ID: 1106759471

View in Genome Browser
Species Human (GRCh38)
Location 13:32853907-32853929
Sequence CTATATCAGCAGTTGCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106759471_1106759473 7 Left 1106759471 13:32853907-32853929 CCATTCTGCAACTGCTGATATAG No data
Right 1106759473 13:32853937-32853959 TTCAAGCTATGGATCCTCAATGG No data
1106759471_1106759475 23 Left 1106759471 13:32853907-32853929 CCATTCTGCAACTGCTGATATAG No data
Right 1106759475 13:32853953-32853975 TCAATGGATGCTGAAACCACTGG No data
1106759471_1106759478 26 Left 1106759471 13:32853907-32853929 CCATTCTGCAACTGCTGATATAG No data
Right 1106759478 13:32853956-32853978 ATGGATGCTGAAACCACTGGGGG No data
1106759471_1106759476 24 Left 1106759471 13:32853907-32853929 CCATTCTGCAACTGCTGATATAG No data
Right 1106759476 13:32853954-32853976 CAATGGATGCTGAAACCACTGGG No data
1106759471_1106759477 25 Left 1106759471 13:32853907-32853929 CCATTCTGCAACTGCTGATATAG No data
Right 1106759477 13:32853955-32853977 AATGGATGCTGAAACCACTGGGG No data
1106759471_1106759472 -4 Left 1106759471 13:32853907-32853929 CCATTCTGCAACTGCTGATATAG No data
Right 1106759472 13:32853926-32853948 ATAGTAACTGATTCAAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106759471 Original CRISPR CTATATCAGCAGTTGCAGAA TGG (reversed) Intergenic
No off target data available for this crispr