ID: 1106758763 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:32847691-32847713 |
| Sequence | TGCGCACGCATGTGTGAAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1106758757_1106758763 | 25 | Left | 1106758757 | 13:32847643-32847665 | CCAGTTAAAAGACAATAGTCTCG | No data | ||
| Right | 1106758763 | 13:32847691-32847713 | TGCGCACGCATGTGTGAAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1106758763 | Original CRISPR | TGCGCACGCATGTGTGAAGA AGG | Intergenic | ||