ID: 1106758757

View in Genome Browser
Species Human (GRCh38)
Location 13:32847643-32847665
Sequence CGAGACTATTGTCTTTTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106758757_1106758763 25 Left 1106758757 13:32847643-32847665 CCAGTTAAAAGACAATAGTCTCG No data
Right 1106758763 13:32847691-32847713 TGCGCACGCATGTGTGAAGAAGG No data
1106758757_1106758762 -10 Left 1106758757 13:32847643-32847665 CCAGTTAAAAGACAATAGTCTCG No data
Right 1106758762 13:32847656-32847678 AATAGTCTCGTCAGTGAGGGGGG No data
1106758757_1106758764 26 Left 1106758757 13:32847643-32847665 CCAGTTAAAAGACAATAGTCTCG No data
Right 1106758764 13:32847692-32847714 GCGCACGCATGTGTGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106758757 Original CRISPR CGAGACTATTGTCTTTTAAC TGG (reversed) Intergenic