ID: 1106773471

View in Genome Browser
Species Human (GRCh38)
Location 13:32985401-32985423
Sequence CACACAGCTGTCCCTCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106773471_1106773479 9 Left 1106773471 13:32985401-32985423 CCCTGTGGAGGGACAGCTGTGTG No data
Right 1106773479 13:32985433-32985455 GGGCGAGGAGCTCTGCCTGGTGG No data
1106773471_1106773481 26 Left 1106773471 13:32985401-32985423 CCCTGTGGAGGGACAGCTGTGTG No data
Right 1106773481 13:32985450-32985472 TGGTGGCATTGACGCCTTTGCGG No data
1106773471_1106773478 6 Left 1106773471 13:32985401-32985423 CCCTGTGGAGGGACAGCTGTGTG No data
Right 1106773478 13:32985430-32985452 AGTGGGCGAGGAGCTCTGCCTGG No data
1106773471_1106773477 -6 Left 1106773471 13:32985401-32985423 CCCTGTGGAGGGACAGCTGTGTG No data
Right 1106773477 13:32985418-32985440 TGTGTGGCTGGCAGTGGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106773471 Original CRISPR CACACAGCTGTCCCTCCACA GGG (reversed) Intergenic
No off target data available for this crispr