ID: 1106751701

View in Genome Browser
Species Human (GRCh38)
Location 13:32778169-32778191
Sequence CTTCTCATGCAAAATGTTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106751698_1106751701 -5 Left 1106751698 13:32778151-32778173 CCAAACCTTTTGTTTAAACTTCT 0: 1
1: 0
2: 2
3: 32
4: 363
Right 1106751701 13:32778169-32778191 CTTCTCATGCAAAATGTTGGCGG 0: 1
1: 0
2: 0
3: 11
4: 223
1106751699_1106751701 -10 Left 1106751699 13:32778156-32778178 CCTTTTGTTTAAACTTCTCATGC 0: 1
1: 0
2: 4
3: 22
4: 242
Right 1106751701 13:32778169-32778191 CTTCTCATGCAAAATGTTGGCGG 0: 1
1: 0
2: 0
3: 11
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106751701 Original CRISPR CTTCTCATGCAAAATGTTGG CGG Intergenic
901730646 1:11276850-11276872 CTTATAATAAAAAATGTTGGGGG - Intronic
902129935 1:14251431-14251453 CTTCTCTTCCCAAATGATGGTGG - Intergenic
904104485 1:28067523-28067545 TTTCTAATGGAAAAAGTTGGGGG - Intronic
904496999 1:30892671-30892693 CTAGTCATGGTAAATGTTGGGGG - Intronic
906672672 1:47667940-47667962 CTTCTCATGTAAAATGAAGCTGG + Intergenic
907506928 1:54925938-54925960 CTTCTGCTGCAAAATGAGGGGGG - Intergenic
907699260 1:56767255-56767277 CTTCTCATGTAAAAAGATGAGGG - Intronic
908413158 1:63886632-63886654 CTTCTCCTTCAGAATGTTGAAGG + Intronic
909253955 1:73394019-73394041 CTTGCCATGTAAAATTTTGGGGG + Intergenic
909276150 1:73689530-73689552 CTTCTCAAGGAATATGTTTGTGG + Intergenic
909561750 1:77015828-77015850 CTTCACAGGCAAAAGGTTAGAGG + Intronic
910657797 1:89635464-89635486 CTTCTTATGTAAAATGTGGATGG - Intronic
911464518 1:98234580-98234602 CTTCTCATGGAATATGTTACTGG - Intergenic
911781653 1:101886965-101886987 CTTCTCTTGAAAAATCTTGAGGG + Intronic
913577181 1:120188088-120188110 ATTCACATGCAAAATGATGATGG + Intergenic
914287074 1:146236881-146236903 CCTCACATTTAAAATGTTGGTGG - Intergenic
914548106 1:148687623-148687645 CCTCACATTTAAAATGTTGGTGG - Intergenic
914559094 1:148799523-148799545 ATTCACATGCAAAATGATGATGG + Intergenic
914613739 1:149330706-149330728 ATTCACATGCAAAATGATGATGG - Intergenic
915096626 1:153467068-153467090 CTTCTGATGCCAAATGTGTGGGG - Intergenic
916614685 1:166427946-166427968 CTTCTCAAGGAATATCTTGGTGG + Intergenic
916808847 1:168287308-168287330 TGACTCATGCAAAATGTTAGAGG - Intronic
918639321 1:186819870-186819892 CTGCTTATGCAAAATGGTGAAGG + Intergenic
919473497 1:198007922-198007944 CTTCTCATTCATCATGTTTGAGG + Intergenic
922844005 1:228668550-228668572 CTTCTGATGCCAAATGTGTGTGG - Intergenic
923630667 1:235648044-235648066 TTTCTCATGCAAACTGATGGTGG - Intronic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
1063555336 10:7073994-7074016 TTTCTCCTGCATCATGTTGGTGG - Intergenic
1064152204 10:12874476-12874498 CTTCTGATGCAAAAAGATGGAGG - Intergenic
1066133660 10:32420169-32420191 CTTCTCTTTCAAAATTTTGCTGG + Intergenic
1066554176 10:36593037-36593059 CAGCTCATCCAAATTGTTGGTGG - Intergenic
1068369448 10:56094523-56094545 CTTCTCATGGAATATCTTAGTGG + Intergenic
1075075488 10:119347719-119347741 CTTCTCATGCACGATGTGCGGGG - Intronic
1077980612 11:7296419-7296441 CTTCTTATTCAAGATGTTGCAGG + Intronic
1078321762 11:10341264-10341286 CTTCTCATGGAGTATGTTTGTGG - Intronic
1082139491 11:48591624-48591646 CTTCACTTGCAATATCTTGGAGG + Intergenic
1087056749 11:93944490-93944512 CCTCACATTTAAAATGTTGGTGG + Intergenic
1087624300 11:100579261-100579283 CTTCGCATGCAAACTGTTTAAGG + Intergenic
1087631194 11:100652519-100652541 CCTGTCCTGCATAATGTTGGTGG - Intergenic
1088543484 11:110937180-110937202 GTTCTCATGCTCAATGTTGAAGG + Intergenic
1092587870 12:9919426-9919448 CCTCTCCTGCAACTTGTTGGAGG + Intronic
1095267051 12:40172766-40172788 CATCTCATGGAAAATGTTAAAGG + Intergenic
1096653282 12:53072898-53072920 CTTTTCATTCAAAGTGTTGTGGG - Intronic
1097515647 12:60602000-60602022 TTTCTAATGTGAAATGTTGGAGG + Intergenic
1097702538 12:62834852-62834874 CTTCCCAAGCAACATGTTTGGGG + Intronic
1097978216 12:65710221-65710243 CTTCTATTGCACCATGTTGGTGG + Intergenic
1098193449 12:67975501-67975523 CTTCTCATGGAATATCTTAGTGG + Intergenic
1099086835 12:78256644-78256666 CTTCTCAAGGAATATGTTTGTGG + Intergenic
1104161325 12:126183647-126183669 ATTCCCAAGCAAAATGTTGAAGG + Intergenic
1104714568 12:131007718-131007740 CTGCTCATGGAACATGTTGTGGG - Intronic
1104732102 12:131112960-131112982 CTTCTAAAGCACAAAGTTGGGGG + Intronic
1106751701 13:32778169-32778191 CTTCTCATGCAAAATGTTGGCGG + Intergenic
1106883557 13:34158182-34158204 CTTTTGATGAAAAGTGTTGGTGG - Intergenic
1106949851 13:34871183-34871205 GTTCTTATGGGAAATGTTGGGGG + Intergenic
1107916010 13:45151774-45151796 TTTGTCTTGCAAAGTGTTGGAGG + Exonic
1109328811 13:60901983-60902005 CTTCTCAAGCAATATCTTTGTGG - Intergenic
1110463896 13:75779083-75779105 CTTCTGATGCTGAAAGTTGGAGG + Intronic
1111482858 13:88854735-88854757 ATTCTTAAGCAAAATGTTGAAGG + Intergenic
1112261629 13:97882793-97882815 CTCCTCATACAAACTGTTGAAGG + Intergenic
1112685205 13:101816381-101816403 CTTCTCTTTCACCATGTTGGCGG - Intronic
1114173000 14:20293284-20293306 ATTTTTATACAAAATGTTGGGGG + Intronic
1114713324 14:24800371-24800393 CTTCTCTTTTAAAAAGTTGGAGG + Intergenic
1115311806 14:31986021-31986043 CTTCTCATAAAAAATATTAGAGG - Intergenic
1115318082 14:32047598-32047620 ATTATACTGCAAAATGTTGGAGG + Intergenic
1117428277 14:55623871-55623893 CTTCTAATGAAAGATGTTGCTGG + Intronic
1117747467 14:58885183-58885205 CCTCTCATGAAGAATGTGGGAGG - Intergenic
1120485385 14:85107184-85107206 ATTCATATGCAAAGTGTTGGTGG - Intergenic
1121385692 14:93521891-93521913 CTTCTGAATCAAAATGTTTGAGG - Intronic
1124889147 15:33715940-33715962 ATTCTCATCCCGAATGTTGGAGG + Intronic
1125163862 15:36679739-36679761 CTTCTCCTTGAAAAGGTTGGTGG - Intronic
1126576539 15:50202651-50202673 CTTTTTCTACAAAATGTTGGAGG + Intronic
1126852942 15:52809311-52809333 TATGTCAAGCAAAATGTTGGGGG - Intergenic
1127197553 15:56605836-56605858 ATTGTAATGCCAAATGTTGGAGG - Intergenic
1128900108 15:71412743-71412765 CTCCTCATTCAAAATGTTGTTGG - Intronic
1131551009 15:93357091-93357113 CTTTTCATGCAAAATGCTGCTGG - Intergenic
1131805997 15:96123331-96123353 CTTTTGATGTAAAATGTTGTGGG - Intergenic
1132339512 15:101069132-101069154 CTGCTCCTGCAAACTGATGGGGG - Exonic
1133498570 16:6343901-6343923 CTTCTCATGTAAATTGCTTGAGG + Intronic
1133794294 16:9033692-9033714 CTTCTCTTCCCAAATGTGGGTGG + Intergenic
1136711064 16:32237678-32237700 ATTCTCTTGGAAAATGTTGAGGG - Intergenic
1136756843 16:32691732-32691754 ATTCTCTTGGAAAATGTTGAGGG + Intergenic
1136811266 16:33178643-33178665 ATTCTCTTGGAAAATGTTGAGGG - Intergenic
1136817742 16:33288723-33288745 ATTCTCTTGGAAAATGTTGAGGG - Intronic
1136824306 16:33345252-33345274 ATTCTCTTGGAAAATGTTGAGGG - Intergenic
1136829372 16:33444023-33444045 ATTCTCTTGGAAAATGTTGAGGG - Intergenic
1137497457 16:48981714-48981736 CTTCCCATGCCACATGTTTGTGG - Intergenic
1140916706 16:79500304-79500326 CATCCCATGAAGAATGTTGGTGG - Intergenic
1141463188 16:84190616-84190638 CATTTGATGCAAAATGTAGGTGG - Intergenic
1141743261 16:85908550-85908572 CTTTTCATGCTAAATTTTAGGGG + Intronic
1202989844 16_KI270728v1_random:1612-1634 ATTCTCTTGGAAAATGTTGAGGG - Intergenic
1203058993 16_KI270728v1_random:952084-952106 ATTCTCTTGGAAAATGTTGAGGG + Intergenic
1144740224 17:17577595-17577617 GTTTTCATGCAAGATGATGGCGG - Intronic
1145980842 17:29010534-29010556 CTTCTCCTGCCACATGATGGGGG - Intronic
1148233655 17:45952849-45952871 CATCTCAAGTAAAAAGTTGGGGG + Intronic
1150182885 17:63145074-63145096 CATTTCCTGCAAAATGGTGGGGG - Intronic
1155786808 18:29912767-29912789 CTTATAGTGCAAAAAGTTGGGGG - Intergenic
1156529819 18:37804719-37804741 CTTCTCATGGAATATCTTTGTGG + Intergenic
1156881915 18:42090861-42090883 CTACTCAAGCAAAATGTTTGTGG - Intergenic
1158332901 18:56382604-56382626 CTTTTCATACCAAATGTGGGAGG - Intergenic
925219104 2:2123430-2123452 ATTGTCATGCCAAGTGTTGGAGG + Intronic
925729361 2:6906751-6906773 GTCCTTATGCAAAATGATGGTGG - Intergenic
927483901 2:23475733-23475755 CCTCTCATGCTAAATGTGTGGGG + Intronic
928330763 2:30356291-30356313 CTTCTGATGCCAGATGATGGGGG + Intergenic
928859410 2:35838754-35838776 CCTGTCATGCAAAATGCTGAAGG - Intergenic
930622924 2:53663177-53663199 CTTCTCAAGGAATATGTTTGTGG - Intronic
931336847 2:61354302-61354324 TTTCTCATCCAAAACGTTAGAGG + Intronic
932452708 2:71824741-71824763 CTCCTCAGGCCAAAGGTTGGTGG - Intergenic
932569793 2:72932589-72932611 CCTCTCATGCATAATCTGGGAGG - Intronic
932808609 2:74805211-74805233 GTTTTGATGCAAAATGTTTGAGG - Intergenic
932811172 2:74827459-74827481 CTTCTCATGCGGATTGTTGGAGG + Intergenic
935471369 2:103464600-103464622 CTTCTCAGTGAAAAAGTTGGGGG - Intergenic
939789430 2:146553151-146553173 CTTCTCTTGCCAATTGTTGATGG - Intergenic
940764932 2:157780220-157780242 CCTCTGATTCAAAATGTAGGTGG + Intronic
940821570 2:158361327-158361349 CTTCTCAAGCAAAATCTTTGTGG - Intronic
942757475 2:179359063-179359085 TTTCTTATGCAAAATTTTGCTGG + Intergenic
943037819 2:182768006-182768028 ATTCTCCTTCAAAATGTGGGGGG - Intronic
943514208 2:188863902-188863924 CTTCTCATGCAGTATCTTAGTGG - Intergenic
1169234249 20:3916727-3916749 CTGCTCATTTAGAATGTTGGAGG + Intronic
1173621088 20:44436521-44436543 CATCTCATGACAAATGTTGATGG + Intergenic
1174973726 20:55306886-55306908 CTTCTCATGGAATATCTTAGTGG - Intergenic
1175150008 20:56925910-56925932 CCCCTCCTGCAAAATATTGGAGG - Intergenic
1175554673 20:59841174-59841196 CTTCTGATAAAATATGTTGGAGG + Intronic
1175633554 20:60561557-60561579 CTTCTGATGGAAGGTGTTGGTGG + Intergenic
1176849327 21:13900752-13900774 ATTGTAATCCAAAATGTTGGAGG - Intergenic
1177203155 21:17980141-17980163 TTTCTCAGGCAAAATGTAGATGG - Intronic
1177527474 21:22313159-22313181 CTTGTAATGCCCAATGTTGGAGG - Intergenic
1181411543 22:22725150-22725172 CTTCTCATGCTCACTTTTGGGGG - Intergenic
1183492106 22:38122227-38122249 CTGGTCATGCAAAGTCTTGGAGG - Intronic
1183550832 22:38483650-38483672 CTTCTCATCTAAAAGGTTAGTGG - Exonic
949650130 3:6148524-6148546 TTTCTCATCCAAAATCTTGGTGG - Intergenic
949674818 3:6441290-6441312 CTTCTCATTGAGGATGTTGGGGG + Intergenic
951789621 3:26465661-26465683 CTTCTCAAGGAATATGTTTGTGG - Intergenic
952248272 3:31622062-31622084 ATTCTCTTACAATATGTTGGAGG - Intronic
952711239 3:36434093-36434115 GTTCACATGTAAAATGTTAGAGG + Intronic
953115468 3:39988499-39988521 CTTCTCATGGAATATCTTAGTGG + Intronic
953591709 3:44262923-44262945 CCTCACATGCAAAATGAGGGTGG - Intronic
955926306 3:64008657-64008679 CCTCACATGCACAATATTGGGGG + Intergenic
955999939 3:64718714-64718736 CTTCTCATCCAAATGGTTAGAGG + Intergenic
959452877 3:106524527-106524549 CTTCTCATGGAATATCTTAGTGG - Intergenic
959886242 3:111504562-111504584 CTTCTCATGCCAATTTTGGGAGG - Intronic
961373203 3:126445134-126445156 CTTCTGATGCAAATTAGTGGTGG - Intronic
962307510 3:134301432-134301454 TTTCTCATGTAAAATCCTGGAGG - Intergenic
962929593 3:140024093-140024115 CTTCTTCTGCAAAATGGGGGTGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
966754048 3:183351855-183351877 CTTCATCTGCAAAATGGTGGGGG + Intronic
966843186 3:184105978-184106000 CTTCTCTTCCAAAAGGTGGGAGG - Intronic
968404538 4:328540-328562 CTTCTCATGGAATATCTTAGTGG - Intergenic
971141137 4:23926235-23926257 CTGGTCCTGCAAGATGTTGGTGG - Intergenic
971421860 4:26481203-26481225 CTGCTCATGCAGAATTGTGGCGG - Intergenic
971596927 4:28541108-28541130 CTTCTTATTCAAAATAATGGAGG + Intergenic
972326608 4:38022486-38022508 CTTCTCCTGGAAATGGTTGGTGG - Intronic
973368717 4:49228298-49228320 ATTGTAATGCCAAATGTTGGAGG - Intergenic
973392328 4:49567116-49567138 ATTGTAATGCCAAATGTTGGAGG + Intergenic
973642845 4:52920330-52920352 CTGCTCATTCAAAATGTTTACGG + Intronic
975030922 4:69615097-69615119 ATTGTAATTCAAAATGTTGGGGG - Intronic
975924459 4:79432258-79432280 GTTCTCATCCAAAATGTGAGAGG - Intergenic
978971850 4:114817366-114817388 ATTCTCATTCAAATTATTGGTGG + Intergenic
980731524 4:136830594-136830616 CTTCTAAAGCAAATTTTTGGAGG + Intergenic
981690774 4:147506271-147506293 TTTGTCTTGCAAAATATTGGAGG + Intronic
982045830 4:151444871-151444893 CTTCTGATACAAAATGTGTGTGG + Intronic
983443709 4:167821456-167821478 ATTGTGATGCAAAGTGTTGGAGG + Intergenic
984361849 4:178744020-178744042 CTGATGATGCAGAATGTTGGTGG + Intergenic
988125930 5:27037071-27037093 CTTCTTCTGCAGAATGTAGGAGG + Intronic
989087896 5:37695305-37695327 ATTCTAATTCACAATGTTGGAGG - Intronic
991642957 5:68772813-68772835 GTTCTCATCCATAATGATGGTGG - Intergenic
993245474 5:85446102-85446124 CTTCTCAATTAAAATGTTGATGG + Intergenic
994647872 5:102492154-102492176 CTTGTCATCCCCAATGTTGGAGG - Intronic
994696451 5:103078534-103078556 CTTCTCATGGAATATCTTAGTGG + Intergenic
994751121 5:103738143-103738165 CTTCTCATGCAGAATGTGATTGG + Intergenic
995318220 5:110800765-110800787 ATTCTCATCCCCAATGTTGGAGG + Intergenic
995599549 5:113780582-113780604 CTTCTGACACCAAATGTTGGGGG - Intergenic
999014183 5:148080687-148080709 CTTCTCATGTAAAATATAGGAGG + Intronic
999490377 5:152044415-152044437 CTCCTCATGGAAAATCCTGGGGG - Intergenic
999918960 5:156296715-156296737 TTTATCCTGGAAAATGTTGGAGG + Intronic
1000565892 5:162846917-162846939 CTTCTCATGGAATATCTTTGTGG - Intergenic
1002918094 6:1545102-1545124 CTTGTAATGCAAAATATGGGAGG - Intergenic
1004649085 6:17591210-17591232 CTTCTCAAGGAAAATGCTGCAGG + Intergenic
1004760281 6:18658048-18658070 CTTCTCATGAAGAATCTTAGTGG - Intergenic
1010630041 6:78188592-78188614 ATTCTAATCCATAATGTTGGAGG - Intergenic
1012360318 6:98369448-98369470 CTTCTAAAGAAAAATGTTTGTGG + Intergenic
1012568406 6:100690309-100690331 CTTCACATGGAAAATATTTGAGG - Intronic
1012771446 6:103439999-103440021 TTTCTCATGCAAAATATTTAGGG - Intergenic
1013099067 6:106973305-106973327 CTTCTCACTTACAATGTTGGAGG + Intronic
1013279698 6:108623995-108624017 ATTCAGATGCAAAATCTTGGTGG - Intronic
1013713375 6:112928113-112928135 CTTCTCATCCAAATTGCTGTTGG - Intergenic
1014901830 6:126975228-126975250 CATCTCAAGCAAAATGGTGCAGG + Intergenic
1018084988 6:160293748-160293770 GTTGTCATGTTAAATGTTGGGGG + Intergenic
1021885854 7:25138042-25138064 CTTCTCATGCCAATTTTGGGAGG + Intronic
1022634816 7:32121382-32121404 CTTCTCATGGAGTATCTTGGTGG - Intronic
1023034302 7:36117283-36117305 CTTTTCATGGATGATGTTGGGGG + Intergenic
1028268082 7:88753227-88753249 GATCTCAAGCAAAATGTTGCAGG - Intergenic
1028677795 7:93487910-93487932 CTTCTCATGAAATATCTTAGTGG - Intronic
1028972150 7:96871249-96871271 CTGCTCAGGCAGAATGGTGGTGG + Intergenic
1030128182 7:106174707-106174729 CTTCTCATGGAAAATGGCAGTGG - Intergenic
1030256693 7:107517498-107517520 CTTCTCATGGAATATCTTAGTGG - Intronic
1030815991 7:114038336-114038358 CTTCATTTGCAAAATGTTAGTGG + Intronic
1031526425 7:122826297-122826319 TTTCTCATGGAAAATGCTGCTGG + Intronic
1032935550 7:136727203-136727225 CTTCTTTTGAAAAATGTTTGTGG - Intergenic
1033063995 7:138135249-138135271 CTTCTAATGCAAAATGTGTAGGG - Intergenic
1033139661 7:138814205-138814227 CTTCTGAGGCACAATGCTGGAGG - Intronic
1033365466 7:140670165-140670187 CTCCTTAAGCAAAATGCTGGGGG - Intronic
1033851037 7:145495201-145495223 CTTATCATGTATAATGTTGATGG + Intergenic
1035491859 7:159286176-159286198 CTTCTCATGGAATATCTTAGTGG - Intergenic
1039823707 8:41155712-41155734 CTTCACCTGTAAAATGTTTGTGG - Intergenic
1043251107 8:78074256-78074278 CTTCTCAGACAAAAATTTGGGGG - Intergenic
1048019047 8:130521461-130521483 CTTCTCATGCACAGTGCAGGAGG - Intergenic
1049524474 8:143115508-143115530 CTTCTCATCAGAAATGATGGGGG - Intergenic
1050285577 9:4098399-4098421 TTGCTCATGGAAAATGTTAGTGG - Intronic
1050336329 9:4593523-4593545 CTTTTCTTGCCAAATTTTGGGGG + Intronic
1050928664 9:11297677-11297699 TTTCTCATTCAAAATATAGGGGG - Intergenic
1051841062 9:21398900-21398922 CATCTCATGGAGAATATTGGTGG + Intergenic
1055547876 9:77399740-77399762 CTTCTGAAGCATAATGGTGGAGG - Intronic
1056264824 9:84886647-84886669 CTTCTCATGCAATATATTCAAGG - Intronic
1057295405 9:93832603-93832625 CTACACATGAAAAATTTTGGGGG - Intergenic
1059076479 9:111198541-111198563 CTTCTCATGCAATATGTTATGGG - Intergenic
1059170674 9:112121648-112121670 TTTCCGATGGAAAATGTTGGTGG + Intronic
1059821143 9:117973425-117973447 TGTCTCTTCCAAAATGTTGGTGG - Intergenic
1060805198 9:126571070-126571092 CTTCTCAGGCAAAAAGTTGTTGG - Intergenic
1062156893 9:135054775-135054797 CTTCTCATCCGAAATCATGGAGG + Intergenic
1186540154 X:10392107-10392129 CTTATCATGCAAAAAGTGTGAGG + Intergenic
1186723355 X:12329524-12329546 CTTCACATGCGTATTGTTGGGGG - Intronic
1189647167 X:43145680-43145702 TTTCTCAGGCAAAAAGTTGAAGG - Intergenic
1191094485 X:56659863-56659885 CTTCTCATGTAGAATCTTGCAGG + Intergenic
1191864716 X:65694721-65694743 CTTCTGCTGCAATCTGTTGGAGG + Intronic
1193708665 X:84854094-84854116 CTCCAAATGCAAAATTTTGGAGG + Intergenic
1193866514 X:86738377-86738399 CTTCTCATGCAAAATCAATGTGG + Intronic
1194021430 X:88696182-88696204 CTTCTCAAGGAATATGTTTGTGG - Intergenic
1194052537 X:89089205-89089227 CTTCTCATCAAAAATCATGGAGG - Intergenic
1194132986 X:90105243-90105265 CTTCTCATGAACTATCTTGGTGG + Intergenic
1194735423 X:97507075-97507097 CTTCACAAGGAAAATGTTGCTGG + Intronic
1198295227 X:135280977-135280999 CTTCTCATGGAATATCTTTGTGG + Intronic
1198341142 X:135714101-135714123 GTTCTCATGGAACATGGTGGGGG + Intronic
1200478774 Y:3675319-3675341 CTTCTCATGAACTATCTTGGTGG + Intergenic
1201390013 Y:13487912-13487934 CTTCTCATGGAGTATCTTGGTGG + Intergenic
1202147788 Y:21818476-21818498 ATGCTCATGAAAAATGTTAGAGG + Intergenic