ID: 1106755808

View in Genome Browser
Species Human (GRCh38)
Location 13:32821726-32821748
Sequence CTGGAGCCCTTGAGGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106755792_1106755808 27 Left 1106755792 13:32821676-32821698 CCTCTCTGGGTGGTGGATGCAGG No data
Right 1106755808 13:32821726-32821748 CTGGAGCCCTTGAGGGAGCTTGG No data
1106755801_1106755808 -6 Left 1106755801 13:32821709-32821731 CCGGCTGAGGAGTCCCCCTGGAG No data
Right 1106755808 13:32821726-32821748 CTGGAGCCCTTGAGGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106755808 Original CRISPR CTGGAGCCCTTGAGGGAGCT TGG Intergenic
No off target data available for this crispr