAAAGG - Intergenic
1106750200 13:32756349-32756371 CTTCCTCTGTAGAAGGAGAATGG + Intronic
1106804014 13:33287545-33287567 CATCGTCTGTGGAAGGTGAAAGG + Intronic
1107811058 13:44200069-44200091 CCTCCTCTGTAGAATGTGAGTGG - Intergenic
1108259253 13:48640648-48640670 CTTCCTCTGTATCAGGTGAGAGG + Intergenic
1110580831 13:77122969-77122991 CTTCCTCTCTAGACTAAGAATGG + Intronic
1110816643 13:79867678-79867700 CCTACTCAGTAAAAGGAGAATGG + Intergenic
1110897082 13:80767880-80767902 CTTCCTTCCTAGGAGGAGAAAGG - Intergenic
1112669609 13:101619424-101619446 CTGCCTTTGAAGATGGAGAAAGG + Intronic
1115433724 14:33349897-33349919 ATTCTTCTCTAGCAGGAGAAGGG + Intronic
1115536464 14:34377898-34377920 CATCCTCTGTAGAGAAAGAAGGG - Intronic
1115544474 14:34453355-34453377 CTTTCTCTGAAGAGGGAGACTGG - Intronic
1115941626 14:38617190-38617212 CTTGCTCTGCAGCAGGTGAAGGG + Intergenic
1116108223 14:40539770-40539792 CTTCATCAGTAGCATGAGAACGG - Intergenic
1117653546 14:57931080-57931102 CTTCCTCTGTAAAATGAGGGAGG - Intronic
1118663931 14:68046042-68046064 CTTCCTCACTAGAATGAGATAGG - Intronic
1118909591 14:70050128-70050150 CCTCCTTTGTAAAAGGAGCAGGG + Intronic
1119250062 14:73144643-73144665 TTTCATCTGTAAAAGGATAAAGG + Intronic
1119535487 14:75399640-75399662 CATGCTGTATAGAAGGAGAAAGG - Intergenic
1119895368 14:78215337-78215359 CTTCCACTGATGAAGGAGCAGGG - Intergenic
1119926332 14:78497831-78497853 CTTCCTCTGTAGGATGAGAATGG + Intronic
1120256526 14:82126727-82126749 CTTCATCTGTATAATGTGAATGG - Intergenic
1120639085 14:86987971-86987993 TTGCCTCTGTAAATGGAGAAAGG - Intergenic
1121073564 14:91047480-91047502 CATTCTTTGTAGAAGTAGAATGG - Intronic
1122138518 14:99648328-99648350 CCTCATCTGTGGAAGGGGAAAGG - Intronic
1122329746 14:100904328-100904350 CTTCCTCCCTGGAGGGAGAAGGG + Intergenic
1125421051 15:39504420-39504442 CTTCCTCTGTAAAATGAGGCTGG - Intergenic
1127524336 15:59777297-59777319 CTGCCTAAGTGGAAGGAGAATGG - Intergenic
1127830909 15:62750390-62750412 CTTCTTCTGTAGACTGTGAAGGG + Exonic
1128078860 15:64844364-64844386 CCTCCTTTGTAAAAGGAAAAGGG + Intronic
1128650169 15:69405954-69405976 CTTCCTATGCAAAATGAGAAGGG + Exonic
1130620849 15:85460757-85460779 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1131373315 15:91902746-91902768 TTTCCTCTCTAGAAGGAAAAAGG - Intronic
1131386798 15:92014759-92014781 CCTTCTCTGTGGAGGGAGAAGGG + Intronic
1132355423 15:101168039-101168061 CTTCCTCTTCAGGAGGAGGAGGG + Intergenic
1132860331 16:2067902-2067924 TTCCCTCTGCAGAAGCAGAAAGG - Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133684996 16:8158072-8158094 ATTCCTCTGAAGAGAGAGAAAGG + Intergenic
1134859247 16:17546342-17546364 CTTCATCTGCAGAAGTAGACGGG - Intergenic
1135006785 16:18831420-18831442 ATTCCTCTGTATGAGGATAAGGG + Intronic
1137563354 16:49517016-49517038 GCTCCTCTGTACAAGGAGGAAGG - Intronic
1137602275 16:49764315-49764337 CTTCCTCTGTTGATGGACACTGG - Intronic
1137910732 16:52375305-52375327 TTTCCTCTGTGGAGGGAAAAAGG + Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138812051 16:60162550-60162572 CTTCCTCTATAGGATGCGAAAGG + Intergenic
1140071134 16:71650834-71650856 CTTCATCTGTAAAATGAAAATGG + Intronic
1140335764 16:74103625-74103647 CTGGCTCTGAAGATGGAGAAAGG + Intergenic
1140749595 16:78011101-78011123 CTTCCTCTTGGGAAGGAGACAGG + Intergenic
1142152003 16:88516789-88516811 CTCTCTTTGTAGAAGGAGAAGGG + Intronic
1142252928 16:89000963-89000985 GCTCCTCGTTAGAAGGAGAAAGG - Intergenic
1142293400 16:89202835-89202857 CTTCCTCTGTTGATGGACAGTGG + Intergenic
1142862461 17:2771143-2771165 CTTCCTCTCTGGAGGGAGAGTGG + Intergenic
1142867523 17:2799765-2799787 CTGCCTCTGGAGAGGGAGGAGGG + Intronic
1143141289 17:4743286-4743308 TCACCTCTGGAGAAGGAGAAGGG - Exonic
1143164517 17:4891338-4891360 CTTCCTCCATTGAAGGACAAGGG - Intronic
1143840793 17:9730216-9730238 TTTTCTCTTAAGAAGGAGAATGG + Intergenic
1144036302 17:11369004-11369026 CTTCATCTGTAAAATGGGAATGG - Intronic
1144328051 17:14200526-14200548 CTTCCTCAGAAAATGGAGAAGGG - Intronic
1144769357 17:17750985-17751007 CCTCCTCTGTGGAAGGCGGAAGG - Intronic
1145142403 17:20456157-20456179 CGTCATCTGTAGAATGAGCATGG - Intronic
1146326540 17:31891037-31891059 TTTCCCATGTAGAAGGACAAAGG - Intronic
1146957117 17:36942347-36942369 CCACCTCCGTAGAAGGAGAAGGG - Exonic
1147145668 17:38483067-38483089 CTTTCTCTGTAGAAGGCAGAGGG + Intronic
1147259236 17:39198751-39198773 CTTTCTGTGGAGCAGGAGAAGGG - Intergenic
1148022405 17:44562174-44562196 CTCCCCCTGAAGAAGGGGAAGGG - Intergenic
1149246281 17:54712180-54712202 CTTATTCTTTAGAGGGAGAATGG - Intergenic
1150479898 17:65500698-65500720 CTTCCTCTATGGAAAGATAAAGG - Intergenic
1150666095 17:67139924-67139946 CTCCCTATGTAGCAGGAGATGGG - Intronic
1150815562 17:68389611-68389633 CTTCCTCTGAAGAAGAGGAAGGG - Intronic
1152174128 17:78775470-78775492 CTTTCTCTGTAGAGGAAGAGTGG - Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152797556 17:82315620-82315642 GTGCCTCTGAAGAAGGAGAGTGG + Intronic
1152848853 17:82619452-82619474 CTCCCTGTGTAGCAGGAGCAGGG - Intronic
1155045931 18:22103172-22103194 ATTCCTCTTAAAAAGGAGAAGGG - Intergenic
1155988016 18:32251322-32251344 ATTCCCCTCTAGAAGGTGAATGG - Intronic
1157260414 18:46171873-46171895 CTTCTTCTGTAGGAGCAGAAGGG - Intergenic
1157498342 18:48172140-48172162 GTTCCTCTGTAGTTTGAGAAAGG + Intronic
1157770250 18:50339366-50339388 CATCCTCTGTGGAAGGTGATTGG - Intergenic
1158452590 18:57580530-57580552 CTGCTCCTGTGGAAGGAGAAGGG + Intronic
1158683778 18:59594221-59594243 ATTCATTTGTAGAAGGAGGACGG - Intronic
1158689326 18:59646089-59646111 ATTCCTCTGGAGAAGGCTAATGG + Intronic
1160510027 18:79448247-79448269 CTGCCTCTGCAGGAGGAGAGGGG + Intronic
1163162799 19:15475632-15475654 CAGCCTCTGTAGAAGGACAAGGG + Exonic
1164436763 19:28237168-28237190 CCTACTCTGTAGATGCAGAAAGG + Intergenic
1164541165 19:29122501-29122523 CTTCTTCTCCAGAAGGAGAGGGG - Intergenic
1166985618 19:46658869-46658891 CTTGCTCTCAAGAAGGAAAAAGG - Intronic
1168111898 19:54197287-54197309 CTTCCTCTCTGAAAGGAGCACGG - Intergenic
1168148155 19:54430796-54430818 CAGCCTCTGCAGAAAGAGAAAGG - Exonic
1168222987 19:54974483-54974505 CTGCTTCTGAAAAAGGAGAAGGG - Exonic
1168383382 19:55942992-55943014 CTGCCTTTGAAGAAGGAGGAAGG + Intergenic
1168508146 19:56953500-56953522 CTTTCTCTGTAAAAGGAAAATGG + Intergenic
1168512714 19:56986234-56986256 CTTCCCCTGGAGAAGGACATTGG - Intergenic
926214661 2:10897235-10897257 CTCCCTCTGAAGATGGAGATGGG + Intergenic
926490070 2:13514480-13514502 CTGACTCTGTAAAAGCAGAACGG - Intergenic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
927796388 2:26052541-26052563 CTTTCTCTGGAGAAACAGAATGG - Intronic
927905863 2:26855786-26855808 CTTGCTCTGCAGAAGGACAAAGG - Intronic
928130497 2:28645684-28645706 CCTTCTCTGTAGAAAGGGAATGG - Intergenic
928883715 2:36125408-36125430 ATTCCTTTGTAGAATGTGAATGG - Intergenic
929023571 2:37577575-37577597 CTATCTCTCTAGAAGGAGGAAGG + Intergenic
930034588 2:47077520-47077542 CTTCATCTGTACAATAAGAATGG + Intronic
930530267 2:52580750-52580772 CTTACTCTGGAGCAGGGGAAGGG - Intergenic
930824171 2:55679094-55679116 CTTGTTCTGTGGAAGGAAAATGG - Intronic
930884907 2:56314391-56314413 CCTCATCTGTGGAATGAGAAGGG + Intronic
930956121 2:57204877-57204899 GTCCCTCTGTATAAAGAGAAGGG + Intergenic
931500038 2:62855451-62855473 GTTCCTGGGTAGAAGGAGGAAGG + Intronic
931523498 2:63126419-63126441 CTTCATCTGTAAAATGAGAATGG - Intronic
935196324 2:100819131-100819153 TTTCCTCTGTGGGAGGAGACAGG - Intergenic
937593461 2:123644059-123644081 CTTCATCTTTTGAAGGATAATGG + Intergenic
938231320 2:129662496-129662518 ATTCCTCTGTAAAAGGAGCCAGG + Intergenic
938906834 2:135845088-135845110 TTTCCTCTGTAGAAAGGGGAAGG + Intronic
939073293 2:137569124-137569146 CTGCCTCCGGAGATGGAGAAAGG + Intronic
939352075 2:141051638-141051660 CTTTCTCAGTTGGAGGAGAATGG - Intronic
939928946 2:148208054-148208076 CTTATTCTTTAGAAGGAGAATGG - Intronic
940041414 2:149365306-149365328 CTTTCTCTGTAAAAATAGAATGG - Intronic
940084761 2:149846803-149846825 ATTCCTCCCTAGGAGGAGAAAGG + Intergenic
940319105 2:152355944-152355966 TTTCCTCTGTAGCGGGAGAAAGG - Intronic
940997183 2:160162459-160162481 TTACCTCTGTAGAAGGACAGGGG + Intronic
941576904 2:167244091-167244113 CTGCCTCTGAAGAAGAAAAAGGG + Exonic
944977128 2:205066591-205066613 CTTCATCTGTAAAATGAGAAAGG + Intronic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
947256683 2:228173562-228173584 CTAGCTTTGTAGATGGAGAAAGG + Intronic
947531955 2:230914938-230914960 CTGACTCTGTGGAAGGAGAGAGG + Intronic
948347050 2:237307507-237307529 CTTCCTGTGTAGTAGGAGACCGG + Intergenic
948442589 2:238004885-238004907 CTCCCTCTGGAGATGGAGGAAGG + Intronic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
948664422 2:239526162-239526184 CTTCCTGGATAGGAGGAGAAGGG + Intergenic
1168760088 20:344633-344655 ATTGCACTGTAGAAGGCGAAGGG - Intergenic
1169609503 20:7363151-7363173 TTGCTTCTGAAGAAGGAGAAAGG + Intergenic
1169671187 20:8104793-8104815 CTACCTCTGTAGCAAGATAAGGG + Intergenic
1169773488 20:9226745-9226767 TTTCTTCTGTACAAGTAGAAAGG + Intronic
1170661677 20:18347480-18347502 TTTCCTCTGGAGAAGGAGGTAGG - Intergenic
1171507168 20:25646931-25646953 CTTTCTCAGTTGAAGGGGAAAGG + Intergenic
1172039014 20:32030939-32030961 CTTCCCCTGTGGAAGGGAAAGGG + Intronic
1172089174 20:32415441-32415463 TTTCCTCTGGAGTGGGAGAAGGG + Intronic
1172322184 20:34004162-34004184 CTTCCTTTGTACATGGAGGAGGG + Intronic
1172901338 20:38337028-38337050 CTGCCTCTTAGGAAGGAGAAAGG - Intronic
1173090343 20:39964620-39964642 CTCCCTCTGGAGAATGGGAATGG + Intergenic
1173325079 20:42025859-42025881 CTTCCTTTCTAGAATGGGAAGGG - Intergenic
1173745854 20:45436701-45436723 CTTCTTCTGTAAAAGGGAAATGG - Intergenic
1174174795 20:48637745-48637767 CTTCCCATCTGGAAGGAGAAGGG + Exonic
1174980012 20:55383193-55383215 AATCCTCTGTTGAAGGAGAAAGG - Intergenic
1175931909 20:62497545-62497567 CATCCTGTGTAGCAGGGGAAGGG + Intergenic
1176226756 20:64004680-64004702 CTTCCTCTGTAAAAGGGAAGAGG + Intronic
1177130680 21:17250615-17250637 ATTCCTCTAAAGAGGGAGAAAGG - Intergenic
1178149300 21:29775719-29775741 TTTCCACTGAAGAAAGAGAAAGG - Intronic
1178757702 21:35368239-35368261 CTGCCTTTGTTAAAGGAGAATGG - Intronic
1180904363 22:19398274-19398296 CTTCGTCTGTAAAAGGAGTGAGG - Intronic
1181912282 22:26248243-26248265 CTTCATCTGTAAAATGTGAATGG + Intronic
1182129503 22:27840594-27840616 GTTCCTCTGTGGGAGGGGAAGGG + Intergenic
1183080914 22:35455833-35455855 CTTCATCTGTAAAAGCCGAATGG - Intergenic
1183273298 22:36875519-36875541 CTTCTTCTGTAGAGGGAGGAGGG - Intronic
1183641955 22:39098122-39098144 CCTCCTCTGTAAGATGAGAATGG + Intronic
1183927175 22:41214569-41214591 GTGGCTCTGTAGGAGGAGAATGG + Intronic
1184093087 22:42302492-42302514 CTTCCTCTGTGAAAGGGGCATGG - Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184893531 22:47393735-47393757 CCTCCTCTGTCCAAGGAGACAGG + Intergenic
1185034849 22:48468397-48468419 CTGCCTCTGCAGAGGGTGAATGG + Intergenic
949723652 3:7019065-7019087 CTTCCTCTGGAGAGGGAGGCTGG - Intronic
949845187 3:8362539-8362561 ATTTGTCTGTTGAAGGAGAAGGG + Intergenic
952844837 3:37679556-37679578 CTTCATCTGTAAAATGTGAAGGG + Intronic
954255873 3:49405529-49405551 TTTCTTCTGTAGAAAGGGAATGG - Intronic
954663708 3:52239292-52239314 GTTCCTCTGTGGCAGGAGAGGGG + Intergenic
954757857 3:52851554-52851576 CTTCCTCTGTAAAATCACAAGGG + Intronic
955137912 3:56238333-56238355 CATCCTCTGAACAAGGAGAAGGG - Intronic
955532978 3:59893604-59893626 CTGCCTTTGTAAAAGGAAAAAGG + Intronic
955976915 3:64488761-64488783 CTTCCTCTGTAAAAGCAGCATGG + Intergenic
956042964 3:65165578-65165600 CTTCCTCTGTTTAAGAACAAAGG + Intergenic
956126587 3:66016746-66016768 CTTCATCTGTTGATGGAGATTGG - Intronic
957625510 3:82648789-82648811 GTTCCTCTGTAGAGATAGAATGG + Intergenic
957828733 3:85487459-85487481 CTGCATCTGAAGAAGAAGAAAGG + Intronic
958680217 3:97320547-97320569 ATTTCTCTGTGGAAGGAGGAAGG - Intronic
959331598 3:105012836-105012858 CTTCCTCTGTAGAAGAGCTACGG + Intergenic
959396666 3:105848384-105848406 GGTCCTGTGTAGAAGGAGAGAGG - Intronic
959412840 3:106046745-106046767 CTCCCTCTGTAGAAGCTCAAGGG - Intergenic
960384204 3:117001234-117001256 CTAGCTCTGTAGAAGGAAAAGGG + Intronic
962505151 3:136039218-136039240 TTTCCTCTGTAGAATGATGAGGG + Intronic
963633914 3:147769100-147769122 ATTCCCTTGTAGAAGTAGAAAGG - Intergenic
967125316 3:186418271-186418293 CTTCCTATGTATATGGAAAATGG - Intergenic
967305469 3:188054730-188054752 CTTCCTAGGTACAAAGAGAAGGG + Intergenic
967991550 3:195135310-195135332 CCTCCTGTGTAAAATGAGAAAGG - Intronic
969842220 4:9891030-9891052 TTGCCTCTGAAGGAGGAGAAGGG - Intronic
971423754 4:26496550-26496572 TTTCCTCTGTTCAAGGAGAAGGG - Intergenic
975570861 4:75816358-75816380 CTTCCTATGTAGAATAAGAGTGG + Intergenic
976036815 4:80833782-80833804 CTTCCTCTGTAGATGTGAAATGG + Intronic
976204956 4:82615998-82616020 CTACCTCTGCGGAAGGAGAGCGG - Intergenic
976883088 4:89954163-89954185 CTTACCCTTTAGAAGAAGAAGGG - Exonic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
979942895 4:126784919-126784941 TTTCCTCTGTAGTTGGAGAAGGG - Intergenic
980641646 4:135587556-135587578 CTTCTACTCTAGAAGGAGACAGG + Intergenic
981756485 4:148145865-148145887 GTTTCTCAGTAGAAGGAAAAGGG + Intronic
983839170 4:172435026-172435048 GCTCCTCAGTAAAAGGAGAATGG + Intronic
983893466 4:173056321-173056343 CTTTCTCAGTAGCACGAGAAGGG + Intergenic
984512510 4:180695681-180695703 CTTCTTCTGTAGTAAGAGGAGGG - Intergenic
984863609 4:184261469-184261491 CTTCCTCTGCAGAAGAGGAAAGG - Intergenic
984923042 4:184782719-184782741 CCTCCCCTGTAGAAGGAGCTAGG - Intronic
984979345 4:185263150-185263172 CTTCCACTGTTAACGGAGAAGGG + Intronic
984990332 4:185374454-185374476 TTTCTTTTGTCGAAGGAGAAAGG - Exonic
986262023 5:6155885-6155907 CTTCTTATGTAGGAGGAGAGTGG - Intergenic
986535861 5:8786292-8786314 CTTCCTCTTTTGGAGGAGACAGG - Intergenic
988102492 5:26699506-26699528 CTACCTTTGTAAATGGAGAAAGG - Intergenic
988109751 5:26803792-26803814 CTTACTCTGAAGAAGTTGAAGGG + Intergenic
988879056 5:35480693-35480715 TTTCTTCTAAAGAAGGAGAATGG - Intergenic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
989429605 5:41337193-41337215 CTTCCTCTGGCAAAGGTGAAAGG + Intronic
991362506 5:65835687-65835709 CTTCCTCTGATGAGGGAGAAAGG + Intronic
994269514 5:97760389-97760411 CTGCCTCAGTAGTGGGAGAAAGG + Intergenic
994719055 5:103359655-103359677 CTTCTTATGTAGAAAAAGAATGG - Intergenic
996241295 5:121206611-121206633 CTACCACTGGAGAAGGGGAAGGG - Intergenic
996876521 5:128246415-128246437 CTTGCTTTGAAGATGGAGAAAGG - Intergenic
997374591 5:133388214-133388236 ATTTCTCTGTAGAATGTGAAGGG + Intronic
998068672 5:139179508-139179530 CTGCTTCTGTAGAGGGAAAATGG - Intronic
998625069 5:143837154-143837176 CTTCATCAGTCGAAAGAGAAAGG - Intergenic
1000249899 5:159483952-159483974 TTTGTTCTGCAGAAGGAGAATGG + Intergenic
1002841584 6:911382-911404 CTTCCTCTGATGAAGGATCAGGG + Intergenic
1003290139 6:4773698-4773720 CTTCCACTGGCGAAGGAGATGGG - Intronic
1003366495 6:5479908-5479930 GCTCCTCAGGAGAAGGAGAAGGG + Intronic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1006831167 6:36969129-36969151 CTGCCTGTGTTGAAGCAGAAGGG + Intronic
1007783793 6:44268955-44268977 CTTCCTCTGGGCAGGGAGAATGG + Intergenic
1008783481 6:55137031-55137053 ATTCCTCTGTGGAACCAGAAAGG + Intronic
1008888744 6:56460353-56460375 ATTCCTCTTTAGGAGGTGAAGGG + Intronic
1009228893 6:61040877-61040899 CATCATATTTAGAAGGAGAAAGG - Intergenic
1009242038 6:61195722-61195744 ATTCCTCTGCAGAGAGAGAATGG - Intergenic
1010572697 6:77496914-77496936 CTGTCTCTGAAGATGGAGAAAGG - Intergenic
1011406110 6:87017254-87017276 CTTTCACTGTAGCAGGACAAAGG + Intergenic
1013075853 6:106771004-106771026 CTTCCACAGTAGCAGGAGATTGG - Intergenic
1014170720 6:118276380-118276402 CTTGCTTTGTAGAAAGAGATTGG - Intronic
1015275289 6:131377747-131377769 CTGGCTTTGAAGAAGGAGAAAGG - Intergenic
1016492565 6:144623205-144623227 CTTCATCTGTAATATGAGAAAGG + Intronic
1017224097 6:152000175-152000197 CTTCATCTGCAAAATGAGAATGG - Intronic
1017432576 6:154385484-154385506 CTTCCTCAGCAAAAGAAGAAAGG - Intronic
1017732675 6:157331473-157331495 CTTCCTCTGTAAAGTGAGGAAGG + Intergenic
1018474246 6:164124304-164124326 CTTCCTCAGTAGAATAAGACAGG + Intergenic
1018653432 6:166010081-166010103 AAACCACTGTAGAAGGAGAATGG + Intergenic
1019014059 6:168867112-168867134 GTTCCACTGTAAAGGGAGAAAGG + Intergenic
1019501413 7:1366701-1366723 CTTCCTCTGTAGAATGGGGTGGG - Intergenic
1019851677 7:3565198-3565220 CATCCGCTGTAGCAGGAAAATGG + Intronic
1020740067 7:12004748-12004770 CTTCCTCCCTAGAAGAAAAAGGG - Intergenic
1022266182 7:28757193-28757215 CCTCCTCTGTAAAATAAGAATGG - Intronic
1022612744 7:31893513-31893535 CTTTCTTTGTAGATGAAGAATGG + Intronic
1023091232 7:36619283-36619305 TTTCCTCTGTGGAAGGGGATAGG + Intronic
1023272247 7:38476762-38476784 CCTCCTCTATAAAAGGAGATTGG - Intronic
1023793491 7:43771943-43771965 TTTCCTCTGTAAAATGAAAAGGG - Intronic
1023880088 7:44313334-44313356 CTTTCTCTGAGGAAGGAAAAAGG + Intronic
1024889252 7:54182143-54182165 CTCCCTCTTTAGAGGGAGAATGG - Intergenic
1026402624 7:70030568-70030590 CTCCCTTTCAAGAAGGAGAAGGG - Intronic
1027234062 7:76287361-76287383 CTTCCTCTGAGGGAGGCGAAAGG + Intergenic
1027557713 7:79686875-79686897 CTGGCTCTGAAGATGGAGAAAGG - Intergenic
1028305379 7:89256800-89256822 TTTCCTCTGGAGGAGGAGGATGG + Intronic
1029290411 7:99498345-99498367 CTACCTCTGGAGAAGGATAGAGG + Intronic
1030680602 7:112430121-112430143 CTCCCTCTGTGGAATGAGAGTGG - Intronic
1030926682 7:115465784-115465806 CTTTCTCTGTAAAACGAGGATGG - Intergenic
1031540105 7:122985163-122985185 CTTCCTCTCTTGAAGGAGGTTGG - Intergenic
1032611741 7:133422858-133422880 CTTACTTTTTAAAAGGAGAAAGG + Intronic
1034481957 7:151328730-151328752 ATTCTTATGCAGAAGGAGAAAGG + Intergenic
1035791497 8:2309771-2309793 ATTCATCTGAAGAAGTAGAATGG + Intergenic
1035801308 8:2411934-2411956 ATTCATCTGAAGAAGTAGAATGG - Intergenic
1036408859 8:8479749-8479771 CTTCCCCTGTAAAATGAGGATGG - Intergenic
1037604562 8:20426307-20426329 CTTCCTTTTTAGAATAAGAAAGG + Intergenic
1037728895 8:21506956-21506978 TTTCCTCTGGAGAGGGAGAAAGG + Intergenic
1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG + Exonic
1038712377 8:29959527-29959549 CTTCTTTTGTAAAAGGAGAATGG - Intergenic
1040740045 8:50562422-50562444 CTGGCTCTGAAGATGGAGAAGGG + Intronic
1042652482 8:71058447-71058469 CTGGCTCTGTAGATGGAGAGTGG - Intergenic
1043528484 8:81122947-81122969 CTTTATCTGTAAAATGAGAATGG - Intergenic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1046088309 8:109466621-109466643 CTTCCTGAGTACAATGAGAAGGG - Exonic
1046501620 8:115085088-115085110 CTGACTTTGAAGAAGGAGAAAGG + Intergenic
1046798313 8:118396681-118396703 CTTCCTAAGTAGAAGTAGCATGG - Intronic
1046971314 8:120226610-120226632 CTTCCTCTGTAAACCGAGGAAGG - Exonic
1048200031 8:132364914-132364936 GTTTGTCTGTAAAAGGAGAAAGG - Intronic
1048668699 8:136693210-136693232 CTTCCTTTGTGGAGGTAGAATGG + Intergenic
1049414178 8:142487894-142487916 CTCCCTCTGTAGAAGGGGGATGG - Intronic
1051904121 9:22075671-22075693 TTTCCTCTGCAAAAGAAGAAAGG + Intergenic
1051975080 9:22939308-22939330 CTGACTCTGAAGATGGAGAAAGG + Intergenic
1056315170 9:85381359-85381381 CTTCCTCTGTAGAATACTAAGGG + Intergenic
1057556846 9:96094981-96095003 CTTCCTCTGTGGAAAGAAATGGG - Intergenic
1057956714 9:99415342-99415364 CTTCATTTGTAGAACGAGAAGGG - Intergenic
1058766499 9:108187359-108187381 AATCCTCTGTACAAGGAGGAAGG + Intergenic
1059051348 9:110930181-110930203 CATCCTATGGAGAAGAAGAAGGG - Intronic
1060375989 9:123115426-123115448 CCTCCTCTGTGCAGGGAGAAAGG - Intronic
1061704893 9:132445476-132445498 ATTCCTCTGTTGAAGGACACTGG + Intronic
1062015299 9:134288230-134288252 CTTCCTCTGGAGCAGGGGCAGGG - Intergenic
1062292982 9:135805688-135805710 CTTCCTCTATTGAAGGAGCAAGG + Intergenic
1062434607 9:136541394-136541416 CCTCCGCTGTAGAAGGGGCATGG - Intronic
1186675591 X:11814041-11814063 CTTCTCATGTAGAGGGAGAATGG - Intergenic
1187433528 X:19246557-19246579 GTTTATCTGTAGAAGGAGACAGG - Intergenic
1189298219 X:39934062-39934084 CTTCATCTGTAAAATGTGAAGGG + Intergenic
1190227606 X:48558285-48558307 CATCGTCTGTAAAATGAGAATGG + Intronic
1190516233 X:51226024-51226046 TTTCCTCTGAAAAAGAAGAATGG - Intergenic
1191185127 X:57603304-57603326 CTTTCTCTGCAGCAGGAGAGGGG + Intergenic
1191956678 X:66649874-66649896 TTTCCTTTGTAGGAGGAGAGGGG + Intergenic
1196366147 X:114926399-114926421 ATTCCTCTGTAGGGGGATAAGGG + Intergenic
1196847823 X:119910582-119910604 TTTCATCTTTTGAAGGAGAAAGG - Intronic
1196898913 X:120364185-120364207 CCTCCTCTGTGGAAGGTTAAAGG + Intronic
1197955436 X:131941805-131941827 CTTCCTTTTTAAAAGGAGTAAGG - Intergenic
1201583231 Y:15532775-15532797 CTTGCTCTGTAGAAAGATACTGG - Intergenic