ID: 1106776682

View in Genome Browser
Species Human (GRCh38)
Location 13:33016343-33016365
Sequence AGCGGGGGTGGGCGCGCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 425}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106776666_1106776682 17 Left 1106776666 13:33016303-33016325 CCGGCTCGCAGGTAATTATTGCC 0: 1
1: 0
2: 0
3: 0
4: 41
Right 1106776682 13:33016343-33016365 AGCGGGGGTGGGCGCGCCGGCGG 0: 1
1: 0
2: 3
3: 39
4: 425
1106776671_1106776682 -4 Left 1106776671 13:33016324-33016346 CCAGCGGAGCCCGCCGGGGAGCG 0: 1
1: 0
2: 0
3: 23
4: 161
Right 1106776682 13:33016343-33016365 AGCGGGGGTGGGCGCGCCGGCGG 0: 1
1: 0
2: 3
3: 39
4: 425
1106776665_1106776682 18 Left 1106776665 13:33016302-33016324 CCCGGCTCGCAGGTAATTATTGC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1106776682 13:33016343-33016365 AGCGGGGGTGGGCGCGCCGGCGG 0: 1
1: 0
2: 3
3: 39
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106776682 Original CRISPR AGCGGGGGTGGGCGCGCCGG CGG Intergenic
900100679 1:960808-960830 GGCGGGGGTCGGGGCGCGGGGGG + Intronic
900101597 1:964396-964418 AGCGGGCGTGGCCGTGCTGGAGG + Exonic
900113732 1:1020064-1020086 AGCGCGGGCGGGCGGGCGGGGGG - Intergenic
900482295 1:2905128-2905150 AGGGTGGGTGGGCGGGCAGGTGG + Intergenic
900648939 1:3721758-3721780 AGCAGGGGTGTGAGTGCCGGTGG - Intronic
901056022 1:6448962-6448984 GGCGGCGGTGGGGGCGGCGGTGG - Exonic
901433884 1:9234727-9234749 GGCGGGGGCGCGCGCGGCGGGGG - Intergenic
901489287 1:9588658-9588680 AGCCCGGGTGGGCGGGGCGGCGG - Intergenic
901798003 1:11691680-11691702 AGGGGGAGTGGGCGGGCAGGAGG - Intergenic
901982950 1:13051037-13051059 AGCTGGGGTGGGCGGGCTGTAGG + Intronic
901986071 1:13076301-13076323 AGCTGGGGTGGGCGGGCTGCAGG - Intronic
901995738 1:13150466-13150488 AGCTGGGGTGGGCGGGCTGCAGG + Intergenic
901999139 1:13177881-13177903 AGCTGGGGTGGGCGGGCTGTAGG - Intergenic
902017625 1:13321012-13321034 AGCTGGGGTGGGCGGGCTGTAGG - Intronic
902444397 1:16452778-16452800 AGCTGGGCTGGGCGGGGCGGCGG - Intronic
902658666 1:17886751-17886773 AGTCGGGGTGGGCGAGCAGGGGG + Intergenic
902691016 1:18110108-18110130 GGCGGGGGTTGGCGTGCCTGAGG + Intronic
902951017 1:19882750-19882772 AGCGAGGGAGGCGGCGCCGGGGG + Intronic
903077984 1:20786934-20786956 GGCGGGAGCGCGCGCGCCGGAGG + Intronic
903384648 1:22918402-22918424 GGCGGGGGCGGGCGTGCGGGTGG + Intergenic
903492878 1:23743219-23743241 AGCGGGGGTGCCGGCGGCGGAGG + Exonic
904181380 1:28668924-28668946 AGGGCGGGCGGGCGCGCAGGGGG + Intronic
905685061 1:39901933-39901955 AGCGAGGGAGGGCGCGCGCGCGG - Exonic
906263126 1:44407810-44407832 AGCGGTGGTGCGCGCGGCGGCGG + Intronic
906640655 1:47438820-47438842 TGCGGGTGTGGGTGCGGCGGCGG - Exonic
907051162 1:51330581-51330603 GCCGGGGAGGGGCGCGCCGGGGG + Intronic
908796259 1:67833464-67833486 CGCTGGGGTGGGCGGGGCGGCGG + Exonic
912246365 1:107965234-107965256 CGCGGGTGGGAGCGCGCCGGCGG + Intergenic
914753167 1:150549348-150549370 GGCGGGGGCGGGCGCGAGGGCGG + Exonic
914869076 1:151458678-151458700 GGCGGGGGCGGGGGCGCGGGCGG - Intronic
914878617 1:151530592-151530614 AGCGGGGGCTGGCCCGCCTGGGG + Exonic
915463423 1:156082501-156082523 ACGGGAGGGGGGCGCGCCGGGGG + Intergenic
916179225 1:162069825-162069847 AGCGGGACTGGGCGCGGCGCCGG - Exonic
917202602 1:172533176-172533198 GGCGGGCGTGGACGAGCCGGTGG + Exonic
917905854 1:179586653-179586675 GGCGGGGGCGGGGGCGGCGGGGG + Intergenic
919730699 1:200912029-200912051 AGTGGGGGCGGGTGCTCCGGAGG - Exonic
919926677 1:202195072-202195094 AGCGGGGCTGGGGGTGCAGGTGG - Intronic
919980843 1:202642350-202642372 GGTGGGGGAGGGCGCGCGGGGGG - Intronic
920135988 1:203769771-203769793 TGCGGGGGGGGGGGCGGCGGGGG + Intronic
922116489 1:222618399-222618421 CGCGGGGGTGGGCGCGCTCCGGG + Intronic
922499025 1:226083413-226083435 GGCTGGGGAGGGCGAGCCGGAGG - Intergenic
923055901 1:230425940-230425962 TGTGGGGGCGGGCGCGCGGGCGG - Intergenic
923429278 1:233905146-233905168 GGCGTGGGTGAGCGAGCCGGCGG + Intronic
924436633 1:244048793-244048815 AGCGGGGGTGGGCGGGAGGGAGG + Intergenic
1063664751 10:8054526-8054548 GGCGGGGGTGCGCGGGGCGGGGG + Intronic
1064086527 10:12349759-12349781 CGCTGGGGAGGGGGCGCCGGGGG - Exonic
1064251063 10:13706908-13706930 AGCGAGGGTGGGGGCTCCTGGGG - Intronic
1065140475 10:22714460-22714482 AGTGGGGCTGAGCGCGCCGGCGG - Exonic
1068637396 10:59362678-59362700 AGCTGGGCGGGGCGCGGCGGCGG + Intronic
1070032618 10:72692203-72692225 GGCGGCGGCGGGGGCGCCGGCGG + Exonic
1071527147 10:86365441-86365463 AGGGGGAGTGGGCGCGCCGAGGG - Intronic
1071997543 10:91162946-91162968 AGCGGGGGTGCGAGCGGCGCGGG - Intergenic
1073914218 10:108383522-108383544 GGCGGGGGTGGGGGGGGCGGTGG - Intergenic
1074377155 10:112950149-112950171 AGCCGGGGTGGGCGGGGCGGGGG - Intergenic
1074377316 10:112951022-112951044 ATCGGGGCTGGGGGCGGCGGCGG + Intronic
1076683554 10:132187007-132187029 AGCGGGGGCGGGCGGGCGGGCGG - Exonic
1076705137 10:132297303-132297325 AGCGGGGGCGGAGGCACCGGTGG - Intronic
1076710762 10:132332459-132332481 AGCGGGGGTGGGCGTGCGTGGGG + Intronic
1077016389 11:400777-400799 GGCGGGGGTGAGCGGGGCGGGGG - Intronic
1077016435 11:400883-400905 GGCGGGGGTGAGCGGGGCGGGGG - Intronic
1077016598 11:401285-401307 GGCGGGTGTGAGCGGGCCGGGGG - Intronic
1077016700 11:401546-401568 GCCGGGGGTGAGCGGGCCGGGGG - Intronic
1077016784 11:401750-401772 GGCGGGGGTGAGCGGGGCGGGGG - Intronic
1077017280 11:402823-402845 GGCGGGGGTGAGCGGGGCGGGGG - Intronic
1077085242 11:747020-747042 AGCAGGGGAGGGAGCGGCGGGGG - Intergenic
1077204570 11:1336393-1336415 GGCGGGGGGGTGCACGCCGGTGG - Intergenic
1077231971 11:1461772-1461794 TGTGGGGGTGGGGGCGCCGCTGG + Intronic
1077247400 11:1546392-1546414 AGGGGGGGTGGCCGCGAAGGGGG + Intergenic
1077492699 11:2869561-2869583 AGCGGGCGCGGGCGCACCGTCGG + Intergenic
1077923108 11:6655894-6655916 AGCGCGGGTGGGGGCGGGGGCGG - Intergenic
1078316082 11:10294247-10294269 AGCGCGGGTGGGGGCGGGGGAGG - Intergenic
1079459783 11:20669518-20669540 AGCGGTGGGGGGCGGGCTGGGGG + Intergenic
1080779766 11:35419411-35419433 TGCGGGTGTGTGCGCGCCTGGGG + Intronic
1081637045 11:44727786-44727808 AGCGGGGCGGGGCGGGGCGGAGG + Intronic
1083296335 11:61717463-61717485 AGCTGGGGCGGGCGAGGCGGAGG - Intronic
1083657662 11:64237476-64237498 AGCTGGGGAGGGTGCTCCGGGGG - Exonic
1083892024 11:65600191-65600213 AGCGGGGGTGGGTGGGCAGAAGG - Intronic
1083894567 11:65613674-65613696 AGCGGGGGTGGTGGGGGCGGTGG - Exonic
1084516331 11:69639600-69639622 GGCGGGGGAGGGGGCGCGGGAGG + Intergenic
1085284630 11:75351734-75351756 ACCGGGGGCGGGGGCGGCGGCGG - Intergenic
1085378324 11:76088486-76088508 GGCGGGGGAGGGGGCGCGGGTGG - Intronic
1089253113 11:117179218-117179240 AGCGGTGGTGGCGGCGGCGGCGG - Exonic
1089455135 11:118621503-118621525 AGCGGGGGCGAGCGGTCCGGAGG + Intronic
1091059862 11:132451380-132451402 GGCGGGGGTGGGGGCGCAGACGG + Intronic
1091290216 11:134435280-134435302 AGCAGGGGAGGGCGGGTCGGGGG + Intergenic
1091730606 12:2877358-2877380 CGCGTGGGTGGGCGAGCCGAGGG + Intronic
1093435251 12:19129495-19129517 GGAGGGGGCGGGCGCGCCGCAGG + Intergenic
1093450357 12:19306605-19306627 AGCGGAGGTGGTGGCGGCGGTGG + Intronic
1094118099 12:26938737-26938759 AGCAGGGGTGGGCGAGTCGGAGG + Intronic
1096491361 12:52014894-52014916 GGCGGGGGCGGCAGCGCCGGCGG - Exonic
1096598672 12:52714392-52714414 AGCCGGGGTGGCGGCGGCGGCGG - Intergenic
1096788293 12:54030297-54030319 GGCGGGGGTGGGGGCGTCGAAGG - Exonic
1096788594 12:54031678-54031700 GGCGAGGGTGGGGGCGCTGGAGG - Intronic
1097046159 12:56189204-56189226 AGCGCAGGAGGGCGCGCGGGGGG + Intronic
1097155020 12:57006266-57006288 GGCCGGGGTCGGCGCGCGGGCGG + Intronic
1099015811 12:77342861-77342883 AGCGGGGGTGGGGTGGCAGGGGG - Intergenic
1101892495 12:108730454-108730476 AGCTGGGGAGCGTGCGCCGGTGG + Intronic
1102009190 12:109607593-109607615 GGCGGGGGTGGGGGGGTCGGGGG - Intergenic
1102839974 12:116108390-116108412 AGGGGGGGGGGGCGCGTGGGGGG + Intronic
1102973604 12:117190387-117190409 GGCGGAGGAGGCCGCGCCGGAGG - Exonic
1103120650 12:118376864-118376886 AGCGGAGGTGGGACCGCTGGGGG + Intronic
1103410775 12:120710346-120710368 GGCGGGGGCGGGCGCCCGGGGGG - Intergenic
1103488235 12:121296878-121296900 AGCCGGCGGGGGCGCGCAGGGGG - Intronic
1103565704 12:121814346-121814368 GGAGGGGGTGGGGGCGGCGGTGG - Exonic
1103604867 12:122078981-122079003 GGCCGGGGTGGCCGCGCCGGAGG - Exonic
1104678067 12:130729273-130729295 AGCAGGGGTGGGTGTGACGGGGG + Intergenic
1104841493 12:131828150-131828172 GGCGGGGGTCGGGGCGCCTGCGG - Intergenic
1104854309 12:131894908-131894930 GGCCGGGGCGGGCGGGCCGGGGG - Exonic
1104929252 12:132329476-132329498 AGGGGGGCCGGGGGCGCCGGGGG + Intergenic
1104977769 12:132559954-132559976 CGCGGAGCTGGGCGCGCGGGAGG - Intronic
1106253716 13:28002860-28002882 AGCGGAGGTGGGCGGGGCGGGGG + Intergenic
1106269371 13:28138732-28138754 GGCGGTGGTGGCCCCGCCGGGGG + Exonic
1106776682 13:33016343-33016365 AGCGGGGGTGGGCGCGCCGGCGG + Intergenic
1106956413 13:34942914-34942936 AGCGGTGGTGGCGGCACCGGGGG + Exonic
1107467636 13:40665125-40665147 GGCGGGGGAGGGCGCGGCGAGGG - Intronic
1107851288 13:44576033-44576055 AGCGGCGGCGGCCGCGGCGGTGG + Exonic
1108340699 13:49496104-49496126 CGCGGGGGCGGGCGGGCGGGCGG + Intronic
1108615752 13:52129972-52129994 ATTGGGGGTGGCCGCGGCGGGGG + Intergenic
1112494748 13:99895981-99896003 AGCCGGGGTGGGCGGCCCCGCGG + Exonic
1112560253 13:100506376-100506398 GGCGGGGGTGGGGGCGGGGGCGG + Intronic
1113653881 13:112056339-112056361 CGCGGGGGCGGGGGCGCGGGAGG + Intergenic
1114292628 14:21301152-21301174 CGCGAGGCTGGGCGCGGCGGGGG - Exonic
1114422718 14:22598201-22598223 AGGGGGCGTGGCCGCGCAGGGGG - Intergenic
1114673551 14:24427456-24427478 AGCTGGGGTGGGGGAACCGGAGG + Exonic
1115566637 14:34630185-34630207 AGCGGGGCGGGGCGGGGCGGAGG + Intergenic
1116945284 14:50830720-50830742 CGCGGGCGGGGGCGGGCCGGCGG - Intronic
1117176629 14:53152767-53152789 AGCGAGGGTGAGAGCGGCGGCGG - Exonic
1119236808 14:73026804-73026826 AGGGGGGGCGGGTGCGGCGGGGG - Intronic
1119741158 14:77014485-77014507 TGCGTGGCTGGGGGCGCCGGGGG - Intergenic
1120821520 14:88915729-88915751 AGCGGGGGTGGGGGAGATGGAGG - Intergenic
1120990182 14:90368598-90368620 AGCGGGGGCGGGCGGGGTGGGGG + Intergenic
1121120423 14:91372526-91372548 TGCGGGGGGGGGCGGGCGGGGGG + Intronic
1121415904 14:93779202-93779224 GGCGGGGGTGGGGGCGGCGGGGG + Exonic
1122329839 14:100904691-100904713 GGCGGGGGTGGTCGGGGCGGGGG + Intergenic
1122799691 14:104223397-104223419 AGCTGGGGTGGGGGCGGGGGCGG - Intergenic
1122825544 14:104368814-104368836 AGCGGGTGTGGGGGCTCCTGTGG + Intergenic
1123113137 14:105882250-105882272 AGAGGAGGTGGGCGGGTCGGTGG + Intergenic
1123115483 14:105892400-105892422 AGAGGAGGTGGGCGGGACGGTGG + Intergenic
1124118188 15:26867117-26867139 AGCGGGCGCGAGTGCGCCGGGGG + Intronic
1124142290 15:27088254-27088276 CGCGGGGGCGGGCGCGGGGGCGG + Intronic
1124712964 15:32030448-32030470 CGCGGGGGCGGGCGGGGCGGGGG + Intergenic
1125918548 15:43510720-43510742 AGCGGGGGTGGGGTCTCTGGGGG - Intronic
1126102887 15:45130127-45130149 CGCGGGCCTGGGCGCTCCGGGGG + Intronic
1126864832 15:52925190-52925212 GGCGGGGGTGGGGGGGCGGGGGG + Intergenic
1128374629 15:67066132-67066154 GGCTGGGGAGGGCGCGCGGGCGG - Exonic
1128656033 15:69462752-69462774 TGCGTTGGTGGGCGCGCCGCGGG - Intergenic
1130319714 15:82830908-82830930 GGAGGGGGTGGGGGCGGCGGTGG - Exonic
1132552778 16:560253-560275 GGCGGCGGGGGGCGCGCGGGCGG + Intergenic
1132683318 16:1152658-1152680 GGTGGGGGTGGGGGCGGCGGCGG + Intergenic
1132843502 16:1989845-1989867 ATGGGAGGTGGGCGCGGCGGAGG + Intronic
1132889326 16:2196297-2196319 GGCGCGGGTGGGAGCCCCGGGGG - Intronic
1132942316 16:2514321-2514343 GGCGGGGGTCGGCGCCCCGAGGG + Intronic
1132943556 16:2520247-2520269 GGCGGGGGCGGGCGGGCGGGCGG + Intronic
1133046087 16:3089105-3089127 CGCGGGCGTGGGTGCGCAGGTGG + Exonic
1134781055 16:16895892-16895914 AGCGGGGGGTGGGGCGCGGGGGG + Intergenic
1135321533 16:21501471-21501493 GGCGGGGGTGGGGGGGCGGGGGG - Intergenic
1135437417 16:22437748-22437770 GGCGGGGGTGGGGGGGCGGGGGG + Intergenic
1135963341 16:27015777-27015799 AGCGGGGGTGGGTGGGCTGGAGG - Intergenic
1136145499 16:28313955-28313977 AGCAAGGGTGGGCGGGCGGGTGG - Intronic
1136226986 16:28866140-28866162 GGCGGGGGTGGGGGCAGCGGGGG - Exonic
1136365130 16:29806294-29806316 GGCGGGGGAGGGCGCGAGGGAGG - Intronic
1136535943 16:30899543-30899565 AATGGGGGTGGGGGTGCCGGGGG + Intronic
1136636878 16:31529639-31529661 GGCGGGGGTGCGCGGGGCGGGGG + Intergenic
1137588912 16:49681655-49681677 TGTGGGGGTGGGCACGCCTGTGG - Intronic
1137787586 16:51151344-51151366 GGAGGGGGCGGGCGGGCCGGCGG - Intronic
1137926718 16:52547323-52547345 AGAGGGGGCGGCCGCGGCGGGGG - Intronic
1138104840 16:54282484-54282506 GCCTGGGGTGGGCGGGCCGGGGG - Intergenic
1138561387 16:57802642-57802664 AGTGGGAGTGGGAGTGCCGGCGG - Intronic
1138619148 16:58197892-58197914 CGCGGGGGCGGGCGGGCTGGGGG + Exonic
1139470220 16:67174417-67174439 AGCGGGGTCCGGCGCGCCCGCGG - Exonic
1139483001 16:67241116-67241138 GGCGGGGGTGGGCGGGGGGGGGG - Intronic
1139489539 16:67279133-67279155 AGCGAGGGTGAGTGCGCGGGGGG - Exonic
1140478550 16:75250878-75250900 AGTGGGGGCGGGCGCGCCGCGGG - Intronic
1141607349 16:85161993-85162015 AGCGGGTGGGGGTGCGCTGGAGG + Intergenic
1141989583 16:87602456-87602478 GGCGGGCGGGGGCGCGCGGGCGG + Intronic
1142209779 16:88803603-88803625 TGCGGGCGTGGACTCGCCGGCGG - Exonic
1142347076 16:89560883-89560905 CGGGGGGGTGCGCGCGCCCGGGG + Intronic
1142586854 17:979444-979466 AGCGGGGGCCGGGGCGGCGGCGG - Exonic
1142810961 17:2395289-2395311 AGTGGTGGTGGGGGTGCCGGCGG + Exonic
1142854865 17:2723962-2723984 CGCGGGGGTGGGGGAGGCGGGGG + Intergenic
1142868819 17:2807718-2807740 AGCGAGGGTGGGAGTGCAGGGGG + Intronic
1143499207 17:7329233-7329255 GGCGGGGGTGGGGGCCCCAGCGG - Exonic
1143537287 17:7549078-7549100 ATCGGGGGAGGGGGAGCCGGCGG - Exonic
1143537338 17:7549173-7549195 AGAGGCGGAGGGGGCGCCGGGGG + Exonic
1143590888 17:7885332-7885354 AGCCGGGGTGGCGGCGGCGGCGG - Intronic
1144586806 17:16492123-16492145 CGCGGGGGCGGGCGGGCGGGCGG + Intronic
1144971265 17:19111198-19111220 GCCGGGAGGGGGCGCGCCGGAGG - Intergenic
1145031383 17:19507578-19507600 GGCGGGGGTGGGGACGCGGGTGG - Intronic
1146176553 17:30669105-30669127 GGATGGGGTGGGGGCGCCGGTGG - Intergenic
1146350015 17:32085220-32085242 GGATGGGGTGGGGGCGCCGGTGG - Intergenic
1147319124 17:39635645-39635667 AGAGGGGGTGGGCGCTCCCAGGG - Exonic
1147970975 17:44219080-44219102 GGCCGGGGCGGGGGCGCCGGCGG - Intronic
1148048663 17:44758910-44758932 TGCGGGGCTGGGGGGGCCGGGGG + Intergenic
1148551071 17:48551106-48551128 AGCGGGGGCGGTGGCGGCGGCGG - Exonic
1148562286 17:48613044-48613066 AGCGGGGACTGGCGCGGCGGGGG + Exonic
1148602064 17:48901761-48901783 GGCGGGGGTGGGGGGGCGGGGGG - Intergenic
1148830170 17:50426104-50426126 GGCGGGGCGGGGCGCGGCGGCGG - Intergenic
1149430519 17:56593367-56593389 AGCGGCGGTGGCGGCGGCGGTGG - Intergenic
1150562210 17:66303306-66303328 CGTGCGGGTGGGCGCGCCCGGGG - Intronic
1151857980 17:76736749-76736771 GGCGGGGCGGGGCGCGCGGGAGG - Exonic
1152077765 17:78169395-78169417 AGCTGGTGTGGGCGCCCTGGAGG - Intronic
1152245761 17:79183866-79183888 AGCGTGGGAGGGCGCGAGGGAGG - Intronic
1152275927 17:79357090-79357112 AGCGGGTGTGGGCGTGTCTGGGG - Intronic
1152349682 17:79777909-79777931 GGCGGGGGTGGGGGCGCGGGCGG - Intergenic
1152584055 17:81181359-81181381 AGCGGGGCTGGACGGGCGGGGGG - Intergenic
1152617845 17:81346053-81346075 GGTGGGGCTGGGCGCCCCGGAGG - Intergenic
1152640019 17:81445448-81445470 AGCGGGTGAGGGGGCGCCCGGGG - Exonic
1152721264 17:81924867-81924889 AGCAGGGGTGGGGGCGATGGGGG - Intronic
1153308974 18:3659447-3659469 ACCGGGGGTGGGGGCGGCGGGGG - Intronic
1153515216 18:5895593-5895615 GGCGTGGGGGGGGGCGCCGGAGG - Intronic
1153872529 18:9334466-9334488 AGCTGGGGTGGGTGCGCCTGGGG + Intergenic
1154214871 18:12408308-12408330 AGCGGGGGCGGCCGGGGCGGGGG + Intronic
1155570343 18:27185369-27185391 GGCGGGGGCGGGGGCGCGGGCGG - Intergenic
1156099678 18:33578501-33578523 CGCGGGGGGAGGCGCGCGGGCGG - Intergenic
1156099768 18:33578823-33578845 TGCGGGAGTGGGCTCGCCCGGGG + Intronic
1156171620 18:34493551-34493573 AGTGGGGGAGGGCGCGGGGGTGG + Intronic
1157555387 18:48610046-48610068 AGAGGGCGTGGGCGGGCTGGGGG + Intronic
1160726788 19:620964-620986 AGGGGGCGCGGGGGCGCCGGGGG + Intronic
1160862634 19:1244235-1244257 TGCGGGGGAGGGAGCGCTGGGGG + Intronic
1160919589 19:1513415-1513437 ACCGGGGATGGGGACGCCGGTGG - Intronic
1160930591 19:1568006-1568028 GGCGGGGGCGGGGGCGGCGGCGG - Exonic
1160967704 19:1753840-1753862 GGCGGCGGTGGGGGCGCCGGGGG + Exonic
1160967827 19:1754311-1754333 GGCGGGGGTGGTGGCGGCGGCGG - Exonic
1160991997 19:1863825-1863847 GGCCGGAGTGGGCGCGCCGGGGG - Intergenic
1160999866 19:1905233-1905255 AGCGGGGCGGGGCGAGGCGGCGG + Exonic
1161006890 19:1941486-1941508 TGTGGGGGCGGGGGCGCCGGGGG - Intronic
1161056745 19:2194605-2194627 AGCGGGGGTGGGGCCGGCGATGG - Intronic
1161072808 19:2270890-2270912 AGCGGGGGCGGGGGGGCGGGCGG + Intronic
1161203682 19:3029338-3029360 CGCGGGGGTGGGCGCGGGGCGGG - Intronic
1161447886 19:4328303-4328325 AGCTGGGGTGGGCGGGCTGGGGG - Intronic
1161802670 19:6424628-6424650 GGCGGGGGCGGGGGAGCCGGAGG - Exonic
1162052256 19:8041664-8041686 AGCGGAGGTGGGAGCCCTGGGGG + Intronic
1162831332 19:13286523-13286545 AGGGGGGGTGGGCAGGCTGGGGG + Exonic
1162895574 19:13763143-13763165 AGGGCTGGTGGGCGAGCCGGGGG - Exonic
1162929875 19:13952543-13952565 AGCGGGGCTGGGAGCGGCGGCGG + Exonic
1162982269 19:14247782-14247804 GGATGGGGTGGGGGCGCCGGTGG + Intergenic
1163051811 19:14690049-14690071 AGCGGAAGTGCGCGCGGCGGCGG + Intronic
1163154492 19:15432532-15432554 GGCGGGGGTGGGGGCGGCGGCGG + Intronic
1163681274 19:18683909-18683931 GGTGGGGGGGGGCGCGGCGGGGG + Intronic
1164818281 19:31223842-31223864 AGCGGGGGTGGGGGTGATGGGGG + Intergenic
1165068380 19:33241644-33241666 AGCGGGTGTGAGTGCGCCTGTGG + Intergenic
1165233869 19:34404859-34404881 AGCGGGCTGGGGCGGGCCGGCGG + Intronic
1165331432 19:35142948-35142970 GGGGGCGGTGGGCGCGCAGGTGG - Exonic
1165493942 19:36141111-36141133 AGCGGGGCCGGGGGCGGCGGCGG + Exonic
1165746011 19:38229720-38229742 AGCGGAGCGGGGCGGGCCGGGGG + Intergenic
1165939887 19:39409770-39409792 AGCGGGGGCGGGCGCGGGGCGGG + Intergenic
1166367247 19:42284016-42284038 GGCGGGGGGAGGCGCGGCGGGGG + Intronic
1166694420 19:44844680-44844702 AGCTGGTGAGGCCGCGCCGGGGG - Intergenic
1166765585 19:45251122-45251144 GGCGGGTCTGGGCACGCCGGCGG - Intronic
1167134634 19:47609417-47609439 CGCGGGGCTGGGGGTGCCGGTGG - Intronic
1167466195 19:49652099-49652121 AGCGGGAGCGGGAGCGGCGGCGG - Exonic
1168056791 19:53868859-53868881 AGGGGAGGGGGGCGCGCCGAGGG - Intronic
1168267331 19:55230020-55230042 AGCGTGGGTGGGGGTGCCAGAGG - Exonic
924962626 2:47170-47192 AGCGGGCGTGGCCGGGCCCGAGG + Intergenic
925013428 2:503470-503492 AGCGGGGGAGGCGGCGCCAGCGG + Intergenic
925271629 2:2613750-2613772 GGCGGGGGTGGGAGGGGCGGTGG + Intergenic
926580880 2:14632485-14632507 AGCGGAGGTGTGCGCACCCGCGG - Intergenic
927714213 2:25341916-25341938 AGGGAGGGAGGGCGCGCGGGCGG - Intronic
928193411 2:29194656-29194678 AGCGGGGGTGGGGGGGTGGGGGG - Intronic
929452636 2:42047710-42047732 AGCGGGGGAGGGGGCGGCGGCGG - Intergenic
929604700 2:43226654-43226676 CGGCGGGGCGGGCGCGCCGGGGG + Intergenic
932812025 2:74833939-74833961 AGCCTGGGGAGGCGCGCCGGGGG - Intergenic
934763790 2:96869548-96869570 ATCGGGGGTGGGAGCGCCGAGGG + Intronic
934765447 2:96877802-96877824 AGCGGGGGTGGATGTGCTGGTGG + Intronic
935592554 2:104855604-104855626 GGCGGGGGTGGCGGCGGCGGCGG + Exonic
937977835 2:127592658-127592680 AGTGGGGGTGGGCGGGGCGGGGG + Intronic
938034868 2:128027627-128027649 AGCGCGGGCGGGCGGGCGGGCGG - Intronic
938727543 2:134120923-134120945 AGCAGGGCTGAGCGCGCCGGCGG - Intronic
939580048 2:143937086-143937108 CGCGCGGGTGGGAGCGCCAGGGG + Intergenic
942450915 2:176107620-176107642 AGCGGGGGCGGCCCCGGCGGGGG + Exonic
942890388 2:180980720-180980742 AGCGGGGGTGGGAGCTCGGCTGG - Exonic
944412417 2:199457618-199457640 AGCGGGGGAGGGGACGGCGGAGG + Exonic
945254445 2:207791910-207791932 AGAGGGGTTGGGCGCGGTGGGGG + Intergenic
946043726 2:216803886-216803908 GGGGGGGGTGGGGGCGCGGGCGG + Intergenic
947741749 2:232487875-232487897 CGAGGGAGGGGGCGCGCCGGCGG + Intergenic
948046853 2:234951936-234951958 GGCGGGGGCGGGGGCGCGGGGGG - Intergenic
948843704 2:240672860-240672882 GGCGTGGCTGGGCGCGCTGGGGG + Intergenic
948947751 2:241229778-241229800 AGGGAGGGTGGGCGGGCAGGCGG - Intronic
948983858 2:241508427-241508449 CGCGGAGGTGGGCGCGCTGCCGG - Exonic
1168757099 20:325509-325531 AGGGGTGGTGCGCGCGCCGGCGG + Exonic
1168800682 20:642112-642134 AGCGGGGGTGGGGTTGCCTGGGG + Intergenic
1170924872 20:20713133-20713155 AAATGGGGTGGGCGCGCAGGAGG - Intergenic
1171473480 20:25390334-25390356 AGCGGGGGTGGGGCTGCCGCGGG + Intronic
1172101214 20:32484572-32484594 GGCGGGGGCGGGCACGCGGGCGG - Intronic
1172404434 20:34677089-34677111 AACTGGGGCGGGCGCGCGGGCGG + Intronic
1172644602 20:36461753-36461775 AGCGCGGGCGGGCGGGCGGGCGG - Intronic
1172684670 20:36744969-36744991 GGGGGGGGGGGGCGCGGCGGGGG + Intronic
1172794242 20:37526276-37526298 AGGGGGGGTGGGGGCGGTGGGGG - Intronic
1173228148 20:41174020-41174042 AGCAGGGGTGGGCTGGCCTGGGG + Intronic
1173827604 20:46057658-46057680 AGCGGCGGGGGGCGCGGCGAGGG - Exonic
1173864903 20:46307589-46307611 GGCAGGGGGGGTCGCGCCGGTGG + Intronic
1174357662 20:50009459-50009481 GGCGGGGGGGGGCGGGGCGGGGG - Intergenic
1176003175 20:62843428-62843450 AGCGGGGGTGGGAGGGCGAGGGG + Intronic
1176281623 20:64316739-64316761 AGCGGGGCGGGGCGCGGCGGGGG + Intergenic
1176304419 21:5115766-5115788 AGCGGGCGTGGGCGCCCGTGAGG + Intergenic
1176547125 21:8206872-8206894 ACCGGAGGAGGGGGCGCCGGGGG - Intergenic
1176550422 21:8218656-8218678 AGGGGGGGGCGGCCCGCCGGCGG - Intergenic
1176555030 21:8251081-8251103 ACCGGAGGAGGGGGCGCCGGGGG - Intergenic
1176566076 21:8389919-8389941 ACCGGAGGAGGGGGCGCCGGGGG - Intergenic
1176573952 21:8434105-8434127 ACCGGAGGAGGGGGCGCCGGGGG - Intergenic
1176577264 21:8445926-8445948 AGGGGGGGGCGGCCCGCCGGCGG - Intergenic
1177792339 21:25734880-25734902 AGCGGAGGTGGTGGCGGCGGAGG - Exonic
1178534911 21:33403356-33403378 GGCGGGGGCGGGGGCGCGGGCGG + Exonic
1178610238 21:34073491-34073513 GGCGGGGCGGGGCGCGCCGAGGG + Intronic
1178948435 21:36966745-36966767 CGCGGGGGTGGGGACGGCGGGGG + Intronic
1179025527 21:37675863-37675885 AGCGGGGGTGGGGGTGGGGGTGG + Intronic
1179852639 21:44146264-44146286 AGCGGGCGTGGGCGCCCGTGAGG - Intergenic
1179958055 21:44752060-44752082 AGTGGGGGCGGGGGCGCCAGGGG - Intergenic
1180069188 21:45427616-45427638 AGGTGGGGTGGGCAGGCCGGCGG + Intronic
1180791399 22:18577461-18577483 AGCGGGGGTCGGCGGGCGAGCGG - Intergenic
1180967313 22:19797344-19797366 AGGGGGGGTGGGGGTGCAGGCGG + Intronic
1181175516 22:21032620-21032642 AGCGGGTGGGGCCGCGCGGGGGG - Intronic
1181230340 22:21417850-21417872 AGCGGGGGTCGGCGGGCGAGCGG + Intronic
1181248310 22:21517013-21517035 AGCGGGGGTCGGCGGGCGAGCGG - Intergenic
1181478066 22:23180756-23180778 CGCGGGGCGGGGCGCGCCGGGGG - Exonic
1182093205 22:27609708-27609730 AGTGGGGGTGGGGGCGGGGGCGG + Intergenic
1182335562 22:29581160-29581182 TGAGGGGGCGGGCGAGCCGGAGG - Exonic
1182552465 22:31107592-31107614 AGCGGGAGTGGGGGCGGGGGCGG - Intronic
1183990534 22:41594408-41594430 GGCGGGGGTGGGGGGGGCGGTGG + Intergenic
1184101576 22:42343941-42343963 GGCGGGGGCGGGCGGGCGGGAGG + Intergenic
1184296970 22:43531039-43531061 AGCAGGGCTGGGCGAGGCGGGGG - Intronic
1184620297 22:45671809-45671831 CGCGGGGGAGGGGGCGCCGGCGG - Exonic
1184795130 22:46727835-46727857 CGCGGGGGTGGCAGGGCCGGGGG - Intronic
1185299913 22:50074183-50074205 AGCGGCGGCGGGCGGGCCAGAGG + Intronic
1203252000 22_KI270733v1_random:123157-123179 ACCGGAGGAGGGGGCGCCGGGGG - Intergenic
1203260054 22_KI270733v1_random:168240-168262 ACCGGAGGAGGGGGCGCCGGGGG - Intergenic
950036583 3:9890510-9890532 GGCGGGGCTGGGCGGGGCGGGGG + Intergenic
950433878 3:12967369-12967391 AGCGGGTGAGGGCGCGGCGCGGG - Exonic
952377656 3:32780901-32780923 AGAGGGGGGCGGCGCCCCGGGGG + Intergenic
952473920 3:33685805-33685827 GGAGGGGGAGGGGGCGCCGGGGG + Intronic
953064429 3:39456140-39456162 AAGGGTGGTGGGGGCGCCGGGGG + Intergenic
954469172 3:50676710-50676732 GGCGGGGGTGGGGGCGTGGGGGG + Intronic
954751668 3:52817512-52817534 AGCGGGGCTGGGCGGTGCGGGGG + Intronic
955356722 3:58237920-58237942 AGCGGAGGCGGGCGGGCGGGCGG + Intronic
956659446 3:71583619-71583641 GGCGGGAGTGGGCGCGCGCGGGG - Intronic
959951648 3:112185659-112185681 AGTGGGGGCGGGTGCTCCGGAGG + Intronic
960914360 3:122681182-122681204 AGCGGAGGTGGCCGGGGCGGGGG + Intronic
961453693 3:127014114-127014136 AGGGTGAGTGGGCGCCCCGGCGG + Exonic
962134630 3:132721536-132721558 TGAGGGGGTGGGCGCGGGGGCGG + Exonic
962318637 3:134374016-134374038 GGCGGGGGTGGGGGTGGCGGGGG - Intronic
966866065 3:184259836-184259858 TGCGGGAGGGGGCGGGCCGGGGG + Exonic
966866544 3:184261519-184261541 GGCGGGGGTGGCGGCGGCGGCGG + Intronic
967983758 3:195080540-195080562 AGCGGGGGTGGGGGGGATGGGGG + Intronic
968454153 4:688778-688800 AGCAGGGCTGGGTGCCCCGGGGG - Intronic
968661807 4:1801762-1801784 CGCGGGGGTGGGGGCGGCAGTGG + Intronic
969550398 4:7862401-7862423 GGGGGGGGGGGGGGCGCCGGCGG + Intronic
969705410 4:8788888-8788910 AGCGGGGGAGGGAGAGGCGGAGG + Intergenic
973754913 4:54064818-54064840 GGCGGAGGGGGGCCCGCCGGCGG - Intronic
977257501 4:94757687-94757709 AGCGGCGGGGTGCGGGCCGGAGG - Intergenic
977694289 4:99949740-99949762 CGCGGGCGTGTGCGCGCCGCAGG - Exonic
978072590 4:104491459-104491481 GGCGGGGGCGGGGGCGGCGGCGG - Exonic
979311883 4:119212774-119212796 AGCGGGGCTGGGCCAGCGGGAGG + Intronic
986330757 5:6714441-6714463 AGGGGCGCTGGGCGCGCCGTCGG - Intergenic
987087975 5:14487499-14487521 AGCGGGGGCGGCGGCGGCGGCGG + Exonic
987087990 5:14487535-14487557 GGCGGGGGTGGGGGCAGCGGCGG + Exonic
989209616 5:38846134-38846156 AGCGGGGACGGGCGGGTCGGGGG - Exonic
991261993 5:64677469-64677491 GGCGGGGGTGGGGGGGCGGGGGG - Intergenic
994043542 5:95284442-95284464 GGCGGGGGCGGGCGCGCTGGGGG - Exonic
994525843 5:100903741-100903763 TGCGGGGGTGGGGACGGCGGTGG + Intergenic
995106540 5:108382073-108382095 GTCGCGGGTGCGCGCGCCGGCGG - Exonic
997899830 5:137754315-137754337 AGCGGAGGTGGCGGCGGCGGCGG - Exonic
997955362 5:138274629-138274651 CGCGGGGGTGGGGGCGGGGGAGG + Exonic
998573054 5:143282468-143282490 GGCGGGGGTGGGGGCGCTGCTGG + Intronic
1001296729 5:170503995-170504017 AGCGGCGGAGGGGGCGGCGGAGG - Intronic
1001688799 5:173616579-173616601 GGCGGTGGTGGGGGCGGCGGCGG + Exonic
1002043499 5:176530121-176530143 GGTGGGGGTGGGGGCGGCGGGGG + Exonic
1002591059 5:180291943-180291965 AGCGGAGCGGGGCGGGCCGGCGG - Exonic
1002691367 5:181052991-181053013 AGGGGGCGGGGGCGCGCCGCGGG - Intronic
1002691376 5:181053011-181053033 GGCGGGGGCGCGCGCGGCGGAGG - Intronic
1002691386 5:181053035-181053057 AGCGGGAGCGCGCGCGGCGGAGG - Intronic
1003426004 6:5998939-5998961 AGTGTGGGTGGGCGCGCGGGGGG + Exonic
1003923532 6:10855758-10855780 AGCAGGGGTGGGCGTGTGGGAGG - Intronic
1004690338 6:17987671-17987693 CGCGGGGCGGGGCGCGGCGGCGG + Intergenic
1004923959 6:20401975-20401997 AGCGGGGATGGAGGCGTCGGGGG - Intronic
1006177513 6:32131309-32131331 GGCGGGGGGGGGCGGGGCGGGGG + Intergenic
1006663961 6:35675884-35675906 AGAGGGGGTGGGCAAGCCTGAGG - Intronic
1006795641 6:36730765-36730787 GGGGGGGGTGGGGGCGGCGGGGG - Intronic
1008760671 6:54848103-54848125 AGTGGGGGTGGGGGTGGCGGTGG + Intronic
1011226614 6:85114982-85115004 GGCGGGGGCGGGGGCGCCGGGGG + Intergenic
1011607330 6:89117981-89118003 AGGGGTGGGGGTCGCGCCGGGGG - Exonic
1015220628 6:130801465-130801487 AGCCGGGGTGGCGGCGGCGGTGG + Intergenic
1015244772 6:131063336-131063358 CGCGGGGGTTTCCGCGCCGGGGG - Intergenic
1017768572 6:157626887-157626909 AGCTGGGGGGGGGGCGGCGGGGG + Intronic
1017891727 6:158644713-158644735 AGCCGGAGGGGACGCGCCGGAGG - Exonic
1018091196 6:160348162-160348184 GGCCGGGGTGGGCGCGCGGTGGG - Intergenic
1018696707 6:166396585-166396607 GGCGGGGGTGGGGGCGGGGGTGG + Intergenic
1018968440 6:168507587-168507609 AGCAGTGGGGGGCGCCCCGGGGG - Intronic
1019112153 6:169724664-169724686 GGCGGGGAGGGGCGCGGCGGGGG - Intronic
1019124083 6:169827694-169827716 ATGGGGAGTGGGCGGGCCGGGGG - Intergenic
1019472815 7:1230228-1230250 GGCGGGGGAGGGCGCGGGGGAGG + Intergenic
1019795179 7:3043636-3043658 AGCGGGGATGGGGGAGCTGGCGG - Intronic
1019989615 7:4682465-4682487 AGCGGCGGTGGCGGCGGCGGCGG - Exonic
1020224909 7:6272440-6272462 AGGTGTGGTGGGCTCGCCGGCGG - Intronic
1020892957 7:13902513-13902535 AGCGGGGGTGGGGGCGCTGGGGG + Intronic
1022230772 7:28410146-28410168 AGCGGGTGGGCGCGCGCCCGGGG + Intronic
1022715146 7:32891882-32891904 GGCGGGGGCGGGGGCGGCGGGGG - Exonic
1023417929 7:39950009-39950031 AGCGGGGCGGGGCGAGGCGGGGG - Intergenic
1026732782 7:72925659-72925681 GGCGGGGGGGAGCGCGGCGGTGG - Intronic
1026899779 7:74030344-74030366 TGCGGGGGTGGGGGAGCAGGAGG + Intronic
1027421317 7:78020089-78020111 GGTGGGGGTGGGGGCGGCGGTGG - Intronic
1027681895 7:81232603-81232625 AGCAGGGGTGGGAGGGCTGGAGG + Intergenic
1028621686 7:92834471-92834493 ATCGGGGGTGGGCGAGCGAGCGG + Intronic
1028773649 7:94655924-94655946 AGCGGGGGAGGGGGAGGCGGCGG + Intronic
1029639857 7:101814224-101814246 CGGGGGCCTGGGCGCGCCGGTGG + Intergenic
1031369738 7:120950598-120950620 AGCGAGGGTTGGCGCGCTGGCGG - Intergenic
1033899043 7:146113666-146113688 GGCTGGGGTGGGGGGGCCGGTGG + Intergenic
1034426794 7:151018272-151018294 GGTGAGGGTGGGCGCGACGGCGG - Exonic
1034994790 7:155570892-155570914 GGCGGGGGTGGGGGCGGGGGCGG - Intergenic
1035028827 7:155844362-155844384 AGCGGGGGAGGGGGACCCGGAGG - Intergenic
1035221696 7:157410108-157410130 AGCGGGCGTGGGCGGTCGGGCGG + Intronic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1037886712 8:22599551-22599573 AGCGGGGCTGGGGGGGCGGGGGG - Intronic
1038644388 8:29350514-29350536 AGCGGAGGGGGAGGCGCCGGTGG + Exonic
1039453884 8:37695807-37695829 AGCGGCGGTGGCGGCGGCGGCGG + Exonic
1039868841 8:41528926-41528948 AGCGGCGGTGTCCGCCCCGGGGG - Intergenic
1039964596 8:42274776-42274798 GGGGGGGGGGGGCGCGCCGGCGG - Intronic
1040404388 8:47086070-47086092 AGCTGGGGTGGGGGGGCCAGGGG + Intergenic
1042253089 8:66775467-66775489 CGCGGGGCGGGGCGCGCGGGCGG + Intronic
1043997943 8:86842685-86842707 AGCGGGGGTTGGCGGGGGGGGGG + Intergenic
1045432150 8:102124158-102124180 AGCCGGGGCGGGTGTGCCGGGGG - Intronic
1049109843 8:140635762-140635784 AGCGGGGCTGGGCGCGCGGGCGG + Intergenic
1049197978 8:141325817-141325839 GGCGGGGGTGGGGGTGGCGGGGG + Intergenic
1049409253 8:142465080-142465102 AGAGGAGGTGGGCGGGCAGGCGG + Intronic
1049571541 8:143372309-143372331 GGCGGGGGTGGGCGGGCCTCAGG + Intronic
1049580137 8:143407388-143407410 AGCGAGGGTGGGCGAGGGGGAGG - Intergenic
1049645377 8:143733644-143733666 AGCGGGGCGGGGCGAGGCGGGGG - Intronic
1049708085 8:144051862-144051884 GGCGGGGGTGGGGGCGGGGGCGG + Intronic
1049760680 8:144330772-144330794 GGTGGGGGCGGGCGGGCCGGCGG + Exonic
1051038287 9:12775851-12775873 AGCGGTGGTGGTGGCGGCGGCGG + Exonic
1052295464 9:26892573-26892595 AGCGGCTGCGGGAGCGCCGGGGG - Exonic
1052971010 9:34377133-34377155 AGGAGGGGCGGGCCCGCCGGCGG - Intergenic
1053452146 9:38202298-38202320 AGCGGGGGTGGGGGTGGGGGTGG + Intergenic
1053482219 9:38424177-38424199 AGCTGCGGGGGCCGCGCCGGCGG - Exonic
1057054253 9:91949326-91949348 GGCGGGGGTGGGGGCGCCGGCGG - Intronic
1058176050 9:101737776-101737798 AGCGCGGCTGGCCGCGCGGGGGG + Exonic
1058843664 9:108934459-108934481 GGCGGGGGTGGCGGCGCCGGAGG + Exonic
1059634193 9:116155468-116155490 AGCGGAGGTGGGGGCGGCGCTGG + Intronic
1060404428 9:123366206-123366228 ACCTGGGGAGGGCGCACCGGCGG - Exonic
1060478021 9:123999924-123999946 AGCCGGGCTAGGCGCGCGGGAGG - Intergenic
1060478092 9:124000094-124000116 AGCGGGGGTGAGGGGGCCGTTGG - Intergenic
1060514543 9:124257833-124257855 AGGGGCGGGGGGCGCCCCGGCGG - Intronic
1060811779 9:126614383-126614405 AGAGCGGGTGGACGGGCCGGCGG + Intergenic
1060832022 9:126722942-126722964 GGCGGGGGCGGGCGCCCCGGGGG - Intergenic
1061293624 9:129665922-129665944 AGCGCGGGTGGAGGCGGCGGCGG - Exonic
1061472171 9:130835338-130835360 GGCGGGGCCGGGGGCGCCGGGGG + Intronic
1061610037 9:131740020-131740042 AGCGGCGGCGGGCGCGCGGGAGG - Intronic
1062306003 9:135907425-135907447 GGCGGGGGCGGGCGCGGGGGCGG + Intergenic
1062343110 9:136102479-136102501 AGTGAGGGTGGGGGCGGCGGTGG + Intergenic
1062537752 9:137028314-137028336 AGCGGGGGCGGGCGGGGCGCGGG - Intronic
1062548959 9:137077351-137077373 AGCGGGGGTGGGCGGGCTCCAGG + Intergenic
1203468403 Un_GL000220v1:106307-106329 ACCGGAGGAGGGGGCGCCGGGGG - Intergenic
1203476224 Un_GL000220v1:150279-150301 ACCGGAGGAGGGGGCGCCGGGGG - Intergenic
1187507126 X:19887212-19887234 AGCCCGGGAGGGCGCCCCGGGGG - Intronic
1187915713 X:24150316-24150338 AGGGGGGGTGGGAGAGCGGGCGG + Intronic
1189281235 X:39821302-39821324 GGCGATGGCGGGCGCGCCGGCGG - Intergenic
1189915488 X:45851610-45851632 GGCGGGGATGGGCGGGCAGGGGG - Intergenic
1190233245 X:48598168-48598190 AGCGGGGGCGGGCACGCCCGCGG + Intronic
1190287785 X:48972090-48972112 AGTGGGGGTGGGGGCCCCTGGGG - Intergenic
1190732611 X:53235123-53235145 GGCGGGGGTGGGGGCGGAGGTGG + Exonic
1190745884 X:53321428-53321450 AGGGGCGGGGGGCGGGCCGGCGG - Intergenic
1191141769 X:57121845-57121867 GGCAGGGGTGGGCGCGGGGGTGG - Intergenic
1192491207 X:71578767-71578789 GGGAGGGGTGGGGGCGCCGGTGG + Intronic
1195779036 X:108440222-108440244 AGCGGTGATGGGCGCGGGGGAGG - Intronic
1195894694 X:109733412-109733434 AGCGGGGGCGGGCGCGTGGGTGG - Intergenic
1197195913 X:123700505-123700527 GGCGGGGCTGGGGGCGGCGGGGG + Intronic
1199453200 X:147996581-147996603 AGCGGGGATGGGGGGGGCGGGGG + Intronic
1200147562 X:153934629-153934651 AACAGGAGTGGGCGCCCCGGAGG + Intronic
1200147779 X:153935304-153935326 GGCGGGGGTGGGGGCGGGGGAGG + Exonic