ID: 1106755951

View in Genome Browser
Species Human (GRCh38)
Location 13:32822694-32822716
Sequence CCAAGGTTACTTAGTAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106755945_1106755951 24 Left 1106755945 13:32822647-32822669 CCATTTTACGGACGATAAAACTG No data
Right 1106755951 13:32822694-32822716 CCAAGGTTACTTAGTAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106755951 Original CRISPR CCAAGGTTACTTAGTAAAGG TGG Intergenic
No off target data available for this crispr