ID: 1106755397

View in Genome Browser
Species Human (GRCh38)
Location 13:32817986-32818008
Sequence TTGTGTGTGTTGTAAGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106755397_1106755400 10 Left 1106755397 13:32817986-32818008 CCTCTATCTTACAACACACACAA No data
Right 1106755400 13:32818019-32818041 AAAATGGAGTAAGGAGTTGAAGG No data
1106755397_1106755399 1 Left 1106755397 13:32817986-32818008 CCTCTATCTTACAACACACACAA No data
Right 1106755399 13:32818010-32818032 AATCAACTCAAAATGGAGTAAGG No data
1106755397_1106755398 -6 Left 1106755397 13:32817986-32818008 CCTCTATCTTACAACACACACAA No data
Right 1106755398 13:32818003-32818025 ACACAAAAATCAACTCAAAATGG 0: 141
1: 1015
2: 4750
3: 13924
4: 16540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106755397 Original CRISPR TTGTGTGTGTTGTAAGATAG AGG (reversed) Intergenic
No off target data available for this crispr