ID: 1106773366

View in Genome Browser
Species Human (GRCh38)
Location 13:32984457-32984479
Sequence GGTGGCCTGTGATGCATTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106773360_1106773366 24 Left 1106773360 13:32984410-32984432 CCCCCTTAAAAATCAATGTCTCT No data
Right 1106773366 13:32984457-32984479 GGTGGCCTGTGATGCATTCATGG No data
1106773359_1106773366 25 Left 1106773359 13:32984409-32984431 CCCCCCTTAAAAATCAATGTCTC No data
Right 1106773366 13:32984457-32984479 GGTGGCCTGTGATGCATTCATGG No data
1106773363_1106773366 21 Left 1106773363 13:32984413-32984435 CCTTAAAAATCAATGTCTCTTAA No data
Right 1106773366 13:32984457-32984479 GGTGGCCTGTGATGCATTCATGG No data
1106773362_1106773366 22 Left 1106773362 13:32984412-32984434 CCCTTAAAAATCAATGTCTCTTA No data
Right 1106773366 13:32984457-32984479 GGTGGCCTGTGATGCATTCATGG No data
1106773361_1106773366 23 Left 1106773361 13:32984411-32984433 CCCCTTAAAAATCAATGTCTCTT No data
Right 1106773366 13:32984457-32984479 GGTGGCCTGTGATGCATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106773366 Original CRISPR GGTGGCCTGTGATGCATTCA TGG Intergenic
No off target data available for this crispr