ID: 1106769176

View in Genome Browser
Species Human (GRCh38)
Location 13:32945124-32945146
Sequence TCGAGGACTGAAAGCAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106769168_1106769176 16 Left 1106769168 13:32945085-32945107 CCAATGCTAAGACCCTGGAGGAG No data
Right 1106769176 13:32945124-32945146 TCGAGGACTGAAAGCAGGACAGG No data
1106769172_1106769176 3 Left 1106769172 13:32945098-32945120 CCTGGAGGAGAGTGAGGCTGGCA No data
Right 1106769176 13:32945124-32945146 TCGAGGACTGAAAGCAGGACAGG No data
1106769171_1106769176 4 Left 1106769171 13:32945097-32945119 CCCTGGAGGAGAGTGAGGCTGGC No data
Right 1106769176 13:32945124-32945146 TCGAGGACTGAAAGCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106769176 Original CRISPR TCGAGGACTGAAAGCAGGAC AGG Intergenic