ID: 1106769171

View in Genome Browser
Species Human (GRCh38)
Location 13:32945097-32945119
Sequence GCCAGCCTCACTCTCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106769171_1106769178 11 Left 1106769171 13:32945097-32945119 CCCTGGAGGAGAGTGAGGCTGGC No data
Right 1106769178 13:32945131-32945153 CTGAAAGCAGGACAGGTGGCTGG No data
1106769171_1106769176 4 Left 1106769171 13:32945097-32945119 CCCTGGAGGAGAGTGAGGCTGGC No data
Right 1106769176 13:32945124-32945146 TCGAGGACTGAAAGCAGGACAGG No data
1106769171_1106769180 26 Left 1106769171 13:32945097-32945119 CCCTGGAGGAGAGTGAGGCTGGC No data
Right 1106769180 13:32945146-32945168 GTGGCTGGAGCTTAGTGTGTGGG No data
1106769171_1106769181 29 Left 1106769171 13:32945097-32945119 CCCTGGAGGAGAGTGAGGCTGGC No data
Right 1106769181 13:32945149-32945171 GCTGGAGCTTAGTGTGTGGGTGG No data
1106769171_1106769177 7 Left 1106769171 13:32945097-32945119 CCCTGGAGGAGAGTGAGGCTGGC No data
Right 1106769177 13:32945127-32945149 AGGACTGAAAGCAGGACAGGTGG No data
1106769171_1106769182 30 Left 1106769171 13:32945097-32945119 CCCTGGAGGAGAGTGAGGCTGGC No data
Right 1106769182 13:32945150-32945172 CTGGAGCTTAGTGTGTGGGTGGG No data
1106769171_1106769179 25 Left 1106769171 13:32945097-32945119 CCCTGGAGGAGAGTGAGGCTGGC No data
Right 1106769179 13:32945145-32945167 GGTGGCTGGAGCTTAGTGTGTGG No data
1106769171_1106769175 -1 Left 1106769171 13:32945097-32945119 CCCTGGAGGAGAGTGAGGCTGGC No data
Right 1106769175 13:32945119-32945141 CAGGTTCGAGGACTGAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106769171 Original CRISPR GCCAGCCTCACTCTCCTCCA GGG (reversed) Intergenic