ID: 1106751241

View in Genome Browser
Species Human (GRCh38)
Location 13:32770539-32770561
Sequence TGTCAAGGAGAGCACAGCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106751238_1106751241 -2 Left 1106751238 13:32770518-32770540 CCAAAAGCAAACAGCACCGAGTG 0: 1
1: 0
2: 1
3: 13
4: 119
Right 1106751241 13:32770539-32770561 TGTCAAGGAGAGCACAGCAGAGG 0: 1
1: 0
2: 2
3: 34
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106751241 Original CRISPR TGTCAAGGAGAGCACAGCAG AGG Exonic
900237896 1:1601162-1601184 AGGCAAGGAGAGCACAGGAAGGG - Intergenic
900876396 1:5345733-5345755 TTTCCCGGAGTGCACAGCAGGGG - Intergenic
901241375 1:7695711-7695733 TGCCAAAGAGAGATCAGCAGGGG + Intronic
902763840 1:18601753-18601775 GGTCCAGGAGACCACAGCTGTGG + Intergenic
903663301 1:24991811-24991833 TGCCAGGGAGGGCACAGGAGGGG - Intergenic
904492780 1:30870911-30870933 TGTCTTGGAGAGCACAGCTCTGG - Intronic
904922350 1:34018685-34018707 TATCAAGGAGTTCACACCAGAGG - Intronic
905306466 1:37022288-37022310 TATTAACGACAGCACAGCAGAGG + Intronic
905446489 1:38031161-38031183 AGGGAAGGAGAGCACAGCAGAGG - Intergenic
905474721 1:38217895-38217917 TGGCAAGGAGTCCAGAGCAGGGG + Intergenic
905768071 1:40619842-40619864 TCTCAGGGAGAGAGCAGCAGTGG + Intergenic
905912933 1:41666061-41666083 AGTCCAGGAAAGCACAGCAATGG - Intronic
906188560 1:43880611-43880633 AGTGAAGGAGAGGACAGAAGTGG - Intronic
907588936 1:55647284-55647306 TGGCATGGGGAGTACAGCAGGGG - Intergenic
907805347 1:57813473-57813495 CTTCAAGGAGCTCACAGCAGAGG + Intronic
908050865 1:60228856-60228878 TGACAATTAGCGCACAGCAGAGG - Intergenic
908784362 1:67720336-67720358 GGTCCAGCAGAGCACAGAAGGGG - Intronic
909415421 1:75400883-75400905 TGGCAAGCAGGGCACAGCAGTGG - Intronic
911650606 1:100383672-100383694 TATTAAGGAGATCACAGCACAGG - Intronic
912062087 1:105686445-105686467 TGACAAGGAGAGAAGAGCTGTGG - Intergenic
912512104 1:110196451-110196473 TTCCTAGGAGAGCACAGGAGGGG + Intronic
913068405 1:115278735-115278757 TGGCAAGCAAAGCACAGCACTGG - Intergenic
913500964 1:119472281-119472303 TGTCAAGAGGAGCAGATCAGGGG - Intergenic
913511798 1:119569054-119569076 TGTCAGGAAGGGCACATCAGTGG - Intergenic
913523244 1:119666126-119666148 TGTCAAGAGAAGGACAGCAGTGG + Intronic
914847666 1:151291770-151291792 TGTCAAGGGGGCCACAGGAGAGG + Exonic
916503689 1:165408676-165408698 TGTCTAGAAAAACACAGCAGAGG + Intronic
918719617 1:187836619-187836641 TGTCAAGAGGAGCACATCAGTGG - Intergenic
919831315 1:201542054-201542076 TGTAAAGGGGAGAAGAGCAGGGG - Intergenic
919907535 1:202088223-202088245 ACACAGGGAGAGCACAGCAGAGG + Intergenic
920724463 1:208420870-208420892 GGTGAAGGAGAGCAGAGCATGGG + Intergenic
920850680 1:209626081-209626103 TGTCAGGGAGAGCCCTGAAGAGG + Intronic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
922723897 1:227913835-227913857 TGCCCAGCAGAGCAGAGCAGCGG + Intergenic
923331184 1:232926362-232926384 TTTCAAGAAGAGAACAGAAGAGG + Intergenic
1063934972 10:11067964-11067986 TGTCAAGGATCACACAGTAGGGG + Intronic
1066251556 10:33637851-33637873 TCTCAAGGAGTGGCCAGCAGTGG + Intergenic
1066662100 10:37746880-37746902 TGGCAGGCAGAGCACATCAGCGG - Intergenic
1068130566 10:52890201-52890223 TGAGAAGGAGAGAACAGCTGTGG + Intergenic
1068392090 10:56410613-56410635 TGTAAAGGAAAGCAAACCAGAGG - Intergenic
1068443960 10:57096048-57096070 TGACAAGGAGAGAAGAGCTGTGG + Intergenic
1069354585 10:67569563-67569585 TGTGAAGGAGAGCAGAGCCATGG - Intronic
1070665061 10:78336887-78336909 TGTCAAGGCTAGCACATGAGGGG - Intergenic
1071260926 10:83918356-83918378 TCTCAAGGTGTGCACTGCAGAGG - Intergenic
1072019299 10:91382603-91382625 GAACAAGTAGAGCACAGCAGGGG - Intergenic
1074844321 10:117383770-117383792 TCTCAAGAAGAGCTCAGAAGGGG - Intergenic
1076115254 10:127891126-127891148 TGTCAAGGAGAGCCCTGAAGGGG - Intronic
1076218457 10:128714427-128714449 TGGCAAGAAGGGCCCAGCAGAGG + Intergenic
1077017914 11:405052-405074 GGACATGGAGAGCCCAGCAGAGG + Intergenic
1077455780 11:2679251-2679273 AGTAAAGGAGAGCACAGCCAAGG - Intronic
1078110806 11:8390265-8390287 TGTCTAGGACAGCACAGCGCAGG - Intergenic
1078348738 11:10574795-10574817 AGTCAAGGAGAGCACAGCTCTGG + Exonic
1078357506 11:10643274-10643296 TGTCCAGCAGAACTCAGCAGAGG - Intronic
1080077417 11:28167349-28167371 AATCAAGGAAAGCTCAGCAGTGG + Intronic
1083158576 11:60840847-60840869 AGTCAAGGAGACCCCTGCAGGGG - Intergenic
1083749347 11:64752840-64752862 TGTGGAGGTGAACACAGCAGAGG - Intronic
1083859506 11:65412344-65412366 TGGGAAGGAGCGCACAGCAGAGG - Exonic
1083975806 11:66118998-66119020 TGTCAGGGAAAACACAGAAGTGG + Intronic
1084427672 11:69094430-69094452 TGTCCAGCTGGGCACAGCAGGGG + Intergenic
1084492312 11:69485581-69485603 TGGCAAGGGGAGCACAGGTGGGG + Intergenic
1087304489 11:96472825-96472847 TGTCCAGGGGAGGGCAGCAGGGG - Intronic
1087866258 11:103230115-103230137 TCTAGAGGAGAGTACAGCAGGGG - Intronic
1087919567 11:103850651-103850673 TATCAAGGAATGCACACCAGGGG + Intergenic
1088026748 11:105194282-105194304 TGTTAAGAAAAGCACAGCATTGG - Intergenic
1088531739 11:110818029-110818051 TGGCAAGGACAGGACAGGAGTGG + Intergenic
1089095389 11:115915979-115916001 TGTGTAGGAGAACACAGGAGGGG + Intergenic
1089178990 11:116567893-116567915 GGTGAAGGAGAGCAGAGGAGAGG - Intergenic
1089440999 11:118516836-118516858 TCTTAAGGAGCTCACAGCAGAGG - Intronic
1089614156 11:119685776-119685798 TGTCCAGGTGAGCAGAGCAAAGG - Intronic
1089787447 11:120918173-120918195 TGGGAAGGAGAGCAAGGCAGAGG - Intronic
1090260291 11:125314507-125314529 TGACATGCAGAGCACACCAGAGG - Intronic
1090440213 11:126719072-126719094 TGTAAAAGAGAACACAGCAAAGG - Intronic
1090493749 11:127190006-127190028 TGTAAAGGAGTGCACAACAAAGG + Intergenic
1091409048 12:227327-227349 TGGCTGGGAGACCACAGCAGGGG - Intronic
1093140717 12:15507559-15507581 TGTCTAGGACATCACAGTAGTGG - Intronic
1093378099 12:18456085-18456107 TCTCAAGAAGAGCTCAGCAAAGG + Intronic
1094408543 12:30145583-30145605 TGTCAAGGAGAATAAAGAAGTGG + Intergenic
1096163446 12:49400360-49400382 TGTGAAGGAGAGCAGAGAAATGG + Intronic
1096585854 12:52619112-52619134 TGCCTGGGAGGGCACAGCAGGGG - Intergenic
1096597091 12:52702876-52702898 TGACAAGGTGAGCACCTCAGGGG - Exonic
1096785939 12:54017464-54017486 TTTCAAGAATAGGACAGCAGCGG + Intronic
1098033547 12:66279320-66279342 TGACCAGCAGAGGACAGCAGAGG + Intergenic
1098079095 12:66764807-66764829 TCTGTAGGAGAACACAGCAGTGG - Intronic
1099160821 12:79239748-79239770 TGTCAACTAGACCACAGAAGAGG + Intronic
1100557073 12:95705674-95705696 TGTGGAGGGGAGCACATCAGAGG - Intronic
1100641263 12:96484272-96484294 CGTCAAAGAGAGCACGCCAGCGG + Intergenic
1100910527 12:99356201-99356223 TGTCAGGGAGGGCACAGCCATGG + Intronic
1103796408 12:123506201-123506223 TGGCAAGGACAGCGCAGCACAGG + Intronic
1104772125 12:131370024-131370046 TGTCAGGCAGAGCAGGGCAGGGG + Intergenic
1106416011 13:29546492-29546514 TGCAAACGAGAGCAAAGCAGAGG + Intronic
1106647738 13:31654865-31654887 TGTTAAGGAGAGCCCAATAGGGG + Intergenic
1106751241 13:32770539-32770561 TGTCAAGGAGAGCACAGCAGAGG + Exonic
1109140754 13:58711890-58711912 TGTCGAGAAGAGCACAACAATGG + Intergenic
1112589398 13:100749757-100749779 TGTCAGGGAGATCAAAGTAGAGG - Intergenic
1112615195 13:100997384-100997406 TCACAGGGAGAGCACAGGAGAGG - Intergenic
1113606016 13:111606729-111606751 TGCCAAGGAGAGGAAAGGAGAGG - Intronic
1113860880 13:113485861-113485883 TCTCACAGAGTGCACAGCAGAGG + Intronic
1116326317 14:43536452-43536474 GGTCAATGGGTGCACAGCAGGGG + Intergenic
1117371115 14:55079208-55079230 AGTCAAGGAAAGCTCACCAGAGG + Intergenic
1117498942 14:56332682-56332704 TTTTAAGGACAGCAGAGCAGAGG - Intergenic
1117756444 14:58979283-58979305 TGCCATAGAGAGCAGAGCAGGGG - Intergenic
1118035094 14:61858026-61858048 TGTTACGGAGAACACAACAGTGG - Intergenic
1119147882 14:72333026-72333048 TGGTATGGAGAACACAGCAGTGG + Intronic
1120744664 14:88142692-88142714 AGTCAAGAGGAGCACATCAGCGG + Intergenic
1121855773 14:97268923-97268945 TTTCCATGAGAGCACAGAAGCGG - Intergenic
1122022001 14:98845791-98845813 CGTCTAGGAAAGGACAGCAGAGG + Intergenic
1122200035 14:100116986-100117008 CGTCCAGGAGAGCACAGCCAAGG + Intronic
1122325618 14:100879427-100879449 TGTCAAAGAGAGGACAGAAGAGG - Intergenic
1122810306 14:104284468-104284490 TGTCCAGCAGAGCTCAGCAGGGG + Intergenic
1125751515 15:42032472-42032494 TGACAAGGACAGCACAGCTGAGG + Intronic
1127727718 15:61766645-61766667 TGCTAAGGAGGGAACAGCAGTGG - Intergenic
1128237777 15:66079412-66079434 TGCAGAGGAGAGCCCAGCAGTGG + Intronic
1128914129 15:71544164-71544186 TGTCAAGGAGTCCAGAGCAATGG + Intronic
1129522813 15:76196444-76196466 GGTCAAGGAGAGATCAGCTGGGG - Intronic
1129523989 15:76202587-76202609 TGTCAAGGTGGGCACAGTGGAGG + Intronic
1129654903 15:77517542-77517564 TGTCAGGGAGAGGAAAACAGAGG + Intergenic
1133420962 16:5646588-5646610 TGTCAGGGAGGGCATGGCAGGGG + Intergenic
1133711256 16:8403362-8403384 TGGGATGCAGAGCACAGCAGAGG + Intergenic
1133969652 16:10558676-10558698 TATGAAGAAGAGGACAGCAGTGG - Intronic
1133975353 16:10596381-10596403 TGGAAAGGAGCGCACAGCTGTGG - Intergenic
1137496129 16:48970669-48970691 AGTCACAGAGAGCACTGCAGGGG - Intergenic
1138363841 16:56455937-56455959 TGTCAAGAGAAGCACAGCAATGG - Intronic
1138450009 16:57088116-57088138 TGGGAAGGAGAGAACAGTAGAGG + Intergenic
1138582239 16:57949171-57949193 GGTCATGATGAGCACAGCAGGGG + Intronic
1139798350 16:69500761-69500783 TGTCAAAGACAGGACAGGAGAGG - Intergenic
1141329307 16:83094245-83094267 TGACAAAGAGGGCAAAGCAGGGG - Intronic
1141681146 16:85544739-85544761 TGTCCAGCAGACCCCAGCAGCGG + Intergenic
1142306075 16:89286420-89286442 TCTGAAGGAGAGCACAGGAGGGG - Intronic
1142381114 16:89732760-89732782 GGTCAGGGTGAACACAGCAGAGG - Intronic
1142381132 16:89732849-89732871 GGTCAGGGCGAGCACAGCAGAGG - Intronic
1142381161 16:89732967-89732989 GGTCAGGGCGAACACAGCAGAGG - Intronic
1142407849 16:89901097-89901119 TGGGGAGGAGAGCAAAGCAGGGG + Intronic
1143288167 17:5807629-5807651 TGTACAGGAGAGGACAGGAGAGG + Intronic
1143292102 17:5839109-5839131 TGGCCAGGAGAGTGCAGCAGAGG + Intronic
1143408887 17:6696643-6696665 TGTAAAGGGGAGCTCAGCTGTGG + Intronic
1146714228 17:35070713-35070735 TGTCAAGGAAACCATGGCAGGGG + Intronic
1147697596 17:42367662-42367684 TGTAAAGGAGAATTCAGCAGGGG - Intronic
1147732143 17:42610399-42610421 TGTCAAGGGGAGTCCAGGAGGGG - Intronic
1147739102 17:42660125-42660147 TGTCAAGGGGAGTCCAGGAGGGG - Intronic
1148469524 17:47884598-47884620 AGACAAGGAATGCACAGCAGTGG + Intergenic
1148690987 17:49526814-49526836 TGTACAGGAGAGCAGACCAGAGG - Intergenic
1149542688 17:57479622-57479644 TCTCAAGTAAAGCAAAGCAGCGG + Intronic
1150596771 17:66613253-66613275 AGTCAAGGACATCCCAGCAGTGG + Intronic
1150915798 17:69435604-69435626 TTTCAAGGAAAGAACAGCATTGG + Intronic
1151435874 17:74097105-74097127 TGTCAAGAAAAGCAGAGCACTGG + Intergenic
1152082498 17:78196952-78196974 TCTCTAGGAGAGGACAGCTGGGG - Intronic
1154390682 18:13933909-13933931 TGGCAAGGAGAGCACAGCCATGG - Intergenic
1155364251 18:25034458-25034480 GGTCTAAAAGAGCACAGCAGTGG + Intergenic
1156432823 18:37093943-37093965 TGTCAAGGGAAACAGAGCAGCGG + Intronic
1158474858 18:57770789-57770811 TGTTAAGGACAGAACAGCAAAGG + Intronic
1158624134 18:59057096-59057118 TGCCAAGGTGATCAGAGCAGTGG - Intergenic
1158668671 18:59455395-59455417 CTTCAAAGGGAGCACAGCAGTGG + Intronic
1159161271 18:64646242-64646264 TGAGAAGGAGAGAACAGCTGTGG - Intergenic
1159750627 18:72296722-72296744 TGTCAAGAAGAGATGAGCAGGGG + Intergenic
1160390143 18:78523833-78523855 TGTCAAGATGAAGACAGCAGAGG - Intergenic
1163731050 19:18949323-18949345 AGTATAGGAGTGCACAGCAGGGG + Intergenic
1164779802 19:30883206-30883228 TGCCAAGGAGAGCACGGGTGAGG + Intergenic
1165239339 19:34451910-34451932 TGTTAAACAGAGCACAGTAGAGG + Intronic
1166283434 19:41809812-41809834 TGTTAGGGGGAGCCCAGCAGAGG - Intronic
1166542002 19:43611745-43611767 TGTGATGGAGAGCAGTGCAGGGG - Intronic
1166998423 19:46730875-46730897 TGCCAAAGACAGCAGAGCAGAGG + Intronic
1167703116 19:51062590-51062612 TGGCATTGAAAGCACAGCAGGGG + Intronic
1168413077 19:56151965-56151987 TGAGAAGGAGAGGACAGCCGAGG + Intronic
925792901 2:7510812-7510834 TGTTGAGGAGGGCACAGCTGTGG - Intergenic
927594265 2:24383052-24383074 TCTCAAGTAGGGTACAGCAGTGG - Intergenic
927740910 2:25568931-25568953 TGTCCAGGAGAGCATGGCCGAGG - Intronic
935268781 2:101416072-101416094 TGTGAATGACTGCACAGCAGTGG + Intronic
936049364 2:109211570-109211592 CGTGCTGGAGAGCACAGCAGTGG + Intronic
937116401 2:119407873-119407895 TGTCAGGCAGAGGCCAGCAGAGG + Intergenic
937249349 2:120513772-120513794 TGTCAAGGAGAGAAAAGGAAGGG - Intergenic
937771661 2:125727223-125727245 CGTCAAGAAGAGCACATCAGCGG + Intergenic
939778343 2:146413311-146413333 TGTCAAGAGGAACACACCAGCGG - Intergenic
940962525 2:159801158-159801180 TGGCCAGGTGAGCACACCAGGGG - Intronic
944681023 2:202076850-202076872 TGTGATGCAGAGCAGAGCAGGGG - Intronic
946023694 2:216659177-216659199 TGTCAAGGCGTGCCCAGCATAGG - Intronic
946191734 2:218011163-218011185 TGTTCAGCTGAGCACAGCAGAGG - Intergenic
946579742 2:221115453-221115475 TGTGAAAGAGAGCACAGCCCTGG - Intergenic
946987215 2:225286690-225286712 TGTCAAGAGGAGCACAGCTGGGG + Intergenic
948281823 2:236752893-236752915 AGCCAAGGAGAAGACAGCAGAGG - Intergenic
1168820833 20:772827-772849 TGTCAAGGAGAGGACATGAAGGG + Intergenic
1170334136 20:15249356-15249378 TCTCAAGGAGACCAGTGCAGTGG - Intronic
1170520231 20:17177635-17177657 TGTGAAGGACAACACAGCAGGGG + Intergenic
1170589862 20:17763617-17763639 TGTCCAGGAGAGAATTGCAGGGG - Intergenic
1171986870 20:31666701-31666723 TGACAAGAAGAGCAGGGCAGAGG + Intronic
1172104783 20:32510469-32510491 TGTCAAGGAGACCAGTGCACAGG + Intronic
1172644754 20:36462332-36462354 GGGCAGGGAGAGCAAAGCAGGGG - Intronic
1173312956 20:41916754-41916776 TGTCAAGGAGCGAACTGCTGCGG - Intergenic
1176254358 20:64143224-64143246 TGGTCAGGAGAGCCCAGCAGGGG - Intergenic
1177886333 21:26750283-26750305 TGTCAAGCTGAGAACAGCACCGG - Intergenic
1178439102 21:32584205-32584227 TGTCATGGAGAAGACAGCTGTGG - Exonic
1180065038 21:45408101-45408123 TGTAAATGAAAGCAGAGCAGGGG + Intronic
1181054777 22:20255701-20255723 TGACAAGGAGGGGACAGGAGCGG - Intronic
1182762104 22:32731013-32731035 TGTCATGGAGAGAAAAGCACAGG - Intronic
1182943374 22:34299660-34299682 TGTCATGGAGTGCACAGGAATGG - Intergenic
1184970892 22:48019141-48019163 TGCCAGGGTGAGCACAGGAGAGG + Intergenic
1185126089 22:49011644-49011666 GGTCAAGGAGAAGCCAGCAGAGG - Intergenic
949341398 3:3034680-3034702 TCTCCAGGAGAGCTGAGCAGTGG - Exonic
950441532 3:13013618-13013640 TGTGAAGGAGAGTAGGGCAGAGG - Intronic
950665324 3:14491813-14491835 GGTGAGGGACAGCACAGCAGAGG - Exonic
950770732 3:15308762-15308784 TGGCAAGTAGAGAATAGCAGAGG - Intronic
952173316 3:30833864-30833886 TCACAAGGAGAGCACAGCACTGG + Exonic
954367115 3:50152078-50152100 TGTCAAGGAGAGCACAGGGTGGG + Intergenic
955111819 3:55957926-55957948 TGAGAAGGAGAGAACAGCTGCGG - Intronic
955683430 3:61526407-61526429 TTTCCAGGTGAGCACAACAGCGG + Intergenic
956567720 3:70658061-70658083 GGACAAGGAGAGCGAAGCAGAGG + Intergenic
957797133 3:85024220-85024242 TGTCATGGAGAGCCCAACACTGG + Intronic
958678017 3:97292287-97292309 TGACAAGGAGAGAAGAGCTGTGG - Intronic
959371725 3:105535414-105535436 TTACAAGGAAAGCACAGCAATGG - Intronic
959892084 3:111568504-111568526 TTTCAAGGAGAGAAAAGTAGTGG - Intronic
961510017 3:127395167-127395189 CGTCGTGGGGAGCACAGCAGAGG - Intergenic
962703280 3:138019597-138019619 TTTCAAGAAGGGCTCAGCAGAGG - Intronic
963074792 3:141335702-141335724 TGTCATGGAGAGTTCAGCAGAGG - Intronic
963744192 3:149109639-149109661 TGTGCAGGAGCCCACAGCAGGGG - Intergenic
964223174 3:154368971-154368993 GGTCAATGGGCGCACAGCAGGGG + Intronic
964310510 3:155386843-155386865 TCTCAAGGAGAGCACCAGAGGGG - Intronic
964517583 3:157529661-157529683 TGTCATGGAGTGCACAGAATGGG + Intronic
964812600 3:160682006-160682028 TGCAAAGCAGAACACAGCAGAGG - Intergenic
966836974 3:184056785-184056807 CCAGAAGGAGAGCACAGCAGGGG + Intronic
966974824 3:185074403-185074425 GGTCACGGAGAGGCCAGCAGCGG - Intergenic
968958031 4:3728867-3728889 AGTCAGGCAGAGCCCAGCAGCGG - Intergenic
969207430 4:5657249-5657271 GTTCAAGGTGAGGACAGCAGAGG - Intronic
971007494 4:22391507-22391529 TGTCAGGGAGAACACAGAAGAGG - Intronic
974968891 4:68801791-68801813 GGTCAATGGGCGCACAGCAGGGG + Intergenic
975909270 4:79248461-79248483 TGTCAATGGTGGCACAGCAGGGG - Intronic
976489960 4:85658876-85658898 GGTCAAGGTGAGAGCAGCAGAGG + Intronic
976681497 4:87761099-87761121 TGTCAACGAGAGGTCAGAAGGGG - Intergenic
977472211 4:97455421-97455443 TGTCAAGAGGAACACAACAGTGG + Intronic
978918637 4:114154386-114154408 GGGCAAGGTGAGTACAGCAGAGG - Intergenic
979859489 4:125676286-125676308 TGTCGAGAAGAACACACCAGCGG + Intergenic
980683009 4:136187895-136187917 ACTCAAGGAGAGCACAGCAATGG - Intergenic
980846357 4:138329897-138329919 GGACAAGGAGAGCACAGCAGAGG - Intergenic
983433675 4:167683668-167683690 TGTCAGGGAGGGAACAGCTGTGG - Intergenic
985469683 5:32333-32355 TCCCACGGAGATCACAGCAGAGG - Intergenic
985512124 5:318817-318839 TGGCCAGGAGAGGACAGGAGGGG + Intronic
985872846 5:2570951-2570973 GGTAACGGAGAGCGCAGCAGCGG - Intergenic
985996255 5:3598903-3598925 TCTCCAGAAGAGCACAACAGAGG - Intronic
986004618 5:3657545-3657567 TGTCAGGGAGAGCCCTGCAGGGG + Intergenic
988139475 5:27217736-27217758 TGTCAAGAGGAGCACAACAGAGG + Intergenic
988642689 5:33058853-33058875 TGACAAGGAGACCCCAGGAGAGG + Intergenic
992489081 5:77223593-77223615 TGACAAGCATAGCACAGTAGTGG + Intronic
995022274 5:107380238-107380260 TACCAAGGAGAGGACCGCAGTGG - Exonic
996569147 5:124913272-124913294 CGTCAAGAGGAGCACATCAGTGG - Intergenic
998349256 5:141490314-141490336 TGTCCTAGAGAGCACACCAGTGG + Exonic
1000133304 5:158320546-158320568 TGTGAAGGAGAGAGCAGAAGAGG - Intergenic
1000915041 5:167071439-167071461 TGGCAAGCAGAGCCCAGCAAAGG - Intergenic
1003628314 6:7764047-7764069 TGCCAGTGAGAGCGCAGCAGGGG + Intronic
1003955861 6:11164597-11164619 TGTCTGTGAGAACACAGCAGTGG + Intergenic
1004415562 6:15421048-15421070 TGTAAGGCAGAGCACAGCAGAGG - Intronic
1005825396 6:29628800-29628822 TGTCAGGCAGAGCCCAGCAGAGG - Intronic
1006176903 6:32127989-32128011 TCTGAAGGAGAGCGGAGCAGGGG - Intronic
1006510305 6:34517751-34517773 TGTAAAGGAAAGCAAGGCAGGGG - Intronic
1007073567 6:39053140-39053162 TGACCAGGAGAGCAAAGCAGCGG - Intronic
1007307554 6:40918768-40918790 TGTCAAGGGGAGCACATCGGTGG + Intergenic
1010971476 6:82267430-82267452 TGTCAATGGCAGAACAGCAGAGG - Intergenic
1011448450 6:87468023-87468045 TGACAAGGATAGTAAAGCAGAGG + Intronic
1011768995 6:90654869-90654891 GCTCAAGGAGAGCCCAACAGGGG - Intergenic
1012375219 6:98554120-98554142 TGTCAAGGACAGCACAGGAGAGG + Intergenic
1012678679 6:102151372-102151394 AGTCAAGGAAAGCATAACAGGGG + Intergenic
1013616833 6:111851156-111851178 AGTCTAGTAGAGGACAGCAGAGG + Intronic
1013750733 6:113402821-113402843 CCCCAAGGGGAGCACAGCAGAGG + Intergenic
1014247274 6:119081854-119081876 TGCCAAGAGGAGCACATCAGTGG - Intronic
1014247283 6:119081942-119081964 TGTCAAGAGGAGCACATCAGTGG - Intronic
1014662744 6:124193569-124193591 TGACAAGGAGAGAAGAGCTGCGG - Intronic
1014817697 6:125953397-125953419 TGTGAAGGAGAGAAGAGCTGTGG + Intergenic
1015188325 6:130444544-130444566 CTTCCAGGAGAGCAGAGCAGTGG + Intergenic
1015986106 6:138885586-138885608 TCTGAGGGAGAGCACAGCAGGGG + Intronic
1016020971 6:139235845-139235867 TGTCAAGAGGAACACATCAGCGG + Intergenic
1016020975 6:139235889-139235911 TGTCAAGAAGAGCAGAGGAGCGG + Intergenic
1017941522 6:159057540-159057562 AGTCAAGCAGACCACTGCAGGGG - Intergenic
1018992845 6:168687173-168687195 TGGGGAGGGGAGCACAGCAGGGG - Intergenic
1020368370 7:7404683-7404705 AATCAAGGAGAGCACGGTAGGGG - Intronic
1021550589 7:21867343-21867365 TGTAAAGTAGAGTTCAGCAGAGG - Intronic
1022385120 7:29892267-29892289 TGGCAAGGAGAGCAGAGCCAAGG + Intronic
1023911255 7:44558489-44558511 TGTCAAGGAAAGGAAAGGAGAGG - Intergenic
1024148087 7:46537319-46537341 TGTGAAGGAGATCTCTGCAGGGG + Intergenic
1024244548 7:47459458-47459480 TGTCCCAGAGAACACAGCAGAGG + Intronic
1026330034 7:69344015-69344037 TGGCAAGGAGAGGAAAGGAGAGG - Intergenic
1026831900 7:73615506-73615528 TGTGAAGCTGGGCACAGCAGAGG - Intronic
1027419642 7:78006560-78006582 AGTCAAGGACACCATAGCAGGGG - Intergenic
1028730822 7:94146712-94146734 TGTCAAGGCAGGCCCAGCAGAGG - Intergenic
1029588976 7:101494707-101494729 AGTCAAGGAAGCCACAGCAGGGG + Intronic
1029992290 7:104973331-104973353 TGTCAAAAACAGCACACCAGTGG - Intergenic
1030107818 7:106001317-106001339 TCAGAGGGAGAGCACAGCAGTGG - Intronic
1032346907 7:131124825-131124847 GTTTGAGGAGAGCACAGCAGGGG - Intronic
1033140536 7:138822440-138822462 TGTCAACTAGAGCACAGGATAGG + Intronic
1034416764 7:150969392-150969414 TGCCACAGAGAGCACAGCTGAGG - Intronic
1034762644 7:153687480-153687502 TGGCAAGGAGGGAACTGCAGAGG + Intergenic
1035636693 8:1152589-1152611 TGTCATGGGGGGCCCAGCAGGGG + Intergenic
1037418270 8:18674590-18674612 AGTCTAAGAGATCACAGCAGGGG + Intronic
1037858528 8:22388605-22388627 TGGCCAGGAGGGAACAGCAGGGG + Intronic
1038042160 8:23732785-23732807 TGACCAGTAGAGTACAGCAGAGG - Intergenic
1041600319 8:59710138-59710160 TCTCAACAAGAGCACAGCATTGG + Intergenic
1041935346 8:63326409-63326431 TGTCAAGAGGGGCACATCAGTGG + Intergenic
1045233459 8:100328314-100328336 TGCCAGGGAGAGGTCAGCAGTGG + Intronic
1046250501 8:111624479-111624501 TGTCTAGAGGAGCACATCAGCGG - Intergenic
1046804313 8:118463391-118463413 AATCACAGAGAGCACAGCAGTGG + Intronic
1047509282 8:125504085-125504107 TGCCAAAAAGAGCACAGAAGCGG + Intergenic
1047983461 8:130208033-130208055 TATCAAGGAGAGAAAAGTAGGGG - Intronic
1048365393 8:133733675-133733697 TGTTACTGAGAGCAGAGCAGAGG - Intergenic
1048872455 8:138810727-138810749 TGTGAAGGAGAACAGAGGAGAGG + Intronic
1049104230 8:140601368-140601390 TGTTGAGGCGAGCACAGCGGCGG - Intronic
1050043589 9:1520916-1520938 TGTCGAGAGGAGCACATCAGTGG + Intergenic
1050078041 9:1884956-1884978 TGTCAAGCACAGTACTGCAGGGG + Intergenic
1052134925 9:24897893-24897915 TGTCAAGAGAAGCACATCAGCGG + Intergenic
1052242660 9:26293162-26293184 TGTGGAGATGAGCACAGCAGGGG - Intergenic
1053398261 9:37795257-37795279 TGGCAAGGTGAGCAGAGGAGAGG - Intronic
1055230550 9:74059111-74059133 TGTGAAGGAGACCATAGCAAAGG - Intergenic
1056543718 9:87595723-87595745 GGCCAAGGAGAGCAGAGGAGAGG - Intronic
1057223512 9:93270987-93271009 TATCATGGAGAGCACAGAAAAGG + Intronic
1059047171 9:110881487-110881509 TGTTAAGGAGAGTACACCAGAGG - Intronic
1059662882 9:116419250-116419272 TGTCCAGCAGAGCACACCTGTGG + Intergenic
1061631386 9:131874351-131874373 CCTCAAGGAGAGCACAGCTTGGG - Intronic
1061886137 9:133591919-133591941 TGGAAAGGAGAGGACAGCGGGGG - Intergenic
1062013105 9:134277411-134277433 TGCCTAGGAGAGCCCAGCAGAGG - Intergenic
1062265230 9:135683825-135683847 GGCCAAGGTGAGCACAGCATGGG + Intergenic
1062272532 9:135716334-135716356 TGTTCAGGAGTGGACAGCAGAGG + Intronic
1187280053 X:17851514-17851536 TGTCAAGGAAAGCACAGAATAGG - Intronic
1188244018 X:27820034-27820056 ATTCAAGGAGAGGACAGCATTGG + Intronic
1191876994 X:65807353-65807375 TGTCAACCAGAGAACATCAGTGG - Intergenic
1195509013 X:105692996-105693018 GGCCCAGGAGAGAACAGCAGAGG - Intronic
1197231862 X:124014019-124014041 TGTCAAGGTGATCACAGTTGTGG + Intronic
1197761395 X:130030820-130030842 TCTCCAGGAGAACACTGCAGCGG - Intronic
1197838103 X:130716602-130716624 TGTCATGGAGGTCACAGCCGTGG - Intronic
1198386632 X:136135127-136135149 TGTCGAGGGGAGCACGCCAGTGG - Intergenic
1199575871 X:149313015-149313037 TGGCAAGGAGGGCACAGCTGTGG + Intergenic
1199674948 X:150180808-150180830 CCTCAAGGTGAGAACAGCAGTGG + Intergenic
1200307751 X:155045707-155045729 TGTAAAGGAGAGCACAGAAAAGG + Intronic