ID: 1106776996

View in Genome Browser
Species Human (GRCh38)
Location 13:33017592-33017614
Sequence CTGCAGGAAGAGAATGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 584}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106776992_1106776996 14 Left 1106776992 13:33017555-33017577 CCTAGAGGTGAGGGCGGGGAGGA 0: 1
1: 0
2: 1
3: 46
4: 412
Right 1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG 0: 1
1: 0
2: 4
3: 50
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106776996 Original CRISPR CTGCAGGAAGAGAATGAGCA GGG Intronic
901190162 1:7405124-7405146 CTGCAGGAAGTGAGGGAGGAGGG - Intronic
901308730 1:8252491-8252513 CAGCAGGTAATGAATGAGCATGG + Intergenic
902556090 1:17247625-17247647 CTCCTGGAAGAGCAGGAGCAAGG - Intergenic
902709530 1:18229196-18229218 CTGGAGGAAGTGATGGAGCATGG + Intronic
903291992 1:22319807-22319829 CTGCAGGAAGAGAGAGAGGGAGG + Intergenic
904357933 1:29953447-29953469 CTGCAGAAATAGAAAGAGCCTGG + Intergenic
905225049 1:36473479-36473501 GTGCAGGCAGAGAATGCGCTGGG - Exonic
905300813 1:36985217-36985239 CTCCAGGAAGAGACTGAGATGGG + Intronic
905490470 1:38339689-38339711 TGGCAGGAAGAGAAAGAGCTTGG - Intergenic
905524100 1:38623608-38623630 CTGCATGAAGTGACTGAGCCAGG + Intergenic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
906033330 1:42736604-42736626 CTGAAGGCAGAGAAGGAACAGGG - Intronic
906566765 1:46806468-46806490 CTGCAGAAAGAGACTAAGCCAGG + Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906825212 1:48972006-48972028 CTGCATTGAGAGAATGATCAAGG + Intronic
907049216 1:51318383-51318405 CTGCAGCAAGAGCATGACCATGG - Intronic
907195601 1:52684072-52684094 CAGGAGCAAGAGAGTGAGCAAGG - Intergenic
907263234 1:53237828-53237850 CTGCAGGGCGGGAATGAGCTAGG - Intronic
907389598 1:54149617-54149639 CTAAAGGGAGAGAAGGAGCATGG - Intronic
907460999 1:54605376-54605398 CTTAGGGAAGAGACTGAGCACGG + Intronic
907595687 1:55717896-55717918 CAGAAGGCAGAGTATGAGCATGG + Intergenic
908970198 1:69819477-69819499 CTGCAGGAAGATTATATGCAAGG - Intronic
909419349 1:75446127-75446149 CTGCATGTAGAGAATGAACCAGG - Intronic
910546084 1:88420752-88420774 TGGCAGGAAGAGCAAGAGCATGG + Intergenic
912458707 1:109817276-109817298 CAGCAGGAAGAGAATATGGAAGG - Intergenic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
914220728 1:145679607-145679629 CTGGTGCAACAGAATGAGCATGG + Intronic
914243369 1:145867717-145867739 CTCCAGGAGGAGACTGAGAAAGG + Intronic
914473305 1:148002480-148002502 CTGGTGCAACAGAATGAGCATGG + Intergenic
914643309 1:149631409-149631431 TTTAAGGAAGGGAATGAGCAAGG + Intergenic
915653131 1:157334276-157334298 CTGCAGCAAAGGAGTGAGCAGGG - Intergenic
915825654 1:159073237-159073259 CTTCAGGAGGAGAAGGAGAAAGG - Exonic
916539699 1:165740882-165740904 CTGCAGGAAGGCCAAGAGCATGG - Intronic
916911034 1:169346588-169346610 CTACGGGAAAAAAATGAGCAGGG - Intronic
917685163 1:177408402-177408424 CTGAAGGATGAGAGTGAGCAGGG - Intergenic
917911686 1:179654345-179654367 CTGAAGGAAGAAAATGAGGTAGG + Exonic
919151257 1:193702139-193702161 CAGCAGTAAAAGAATCAGCAGGG - Intergenic
919448297 1:197737988-197738010 CTGCGGGAAGAAAATGAGCTGGG - Intronic
920166457 1:204039674-204039696 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
920449759 1:206051087-206051109 AAGAAGGAAGAGAAAGAGCAGGG - Intronic
921243354 1:213209741-213209763 CTGTAGGCAGAGTAGGAGCATGG + Intronic
922564049 1:226589717-226589739 CTCCAGGAACAGCATGCGCAGGG + Intronic
923152298 1:231244259-231244281 CTGTAGGAAGAGAATCAGGTTGG + Intronic
924391839 1:243569196-243569218 CTGCAGAAACTGAATGACCATGG + Intronic
1062813910 10:485310-485332 CTGCGAGAAGAGAATGAGGGAGG + Intronic
1062983240 10:1743499-1743521 CAGCAGGGAGAGGAAGAGCAAGG + Intergenic
1063635014 10:7774052-7774074 GTGCAGGAAGGAACTGAGCATGG - Intronic
1063883443 10:10553812-10553834 CTGCTGGAGGAGAAAGAGCTTGG + Intergenic
1064106227 10:12502849-12502871 CTCCAAGGAGAAAATGAGCATGG - Intronic
1064750200 10:18520693-18520715 CGGCAGGGTGAGAATGAGCGAGG - Intronic
1064977227 10:21130343-21130365 CAGCAGGCAGAAAATCAGCAAGG + Intronic
1065598401 10:27341339-27341361 TTGAAGGCAGAGAAAGAGCATGG - Intergenic
1065686826 10:28293958-28293980 CTGCAGAAAGAAAATGAACCAGG + Intronic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1066541031 10:36447084-36447106 CTGCATGAAGAAGAAGAGCAGGG - Intergenic
1067277651 10:44849403-44849425 CAGCAGAGAGTGAATGAGCAAGG - Intergenic
1067318461 10:45194340-45194362 TTGAAGGCAGAGAAAGAGCATGG - Intergenic
1067349550 10:45463493-45463515 CTGCTGGAAGAGAAGGCGGATGG - Exonic
1067581855 10:47451355-47451377 CTGCAGAAAGACAAGAAGCAGGG + Intergenic
1067842533 10:49692334-49692356 CTTCAGAAAGAGACTCAGCAAGG - Intronic
1067995916 10:51273167-51273189 CTGCAGGAAGAAAGATAGCAGGG - Intronic
1068487740 10:57681224-57681246 TTACAGGAAGAAAATGAGCAGGG - Intergenic
1068539570 10:58276095-58276117 CTGCAGGAAGAAGTTGAACAGGG - Intronic
1069177915 10:65316963-65316985 CTGCACAAAGAAAATGAGGAAGG + Intergenic
1069950343 10:72014367-72014389 CTGCAGGAAGAGGCAGAGGAGGG + Intergenic
1070102209 10:73399076-73399098 ATGAAGGAAGAGAGAGAGCATGG - Intronic
1070191951 10:74119040-74119062 CTGCAGGCAGTGACTAAGCATGG - Exonic
1070667129 10:78353186-78353208 CTGCAAAAGGAAAATGAGCAAGG - Intergenic
1070737196 10:78871322-78871344 TAGAATGAAGAGAATGAGCAGGG - Intergenic
1071156044 10:82690919-82690941 TGGAAGAAAGAGAATGAGCAGGG - Intronic
1071510355 10:86257840-86257862 CTCCAGGAAGATAAAGAACAGGG + Intronic
1071948694 10:90678052-90678074 ATGCAGAAAGAGAAAGAGTATGG - Intergenic
1072236873 10:93461141-93461163 CTTCAGGATGAGAATGAGACAGG - Intronic
1072422039 10:95297333-95297355 CAGCAGGGACAGAATGAACAAGG + Intergenic
1072669514 10:97419124-97419146 CTGCCGGAAAAGAAAGAGGAGGG - Intronic
1072740685 10:97907345-97907367 CTGCAGGTAGAGAAGGGGGAGGG + Intronic
1073178624 10:101570837-101570859 CAGCAGGAAGGGGAAGAGCATGG + Intronic
1073612158 10:104955207-104955229 CTGCAGGAAGAAAATGCCGACGG - Intronic
1073948125 10:108776040-108776062 CTGCAGGCATTGAATGAGAAAGG - Intergenic
1074735641 10:116429803-116429825 CTGCAGGTAGAGAAGGAAGATGG + Intronic
1074944124 10:118264704-118264726 TAGCAGGAAGAGAAGGAGCAGGG + Intergenic
1075977057 10:126705223-126705245 CTGCAGGAATAAAGTGAGCAAGG - Intergenic
1076110235 10:127854663-127854685 CAGCAGCAAGTGAATGGGCATGG + Intergenic
1076476446 10:130756997-130757019 CTGCAGGAAAGGAAAGAGGAAGG + Intergenic
1078355643 11:10629712-10629734 CTGCAGAAGGAGGATGAGCTGGG + Intronic
1078391528 11:10939187-10939209 ATGAAGGATGAGAGTGAGCAGGG - Intergenic
1078710932 11:13790260-13790282 CAGCTGGAAGAGAGTGGGCATGG - Intergenic
1079252043 11:18793521-18793543 CTGCATGGAGAAAATGAGGAGGG - Intergenic
1079373862 11:19874339-19874361 CCACAGGAAGAGAAAGAACAGGG + Intronic
1079387452 11:19993330-19993352 CTGCAAGAAGAAAGAGAGCATGG + Intronic
1079388141 11:19998734-19998756 CTGAAGGAAGAGAATAAGCCAGG - Intronic
1081216334 11:40403787-40403809 CTGCTTGTAGAGAATGAGCCTGG - Intronic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1081763577 11:45593762-45593784 CTGCAGGAGAGGAGTGAGCAAGG + Intergenic
1082898841 11:58223532-58223554 CTGGATGAAGGGAATGAGCAGGG + Intergenic
1082899997 11:58237748-58237770 CTGAAGGAAGAGTAGAAGCATGG - Intergenic
1082967094 11:58977310-58977332 CTGCAGGAAGTGATACAGCATGG + Intronic
1083397503 11:62401723-62401745 CTGCAGGAAGAGAGAGGGCAGGG + Intergenic
1083533541 11:63447622-63447644 CTGTTGGAAGAAAAAGAGCAAGG + Intergenic
1083877418 11:65531658-65531680 CTGCAGGAGGCGGATGCGCATGG - Exonic
1083935121 11:65865963-65865985 CTGCAGGAAGAGAGGCAGCGAGG - Intronic
1084279034 11:68074354-68074376 CTACAGTCAGAGACTGAGCAGGG + Intronic
1084305921 11:68283227-68283249 CTGCTGAAAGAGAATGAGGTGGG - Intergenic
1085816064 11:79738796-79738818 GTGGAGGAAGAGAAGGAGGATGG + Intergenic
1085919204 11:80931612-80931634 CTGAAGGGTGAGAATGAGCTTGG + Intergenic
1086330514 11:85749424-85749446 CTTCAGGCAGAGAATGTGAATGG + Intronic
1086399681 11:86450249-86450271 CTCCAGGAAGAGAATAAGAATGG - Intronic
1087946431 11:104165099-104165121 GAGCAGGAACAGACTGAGCAAGG + Intergenic
1088238724 11:107752138-107752160 CTGGAGGAAGAGAAAGACCTTGG - Intergenic
1088522810 11:110717592-110717614 CTGAAGAATGAGAATAAGCAAGG + Intergenic
1088630114 11:111766358-111766380 CAGCAGGAGGAGAAAGAACATGG - Exonic
1088751689 11:112847548-112847570 CTTCAGGAAGAGGAAGAGTAAGG + Intergenic
1088813127 11:113404856-113404878 CTCCAGGAAGAGAATGATAATGG + Intergenic
1088841901 11:113634507-113634529 GTGCAGAAAGGGAAGGAGCAGGG - Intergenic
1089223942 11:116899694-116899716 CTACACTAAGACAATGAGCAAGG + Intronic
1089890052 11:121871749-121871771 CTGAAGGGAAAGAATGAGCAAGG + Intergenic
1090057100 11:123432718-123432740 CAGCAGGAAAAGAATGAGGTTGG + Intronic
1090861068 11:130652850-130652872 CAGCAGTAAATGAATGAGCATGG + Intergenic
1091801628 12:3328201-3328223 CTGCAGGTAGAGCAGGAGCTGGG - Intergenic
1092057303 12:5518748-5518770 CTGCAGGGAGAGAAAGAGCTGGG + Intronic
1092210811 12:6645338-6645360 CTGCAGGAAGAGAAGGAAAATGG + Intronic
1093239348 12:16650110-16650132 CAGCAGGAAGAAAATTAGTAAGG + Intergenic
1093912031 12:24759303-24759325 CTGCAAGAAGATAAAGAGAAAGG - Intergenic
1094503502 12:31040754-31040776 CTAAAAGAAGAGAAAGAGCATGG - Intergenic
1096231545 12:49899556-49899578 CTGAAAGAATAGAATGTGCAGGG - Intronic
1096323967 12:50641640-50641662 CCACAGGAAGGGAAGGAGCAAGG + Intronic
1097092917 12:56521823-56521845 CTGCGGGCAGAGAATGAGCTCGG - Intergenic
1098169284 12:67730322-67730344 CTCCTGGGAGATAATGAGCAAGG + Intergenic
1099149171 12:79087585-79087607 TTGCAGGCAAAGAATGAGTAAGG + Intronic
1100469255 12:94874829-94874851 CTGCGGGAAAAAAATGAGAAGGG + Intergenic
1100600224 12:96106629-96106651 CTCCAGGATGAAAATGAACAAGG + Intergenic
1101322923 12:103689132-103689154 CTGCAGGAACAGTTTCAGCATGG - Intronic
1101751967 12:107589367-107589389 CTGCTGGAAGAAAATCAGCTGGG + Intronic
1101951943 12:109183864-109183886 CTGAAGGAAGAAAAAGAGGAAGG - Intronic
1102734209 12:115143731-115143753 CTGAAGGAAGTGAATGAACTAGG + Intergenic
1102747807 12:115265319-115265341 TTGCAGAAAGAAGATGAGCATGG + Intergenic
1103260460 12:119584037-119584059 CTCCACAAAGAGCATGAGCAAGG + Intergenic
1104417480 12:128607249-128607271 GGGCTGGAGGAGAATGAGCAAGG + Intronic
1104646231 12:130499570-130499592 GTGCAGGAGTAGAATGAACACGG - Intronic
1105224148 13:18413019-18413041 TTGAAGGCAGAGAAAGAGCATGG + Intergenic
1105309013 13:19189883-19189905 CTGATGGAAGGGAATGAGAAGGG - Intergenic
1105837447 13:24223673-24223695 CTACAGGAGGAGCAAGAGCACGG + Exonic
1106227062 13:27793588-27793610 CAGCAGCAAGAGGATGCGCACGG + Exonic
1106463424 13:29992281-29992303 CAGGAGCAAGAGAATGAGAAGGG - Intergenic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1107230127 13:38098934-38098956 CTGGAGCAAGAGAGAGAGCAGGG + Intergenic
1107901146 13:45015729-45015751 CTGGAGGAAGAGTATGAGGAAGG + Intronic
1107963399 13:45578352-45578374 TTGCAGGAGGAGAAAGAGCTTGG - Intronic
1108642465 13:52395525-52395547 CTGGAGGCAGGGAACGAGCAGGG + Intronic
1108721855 13:53140372-53140394 CTGCAGGATGAGAGTGTGCGAGG - Intergenic
1109467053 13:62748930-62748952 CTGCAGGCAGAGAGTAATCAAGG - Intergenic
1110240628 13:73262501-73262523 CAGGAGGAAGAGAGAGAGCAAGG + Intergenic
1112722881 13:102265141-102265163 ATGGAGGATGAGAATGAGAAAGG - Intronic
1114057346 14:18983390-18983412 CTGCCAGAAAAGAAAGAGCAAGG + Intronic
1114105200 14:19418357-19418379 CTGCCAGAAAAGAAAGAGCAAGG - Intronic
1114158900 14:20140413-20140435 TAGCAGGAAGAGAATGGGGAAGG + Intergenic
1114310731 14:21464505-21464527 CCACAAGAAGAGAATGAGCCAGG + Intronic
1114405380 14:22451359-22451381 CTGCAGGGAGAAAAGGGGCAGGG + Intergenic
1114739014 14:25075267-25075289 CTTCAGGCTGAGAATGAGCCTGG + Intergenic
1116161530 14:41271778-41271800 CTGCATGTAGAGAATGAATATGG - Intergenic
1116474913 14:45328631-45328653 CAGCAGGATAAGAATGAGCAAGG + Intergenic
1118321578 14:64756591-64756613 CTGAAGGAAAATAAAGAGCAGGG - Intronic
1119667944 14:76498415-76498437 CTCCAGGAAGAGTTTGTGCATGG - Exonic
1119672702 14:76531518-76531540 CTTCAGGCACAGAATGATCAAGG - Intergenic
1119738542 14:76999357-76999379 CTGGAGGAAGAGGATGAGGGTGG - Intergenic
1119970905 14:78969198-78969220 CTACAGGAACAGGCTGAGCATGG - Intronic
1119995933 14:79253681-79253703 CGGCAGGAAAAGAAAGAGCGAGG + Intronic
1120491475 14:85183962-85183984 CGGCTGGAAGAAAGTGAGCAGGG - Intergenic
1120979529 14:90278024-90278046 GCACAGGGAGAGAATGAGCAAGG + Exonic
1121288250 14:92753388-92753410 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1121557320 14:94848260-94848282 TTGGAGGATGAGAATGAGAACGG + Intergenic
1121610041 14:95272303-95272325 CTCCAGGAAGAGGAGGAGGAGGG + Intronic
1121813108 14:96908722-96908744 CGGGAGGAAGAGGAAGAGCAAGG + Intronic
1122069189 14:99194708-99194730 CTACAGGAAGTGAAGGAGCTGGG + Intronic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1123058603 14:105584232-105584254 CAGCAGGAAGAGGGTGAGGAAGG + Intergenic
1123082934 14:105704466-105704488 CAGCAGGAAGAGGGTGAGGAAGG + Intergenic
1123116614 14:105897695-105897717 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1123164771 14:106315666-106315688 CAGCAGGGAGAGGGTGAGCAGGG - Intergenic
1123391489 15:19878446-19878468 TTGAAGGCAGAGAAAGAGCATGG + Intergenic
1123403614 15:20008143-20008165 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1123512950 15:21014788-21014810 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1124155530 15:27222068-27222090 CTCCAGGAAGAAAATGAGGAGGG - Intronic
1126369742 15:47933241-47933263 CTGTGGGAAGAGAGTGAGTAAGG - Intergenic
1126625208 15:50679823-50679845 CAGCAGGAAAAGACTGGGCATGG - Intronic
1128278216 15:66372226-66372248 CTTGAGGAAGAGAGTGAGGAAGG - Intronic
1128611932 15:69081030-69081052 TTGCAGGAAGAAATAGAGCAAGG - Intergenic
1128650419 15:69408248-69408270 TAGCATGAAGAGAATGAGCGTGG - Intergenic
1129301053 15:74625779-74625801 CTGGAGGAGGAGGATGGGCAGGG - Intronic
1131463974 15:92639758-92639780 CAGGAGCAAGAGAAAGAGCAAGG - Intronic
1132086194 15:98910201-98910223 TTGCAGGGATAGAGTGAGCAGGG - Intronic
1133358964 16:5158465-5158487 CGGGAGCAAGAGAATGAGGAGGG - Intergenic
1133657029 16:7875439-7875461 CTGCAGGAAGACATGGAGAAGGG + Intergenic
1133863567 16:9619845-9619867 CTGAAGGAAGAGCTGGAGCATGG - Intergenic
1134264919 16:12684586-12684608 TTGGAGGAAACGAATGAGCAGGG - Intronic
1135559695 16:23466781-23466803 GTGAAGGAAGAGGATGAGGATGG + Exonic
1135774412 16:25243845-25243867 TTGCAGTGAGAGAATGAGCGAGG - Exonic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1137705762 16:50534779-50534801 CCGAAGGAAGAGAATGACCATGG - Intergenic
1137792900 16:51189943-51189965 CAGCAAGAAGTGCATGAGCATGG - Intergenic
1138070568 16:53989233-53989255 CTTCAGGAATAGAATGAACAGGG + Intronic
1138090400 16:54169137-54169159 CTGCAGAAAGAAAATGAAAATGG - Intergenic
1138299262 16:55912612-55912634 GAGGAGGAAGAGAAGGAGCAGGG + Intronic
1139558541 16:67727734-67727756 CTGCAGGTACAGGATGAGCCGGG - Exonic
1139820493 16:69717319-69717341 CTGCAGGAACACATTCAGCAGGG + Intronic
1141426106 16:83945814-83945836 CTGCACGCGGTGAATGAGCAAGG + Intronic
1143508773 17:7384046-7384068 CCGCAGGAAGAGGCAGAGCAGGG - Exonic
1144191876 17:12853941-12853963 CTGCGGGAACAGAATGAGCTGGG - Intronic
1144381211 17:14700630-14700652 CTGCAAGGTGAGAGTGAGCAGGG - Intergenic
1144617038 17:16786156-16786178 CTGCAGTAACAGAAATAGCATGG + Intronic
1144895655 17:18529518-18529540 CTGCAGTAACAGAAATAGCATGG - Intergenic
1144968622 17:19093395-19093417 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1144979293 17:19158668-19158690 TTGCAGGAAGAGGAGGAGGAGGG - Exonic
1144988929 17:19219564-19219586 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1145136563 17:20414713-20414735 CTGCAGTAACAGAAATAGCATGG + Intergenic
1146290544 17:31603476-31603498 CTGGAGGATGAGAAGGGGCAGGG - Intergenic
1146924772 17:36736552-36736574 CTGCAGGGTGAGAATGAGAAAGG + Intergenic
1147884461 17:43675501-43675523 CTGGAGGAAGAGAATGAACTTGG + Intergenic
1148184775 17:45634182-45634204 CAGCTGGAACAGAATGAGCAGGG + Intergenic
1148293212 17:46475253-46475275 CTGCAAGCAGAGAGGGAGCATGG + Intergenic
1148315397 17:46692956-46692978 CTGCAAGCAGAGAGGGAGCATGG + Exonic
1148437011 17:47693105-47693127 CTGCAGGTAGAGAATGATCAGGG - Intergenic
1150178354 17:63087187-63087209 CTGTTGGAAGAGACAGAGCAAGG - Intronic
1150347000 17:64411997-64412019 CTGAAGGAAGAGGAACAGCAGGG + Intronic
1150410431 17:64937056-64937078 CTCCAGGAATAGGATGGGCATGG - Intergenic
1150456527 17:65310881-65310903 CTGAAGGAGGAGAAGGAGCTAGG + Intergenic
1150600794 17:66649272-66649294 GTGCAGGCAGATAATGGGCATGG - Intronic
1151385916 17:73755258-73755280 CTGCAGCCAGAGACTTAGCAAGG + Intergenic
1151699910 17:75737571-75737593 CGGCAGGAGGAGGAGGAGCAGGG - Exonic
1151758432 17:76087703-76087725 CTGCAGGAAGAGGATGGCCTGGG + Exonic
1151955676 17:77379047-77379069 CTGCTGGATGAGAATGTTCAGGG - Intronic
1152499225 17:80697100-80697122 CTACAGTCAGAGAGTGAGCAAGG + Intronic
1154218240 18:12431434-12431456 CTGCAGGGAGAGAAGGGGCTGGG - Exonic
1154475546 18:14752458-14752480 TTGAAGGTAGAGAAAGAGCATGG + Intronic
1154529158 18:15326093-15326115 TTGAAGGCAGAGAAAGAGCATGG - Intergenic
1154999645 18:21673967-21673989 CTGCAACAAGAGAATAAGTAGGG + Intronic
1155571434 18:27198013-27198035 CTGGAGGCAGAGAATGAGTGAGG + Intergenic
1156004074 18:32419447-32419469 TGGCAGGAAGAGAATGAGAGAGG - Intronic
1158080169 18:53580939-53580961 TTACAGGAAGAGAAAGAGGAAGG + Intergenic
1158865709 18:61636107-61636129 ATGAAAGAAGAGAAGGAGCAAGG + Intergenic
1159231027 18:65606815-65606837 CAGGAGGAAGAGAATGAAGAGGG - Intergenic
1159502803 18:69295431-69295453 CAGAAAGAAGAGAAGGAGCAAGG + Intergenic
1159807543 18:72974352-72974374 TGGCTGGAACAGAATGAGCAGGG - Intergenic
1159898604 18:74021053-74021075 CAGGAGGAAGAGAGAGAGCAAGG + Intergenic
1160103582 18:75947128-75947150 ATGCGGGAAGACAATGAGCTGGG - Intergenic
1160242491 18:77133203-77133225 CTGCAGGAGGAGAGTCAGCCCGG + Intronic
1161408214 19:4102242-4102264 CTGCAGAAAGAGAGTGGCCAAGG - Intronic
1161457330 19:4376015-4376037 CTGCAGGAAGAGACTGGAAATGG + Intronic
1161663797 19:5562986-5563008 CTGCAGGAAGAGAGGGAGTTGGG + Intergenic
1161681567 19:5682273-5682295 AGGCAGGGAGAGAATGAGTATGG + Intronic
1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG + Intronic
1162543001 19:11309410-11309432 GTGCTGGAACAGAGTGAGCAAGG - Intronic
1162550077 19:11353769-11353791 CTGCAAGAAGACAAGGAGCTGGG - Intronic
1162823015 19:13234790-13234812 CTGCCAGAAGAGAAGGAGGAGGG + Intronic
1163067470 19:14809370-14809392 CTGCAGGAAGAGAGTGGCCCTGG + Intronic
1163545051 19:17936387-17936409 CTGCGGGAAGAGGATGGGGATGG - Intronic
1163571815 19:18086773-18086795 CAGCAGGAAGAGGAAGAGGAGGG + Exonic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1163857877 19:19720171-19720193 CAGCAGGCAGAAAATGAGGAAGG + Intronic
1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG + Intergenic
1164705300 19:30314922-30314944 CTGCAGGTAGAGAGCCAGCAGGG - Intronic
1166053433 19:40274710-40274732 CTGCAGGCAGGGGAGGAGCAGGG + Intronic
1166785152 19:45363153-45363175 GGGCAGGCAGAGAATGACCAAGG - Intronic
1166993375 19:46706440-46706462 CTGCAAGAAGAGCTTCAGCAGGG + Intronic
1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG + Intergenic
1167516878 19:49928846-49928868 CTGCGGGAAGAGAATGAGGCTGG + Exonic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
1167618904 19:50550743-50550765 CTGCAGGAGAAAAATGAGCCCGG - Intronic
1167781360 19:51601238-51601260 CCGCAGGAAGTTCATGAGCACGG - Intergenic
1168078889 19:53994833-53994855 CTGCAGAAATAAAATGATCAAGG - Intronic
925501296 2:4507986-4508008 CTGCAGGATGAGAGTTACCAGGG - Intergenic
925572918 2:5330739-5330761 CTGCAGGCGGAAAATAAGCAGGG + Intergenic
925594149 2:5538874-5538896 CTGCAGGACGAGCAAGACCACGG - Intergenic
926681202 2:15665359-15665381 CAGCAGGAACAGAGTGACCAGGG + Intergenic
927127208 2:20022770-20022792 CTGCAGTAAGAGCAGGTGCAAGG + Intergenic
927365909 2:22296106-22296128 ATGAAGGGAGAGAAGGAGCAGGG - Intergenic
928132967 2:28666740-28666762 CTCCAGGGAGAGCATGGGCAGGG + Intergenic
928299830 2:30115315-30115337 CTGCTCGAGGAGGATGAGCAAGG + Intergenic
928952626 2:36826510-36826532 CTAGAGGAAAAGAAGGAGCAGGG - Intergenic
928979373 2:37122313-37122335 CTGCAGCAAGAGGAGGAGCAAGG + Intronic
930049827 2:47206367-47206389 AAGCAGGAAGTGAATGGGCAAGG - Intergenic
930218595 2:48722587-48722609 CAGTAGGAAGAGAGAGAGCAGGG - Intronic
931431768 2:62214224-62214246 CTGTGGGAACAGCATGAGCAGGG + Intronic
931766256 2:65459164-65459186 CTGCTGGAAGAGACTGTGAAGGG - Intergenic
931988399 2:67764029-67764051 CTGTTGGAAGAGAAGTAGCAAGG - Intergenic
932109991 2:68989991-68990013 TTGGAGGAAGAATATGAGCAAGG - Intergenic
932130343 2:69181780-69181802 CTGCAGGAAGAAGATGATGATGG + Exonic
932812806 2:74838302-74838324 CTGCAGGAAGTGGAGGAGCTGGG + Intronic
933191535 2:79339117-79339139 CTGTAGGGAGAGAGTGAACAGGG + Intronic
933998806 2:87689324-87689346 CTGAAGGAAGAAAATGACCCTGG - Intergenic
934523242 2:95032985-95033007 CAGCGGGAAGAGAAGGTGCAGGG + Intronic
934979219 2:98826484-98826506 CTGAAGGAAGTGAACGGGCAGGG + Intronic
936295041 2:111261554-111261576 CTGAAGGAAGAAAATGACCCTGG + Intergenic
936500168 2:113060575-113060597 CTGCTGGAAGAGAAGCTGCACGG - Intronic
936856022 2:116958163-116958185 CAGGAGGAAGAGAGAGAGCAGGG + Intergenic
936921332 2:117691707-117691729 CTGCAGCAAATAAATGAGCAAGG + Intergenic
936958679 2:118049891-118049913 AAGCAGAAAGAGAATGAGTATGG - Intergenic
937244788 2:120485656-120485678 CACCAGGAAAAGAATGAGCAGGG - Intergenic
937503917 2:122514725-122514747 TTGAAGGAAGAGAATGATCGAGG - Intergenic
937742495 2:125373046-125373068 CTTCAGAAATACAATGAGCAGGG - Intergenic
938129974 2:128706886-128706908 CAGAGGTAAGAGAATGAGCAGGG + Intergenic
938283797 2:130090102-130090124 CTGCCAGAAAAGAAAGAGCAAGG - Intronic
938334445 2:130478666-130478688 CTGCCAGAAAAGAAAGAGCAAGG - Intronic
938355379 2:130642002-130642024 CTGCCAGAAAAGAAAGAGCAAGG + Intronic
938431810 2:131248791-131248813 CTGCCAGAAAAGAAAGAGCAAGG + Intronic
938475479 2:131607380-131607402 CTGCCAGAAAAGAAAGAGCAAGG + Intergenic
938475534 2:131608234-131608256 CAGCAGCAAGAGCAGGAGCAAGG - Intergenic
938528260 2:132157509-132157531 TTGAAGGCAGAGAAAGAGCATGG - Intronic
938830507 2:135045834-135045856 CTGGAGGAAGACAATGAAGATGG + Intronic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
939983680 2:148810526-148810548 CTGAAGGAAGAGAAATATCACGG - Intergenic
940033976 2:149293969-149293991 CTGAAGGATTAGAAGGAGCAGGG + Intergenic
940148872 2:150577621-150577643 CAGCAGGAAGAGAGAGAGGAGGG + Intergenic
940683303 2:156813854-156813876 CGGCAGGCAGAGAATGGGTACGG - Intergenic
941024873 2:160447386-160447408 CTGCAGGAAGAAAATGAAACAGG + Intronic
941221026 2:162781511-162781533 CTAGTGGAAGAGAATGAGGAAGG + Intronic
941853108 2:170204002-170204024 CCCCAGGAAGAGAATGAGATGGG + Intronic
941966763 2:171308212-171308234 CTGCAGGAATCTAAAGAGCAGGG + Intergenic
942145635 2:173023768-173023790 CTCAAGGAAAAGAAGGAGCAAGG + Intronic
942471499 2:176265420-176265442 CAGGAGGAAGAGAAAGAGAAGGG - Intergenic
943619980 2:190138572-190138594 CAGCTGTAAGAAAATGAGCAAGG - Intronic
944388759 2:199194931-199194953 GAGGAGGAGGAGAATGAGCAGGG - Intergenic
945328987 2:208517117-208517139 CTTCAGGAAGATATTGAACATGG - Intronic
945893606 2:215457474-215457496 ATGCTGGGAGAGAATGACCAAGG - Intergenic
946007767 2:216540203-216540225 GTGAAGGAAGAGAATCAGCTTGG - Intronic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
947496746 2:230643264-230643286 CTGCAGGACTAGAGTGGGCAGGG - Intergenic
947593669 2:231398228-231398250 CAGCAGGAAGAGGGTGCGCACGG - Exonic
947841413 2:233210151-233210173 ATGGAGGAAGAGCATGAGCTGGG - Intronic
948927517 2:241108795-241108817 CTGCAGGACGAGACTGAACAGGG + Intronic
1169231272 20:3889999-3890021 CCTCAGGAAGAGAATGCCCAAGG - Intronic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170532683 20:17310074-17310096 CAGGAGCAAGAGAAAGAGCAAGG + Intronic
1170930517 20:20766219-20766241 CAGCAGGAAGAGCATGAAAATGG - Intergenic
1171284031 20:23923288-23923310 CTGCAGGAAGTGAAATAGAATGG + Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172123044 20:32609692-32609714 GTGGAGGGAGGGAATGAGCATGG - Intergenic
1172133678 20:32673204-32673226 CGGCAGGAAGAGGCTGAGCTGGG + Intergenic
1172893842 20:38285683-38285705 CAGGAGGAAGAGAAAGAGCAGGG - Intronic
1173597501 20:44268659-44268681 CTGAAGGATGAGAAGGAGCCTGG + Intronic
1174197842 20:48786047-48786069 CAGCAGGAAGAGAATGGGGCTGG + Intronic
1175227365 20:57452437-57452459 CTGAATGGAGAGAATGAGCCAGG + Intergenic
1175324608 20:58114395-58114417 CACCAAGAAGAGAATGAGCCCGG + Intergenic
1176768240 21:13042394-13042416 TTGAAGGCAGAGAAAGAGCATGG + Intergenic
1177249359 21:18572220-18572242 AAGCAGGAAGAGAAGGAGGATGG + Intergenic
1178081390 21:29069665-29069687 CTGCAGTCAGAGAATGCCCATGG - Intronic
1178288442 21:31345658-31345680 CTAAAGGAACAGAATGGGCACGG + Intronic
1178513149 21:33224142-33224164 CAGCAGGGAGAGAATCAGTAAGG - Intergenic
1178746112 21:35251763-35251785 TTGGAGGAAGAGGATGTGCAAGG + Intronic
1179280960 21:39933933-39933955 TTGCAAGAAGAGAAAGAGCTGGG - Intergenic
1180020350 21:45120655-45120677 CTGGAGGAAGACAATAAGCTCGG - Intronic
1180128942 21:45812899-45812921 TTGCACAAAGAGAATGAACAGGG - Intronic
1180475835 22:15705999-15706021 CTGCCAGAAAAGAAAGAGCAAGG + Intronic
1180515371 22:16136621-16136643 TTGAAGGCAGAGAAAGAGCATGG + Intergenic
1180784024 22:18536975-18536997 CAGCAGGCAGAGAAAGAGAAGGG + Intergenic
1181127592 22:20711023-20711045 CAGCAGGCAGAGAAAGAGAAGGG + Intronic
1181240924 22:21476327-21476349 CAGCAGGCAGAGAAAGAGAAGGG + Intergenic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182354198 22:29714945-29714967 CTGCTGGGAGAGAAGGAGGAGGG + Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182855727 22:33516169-33516191 CTGCAGGAAATGAAGGAGCGAGG + Intronic
1183843068 22:40516487-40516509 GAGAAGGAAGAGAATAAGCAAGG + Intronic
1184186962 22:42871430-42871452 ATGGAGGACGAGGATGAGCAGGG - Exonic
1184999327 22:48234407-48234429 CTGCATGAACTGAATGATCAAGG - Intergenic
1185193576 22:49453982-49454004 CTGCTGGTAAAGAAGGAGCAGGG + Intronic
949230168 3:1741505-1741527 CTACAGGTTGAGAATGAGAAAGG + Intergenic
949328865 3:2898926-2898948 CAGCAGGAAGATAAAGAACAAGG + Intronic
949420425 3:3859294-3859316 CTGCAGGCAGAAAAGGAGCAAGG - Intronic
949563189 3:5221409-5221431 CTGGAGGAAGAGTAAGAACATGG + Intergenic
949863867 3:8531263-8531285 CAGAAGGAAGAAAATGTGCAAGG - Intronic
950125705 3:10508647-10508669 CTGCAGGAAGAGAAGGCAAAGGG - Intronic
950458951 3:13109670-13109692 GTGAAGGAAGAGAAAGGGCAGGG - Intergenic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
950614637 3:14148872-14148894 CTGCGGGAAGAAAATGACCTGGG - Exonic
950627758 3:14260610-14260632 CTGCAGGAGGAGTTTAAGCAGGG + Intergenic
951127186 3:18997542-18997564 CGGAAGGAACAGAATCAGCAAGG - Intergenic
952482708 3:33778021-33778043 CTCCAGAAAAAGAATGAGCGGGG - Intergenic
952620787 3:35339113-35339135 GTGCAGGTAGAGAAGAAGCAAGG + Intergenic
953041791 3:39262038-39262060 CTGCAGGCAGATAATGAGGCAGG - Intergenic
953663188 3:44905845-44905867 CTGCAGGAAGATTCTCAGCAGGG + Intronic
954133894 3:48573237-48573259 CTGGAGGAAGAGAAAGTTCAGGG + Intronic
954220572 3:49151119-49151141 TTGGAGGAAGAGTCTGAGCAGGG - Intergenic
954641077 3:52098250-52098272 CTGGAGGAAGGGTGTGAGCAGGG + Intronic
955393429 3:58537359-58537381 ATGCAGGAAGAGAGGGAGGAAGG - Intergenic
956552873 3:70481278-70481300 TTGGAGGAAGAGAAGGAGTAGGG + Intergenic
956575785 3:70751541-70751563 CTGCAGGAAGACAGTAAGAAGGG + Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956780010 3:72596283-72596305 TTGGAGGAATAGACTGAGCAGGG + Intergenic
957156704 3:76552749-76552771 CTGAAGGATGAGACAGAGCATGG + Intronic
958435231 3:94088110-94088132 CTGAAGGATGAAAAGGAGCAGGG - Intronic
959166854 3:102791141-102791163 CTGCTGGCAGGGAATGTGCAAGG + Intergenic
961114430 3:124316558-124316580 CTGCAGAAAGAGGAGCAGCAGGG - Intronic
961353407 3:126318113-126318135 GTGCAAGAAGAGAGTGGGCAGGG - Intergenic
961488250 3:127232546-127232568 ATGCAGGATGAGATTGAGGAGGG - Intergenic
962005670 3:131347013-131347035 GTGTATGAAGAGAATGACCAGGG + Intronic
962124093 3:132596480-132596502 CTGCAGGTGGAGACTGAGCCTGG + Intronic
962739654 3:138353903-138353925 CTTCAGGAAGAGACAGACCATGG - Intronic
963792398 3:149597254-149597276 TTTTAGGAAGAGTATGAGCATGG - Intronic
964203026 3:154139466-154139488 CTGTAGGAAGAGAAGGCTCAGGG + Intronic
965259984 3:166469580-166469602 CTGCAGGAAGTATATGTGCAGGG - Intergenic
965512471 3:169583479-169583501 CTACAGGAAGAGAAAGAGAGAGG - Intronic
965699062 3:171440709-171440731 CTGCAGGAAGAGGGTGTGGAGGG + Intronic
966295310 3:178413704-178413726 GTGTAGGAAGAGTATGAGGAGGG + Intergenic
966390409 3:179447257-179447279 AGGCTGGAAGAGAGTGAGCAGGG + Intronic
966497081 3:180593307-180593329 TGGCAGGAACAGAGTGAGCATGG - Intergenic
966596753 3:181730950-181730972 GAACAGGAAGAGAAGGAGCAGGG - Intergenic
966732017 3:183159301-183159323 CAGGAGGAAGAGAATGTGTAAGG + Intronic
966824617 3:183953237-183953259 CAGCTGGAAGAGAAAGGGCAGGG - Exonic
967189642 3:186974302-186974324 CTGCAGGAACCGACTGAGCTTGG + Intronic
967389867 3:188945147-188945169 GTGCCGGCGGAGAATGAGCAGGG - Intergenic
968330587 3:197866122-197866144 CAGCAGGAAAAGAATATGCAGGG - Exonic
968346996 3:198016964-198016986 CTACAGAAAGTAAATGAGCATGG + Intronic
968819402 4:2838107-2838129 CTGCAGGAAATGAATGAAAAAGG - Exonic
969587687 4:8104054-8104076 CTGCAGGGAGAGAAAGGCCAGGG + Intronic
969695187 4:8730251-8730273 CAGCAGCATGAGAAGGAGCAGGG + Intergenic
969984301 4:11191147-11191169 CAGGAGGAAGAGAGAGAGCAGGG + Intergenic
970016456 4:11517586-11517608 CTGGAGGAAGAGAATGAAGGTGG - Intergenic
970536781 4:17038139-17038161 CTGAGGAAAGAGAATGAGCATGG - Intergenic
971863194 4:32136224-32136246 CTGAAGGATGAGAAGGAGCCAGG + Intergenic
972371332 4:38426315-38426337 CTCAAGAAAGAGATTGAGCATGG - Intergenic
972451392 4:39202953-39202975 CTGCAGGGATAGTATGAGCCTGG + Intronic
973288814 4:48449256-48449278 CTGAAGGAAGAGAATGGCCAGGG - Intergenic
973716316 4:53680741-53680763 CTCCAGGAAGAAACAGAGCAAGG - Intronic
973721006 4:53723718-53723740 CTGCAAGATGAGAATGAGAAGGG - Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
975741768 4:77436113-77436135 CTGCAGGAATGCACTGAGCATGG - Intergenic
976009592 4:80471548-80471570 CAGCAGGGAGAGACTCAGCAGGG + Intronic
976133589 4:81911115-81911137 CAGCAGCAAGAGAGAGAGCAAGG - Intronic
976384475 4:84439717-84439739 CTGCAGGATGACAATCATCATGG - Intergenic
977098206 4:92772389-92772411 CTGCAGGAAGAAAGAGAGTAGGG - Intronic
977163171 4:93662024-93662046 TAGCTGGAACAGAATGAGCAAGG - Intronic
977262207 4:94811318-94811340 CTGAAGGCAAAGAAAGAGCAGGG + Intronic
978615656 4:110592720-110592742 CAGGAGGAAGAGAGTGATCAGGG - Intergenic
980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG + Intergenic
982080805 4:151787668-151787690 CACCAGGAACAGAATTAGCATGG - Intergenic
982951453 4:161702259-161702281 CTGCATGAAGATGATGAGAAGGG + Intronic
983509352 4:168590663-168590685 AACCAGGAAGAAAATGAGCAAGG + Intronic
983795653 4:171859440-171859462 CTTCAGGAAGGGAGGGAGCATGG + Intronic
983880215 4:172924164-172924186 CTGCTGAAAGAGAATGGGCCAGG - Intronic
984680904 4:182608596-182608618 CTGCAGCAAGCGGACGAGCAGGG - Intronic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985263823 4:188139814-188139836 CTGCAGAGCGAGGATGAGCAGGG + Exonic
985346077 4:189005934-189005956 CTGAAGGAAAATGATGAGCAAGG - Intergenic
986274394 5:6260854-6260876 TTGCAGGAAGAGGAGGAACAGGG - Intergenic
986342001 5:6797266-6797288 ATGAAGGAATAGAAAGAGCAGGG - Intergenic
986360854 5:6976417-6976439 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
986387354 5:7247750-7247772 CTTGAGGAAGACAATGAGCCTGG + Intergenic
986473062 5:8094841-8094863 CAGCAGGGAGAGTATGAGCTTGG + Intergenic
986524403 5:8657543-8657565 GTCCAGGAAGAGAGTGAGAAAGG + Intergenic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988271996 5:29028969-29028991 CTGAAGGTAGAGAATGGGGAGGG + Intergenic
988642648 5:33058418-33058440 GTGAAGTAAGAAAATGAGCATGG + Intergenic
988998641 5:36738595-36738617 CAGAAGGAACAGAATGAGCAAGG - Intergenic
989711942 5:44409105-44409127 TAGCTGGAACAGAATGAGCAAGG + Intergenic
990985660 5:61638809-61638831 ATGCAGGGAGCTAATGAGCATGG + Intronic
991543195 5:67752254-67752276 CTGCAGGGAGAGAGTGAGACTGG + Intergenic
991925342 5:71699861-71699883 CTGAAAGAATAGAATGAGAAGGG - Intergenic
993398694 5:87422051-87422073 GTGAAGGAAAAGAATGAGCTCGG - Intergenic
995306688 5:110659304-110659326 CAGCAGAAAAAGAATGAGAATGG + Intronic
995397381 5:111701803-111701825 CTTCAGGAAGAGAGTGAGATTGG - Intronic
995452832 5:112321319-112321341 CTGCAGTAACACAATGACCAAGG + Intronic
995500143 5:112795458-112795480 CTCCAGGAAGAGAAGGAGGCTGG - Intronic
995559579 5:113365817-113365839 CAGAAGGAAGAGAGAGAGCAGGG + Intronic
995677394 5:114677817-114677839 CTGTAGGAAGAGAATGTTCTAGG + Intergenic
995904438 5:117106518-117106540 ATGCATGGAGAGATTGAGCATGG + Intergenic
997502677 5:134389285-134389307 TAGCAGGAAGAGAATGAGATAGG - Intronic
997839188 5:137223142-137223164 GGGCAGGAAGAGACTGAGGATGG + Intronic
998638286 5:143981550-143981572 CTGTTGGAGGAGTATGAGCATGG - Intergenic
999268324 5:150281399-150281421 CTGGGGGAAGAGAAAGAGCTGGG + Intronic
999292941 5:150439308-150439330 CTGCACCAAGAGATTGAGGATGG + Intergenic
1000239119 5:159392872-159392894 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1000247789 5:159463254-159463276 ATGCAGGAAGGGACTGAGCAGGG - Intergenic
1000469827 5:161627553-161627575 ATGGAGGAAGGGAATGAGGACGG - Intronic
1000579437 5:163017136-163017158 CTGGAGCAAGAGAACGAGAAAGG - Intergenic
1000628726 5:163567774-163567796 AGGAAGGAAGAGAATGAGGAAGG - Intergenic
1000666560 5:164005276-164005298 TTGCAGGAAGATAATGAGCAAGG + Intergenic
1000872910 5:166599690-166599712 ATGAAGGAAGATCATGAGCAAGG - Intergenic
1001483703 5:172105254-172105276 CCACAGGAAGGGAAGGAGCAAGG - Intronic
1001581375 5:172800813-172800835 CTGAAGGATGAGAAGGACCATGG - Intergenic
1002892157 6:1343965-1343987 CAGCAGGCAGAAAATCAGCAAGG + Intergenic
1003221319 6:4163446-4163468 CAGCAGGAAAAGAATGAACTTGG - Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003366217 6:5477348-5477370 CGGCAGGAAGACAATAAGCTAGG - Intronic
1003418424 6:5934341-5934363 CTGCAGGAACACAGTGGGCAAGG - Intergenic
1003422333 6:5969578-5969600 CTGCAGTGAGAGAAAAAGCAGGG + Intergenic
1003464224 6:6363046-6363068 CTGCATGAAGAGTTTGAGAAAGG - Intergenic
1003739433 6:8919222-8919244 CTGAAGGATGAGAAAGAGCTAGG + Intergenic
1003790886 6:9546179-9546201 CTGTATGAAGAGAATGTGAAAGG + Intergenic
1003848235 6:10196194-10196216 CCGCAGGCAGAGAGTGAGGAAGG - Intronic
1003977835 6:11360584-11360606 CAGGAGGAAGAGAGAGAGCAGGG - Intronic
1004076726 6:12350689-12350711 CAGGAGGAAGAGAATGAAGAGGG + Intergenic
1004281047 6:14280257-14280279 TTGCAGGCAGAGAGGGAGCAAGG + Intergenic
1004334271 6:14750070-14750092 GAGCAGGAAGAGCATGAGGAAGG - Intergenic
1005609108 6:27506456-27506478 GTGCAGGATGAGAAGGGGCAGGG + Intergenic
1005850549 6:29817558-29817580 CTTCAGGCAGAGAATGGGCTAGG - Intergenic
1006917628 6:37605143-37605165 CTGCAGGTTGCAAATGAGCAGGG - Intergenic
1007247302 6:40471837-40471859 CTGAAGGAAGAGGGTAAGCAGGG + Intronic
1007843411 6:44735089-44735111 GGGCAGTAAGAGAAAGAGCATGG - Intergenic
1007947541 6:45839717-45839739 CTGCAGGAGGTGATGGAGCAGGG - Intergenic
1008235969 6:49050521-49050543 ATGCAGGATGAGAATAAGCAGGG - Intergenic
1009188232 6:60599284-60599306 CTGTAGGAACAGGATGAGGAGGG + Intergenic
1009686358 6:66962682-66962704 CTGCAGGAATGGAATAATCAAGG + Intergenic
1011140546 6:84150875-84150897 CTGTAGGAGGAGAATGAGCATGG - Intronic
1011406859 6:87024719-87024741 CTGCAGGCAGAGAATAAGGGTGG - Intergenic
1011811882 6:91141653-91141675 TTCCAGGAAGAGAAGGAGGAAGG - Intergenic
1012032181 6:94085586-94085608 CTGCTGGAAAAAAATGAGAAAGG - Intergenic
1013302195 6:108814470-108814492 CTGCAGTAAGAAAAACAGCATGG - Intergenic
1013584527 6:111566472-111566494 CAGCTGGACGAGGATGAGCATGG - Exonic
1013866891 6:114709354-114709376 CTGCCGGAAGAGCATTATCAAGG - Intergenic
1015356482 6:132282774-132282796 TTGCAGGAAGAGTATGAGAGAGG + Intergenic
1015642710 6:135353325-135353347 CTACAGGAAGAGATTGGCCATGG + Intronic
1016731352 6:147431672-147431694 CTGCAGGAAGCGGAAGAGGAAGG - Intergenic
1017215460 6:151901315-151901337 TTGCAGGCAGCGGATGAGCAAGG + Intronic
1017408333 6:154143019-154143041 CTCCAGGCAGAGAATGTTCAGGG - Intronic
1017626310 6:156352490-156352512 CTCCAGGAAGATAATGAGTGTGG - Intergenic
1017798955 6:157874519-157874541 CTGCAGGCAGAAAATCAGTAAGG + Intronic
1018385638 6:163300477-163300499 CTGCAGGAAGAGAGTGAGGGCGG - Intronic
1018721224 6:166574043-166574065 CTGTAGAGAGAGAATGACCACGG - Intronic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1019141674 6:169950874-169950896 CTGCAGGAAGAAGATCAGCATGG - Intergenic
1019212505 6:170418007-170418029 CTTCAGGAGGAGAAGGCGCATGG + Intergenic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1019443370 7:1058611-1058633 CTGCTGGAAGAGAAGCAGGAGGG + Exonic
1019973850 7:4564041-4564063 GTGGAGGAAGAGAGTGTGCAGGG - Intergenic
1020141333 7:5613564-5613586 CTGTGGTAAGAAAATGAGCAGGG - Intergenic
1021176206 7:17452664-17452686 CAGCAAGAAGATAATGAGAAAGG + Intergenic
1021773464 7:24028304-24028326 CTGGAGGAAGAGAACAGGCAAGG + Intergenic
1022027897 7:26465914-26465936 CTAAAGGAACAGAAGGAGCAAGG + Intergenic
1022254271 7:28640661-28640683 ATGCTGGAAGAAAATGAGCCTGG + Intronic
1022476799 7:30716345-30716367 CTGCAGGAAGAAGAAGGGCAGGG - Intronic
1022481798 7:30748977-30748999 AGGCAGGAAGAGAAGTAGCAAGG + Intronic
1022610501 7:31867087-31867109 CTGCAGGCAGAGAATGTCAATGG - Intronic
1022672718 7:32471457-32471479 CTGCAGGACGAGACTGGGCCGGG - Intergenic
1023460760 7:40393747-40393769 CTGAAGGAAGGGAATGAAGATGG + Intronic
1023540999 7:41265697-41265719 CTGCAGTAAAAGAATGAGAGTGG - Intergenic
1023641638 7:42264885-42264907 GTGCAGGAGGAGAGTGAGAAAGG + Intergenic
1024176240 7:46843979-46844001 CTCCAGGAAGGGACAGAGCAGGG - Intergenic
1024800423 7:53071496-53071518 CTGTAGGAAAAGAAAGAGTAGGG - Intergenic
1025851851 7:65250729-65250751 CTGCAGCAAGAGCCTGAACATGG - Intergenic
1026324791 7:69299718-69299740 CTGCTGGAACAGAACAAGCAAGG - Intergenic
1027581746 7:80005425-80005447 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1027803421 7:82784291-82784313 CTTCAGGAAGAGTATGACCCAGG - Intronic
1028570045 7:92277038-92277060 CAGGAGCAAGAGAAAGAGCAAGG - Intronic
1029172629 7:98641681-98641703 TTGCTGAAAGAGAAAGAGCAGGG - Intergenic
1029275702 7:99402949-99402971 ATGCAGGAGGAGAATTGGCAAGG - Intronic
1029853481 7:103489302-103489324 CTGCTGGAAGAGGCTGAGGAAGG + Intronic
1029905588 7:104090124-104090146 CTCCAGCAAGAGCAGGAGCAGGG - Intergenic
1030520948 7:110597401-110597423 CTGTAATAAGAGAATTAGCATGG - Intergenic
1030631317 7:111899117-111899139 ATGCAGGAAGAGAGCTAGCAGGG - Intronic
1030717138 7:112822256-112822278 CTCCAGGAAGAGAATCAATAGGG + Exonic
1031317456 7:120274361-120274383 CTGCAGGAAGAGATTTGGCTGGG + Exonic
1031371024 7:120966669-120966691 CTGGAGTATGTGAATGAGCATGG - Exonic
1031541151 7:122996039-122996061 ATGCAGGACGTGAATGAACAGGG - Intergenic
1032062245 7:128734866-128734888 CCACAGAAAGAGAATGAGCTTGG + Intergenic
1033261767 7:139850164-139850186 GTGCAGGACGAGAAGGAGCGTGG - Intronic
1033655395 7:143370199-143370221 CTCCAGGAAGAGAAAGATCAAGG - Intergenic
1034077631 7:148247942-148247964 CTGAAGAAAGAGGCTGAGCATGG - Intronic
1034528457 7:151680867-151680889 CTTCTCGAAGAGAAAGAGCAAGG - Intronic
1036584728 8:10113023-10113045 CTGCAGACAGAGAATATGCAAGG - Intronic
1037839937 8:22237495-22237517 GTGCAGGGAGAGATTGTGCAGGG + Intergenic
1038399104 8:27269519-27269541 CAGCAGGGAGGGAATGTGCAGGG - Intergenic
1038455091 8:27667734-27667756 GAGCAGGCAGAGAGTGAGCAGGG + Intronic
1038662560 8:29509816-29509838 CAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1038958553 8:32493608-32493630 CTGAAGGATGACAATTAGCACGG - Intronic
1039148290 8:34474768-34474790 ATGCTGGAACAGAATGAGTAAGG + Intergenic
1040621370 8:49096303-49096325 CTGCAGGAACAGTAGGGGCAAGG - Intergenic
1041080647 8:54211907-54211929 ATGCCGGAAGAGAAGGAGCTTGG + Intergenic
1041345779 8:56896568-56896590 ATGCAGGAAAGGAATGAGAAAGG + Intergenic
1041876861 8:62698398-62698420 CTGCAGGAGGAGCTTGAGTAGGG - Intronic
1042522842 8:69732633-69732655 CAGCAGAAAGACCATGAGCAGGG + Intronic
1042522984 8:69733980-69734002 CAGCAGAAAGACCATGAGCAGGG + Intronic
1042610556 8:70595247-70595269 CTTCTGGAGGAGAAGGAGCAGGG - Intronic
1042802228 8:72732025-72732047 CTGAAGGAGGAGATTCAGCAGGG - Intronic
1043714967 8:83470677-83470699 CAGTAGAAAAAGAATGAGCAAGG - Intergenic
1043827307 8:84944699-84944721 ATAAAGGAAGAGAATGAGAATGG - Intergenic
1044413369 8:91909746-91909768 CTGCTGGAAGAGGAGGAGGAAGG + Intergenic
1045764801 8:105654685-105654707 CTGCTTGAATAGAATGACCAAGG - Intronic
1047652650 8:126940126-126940148 CTGCAGGAGGAAACAGAGCATGG - Intergenic
1048081404 8:131132037-131132059 CTGTAGGATAAGAATAAGCAAGG - Intergenic
1048285083 8:133135254-133135276 CTGAAGCAAGACAATGAGGATGG + Intergenic
1048614195 8:136056619-136056641 CTGAAGGAAAAGAAGGAGCCAGG - Intergenic
1049252277 8:141595664-141595686 CTTCAGGAAGAGCATGTGCAGGG - Intergenic
1049674810 8:143884718-143884740 CTGCAGGAACAGGAGGTGCAGGG - Intergenic
1049706506 8:144045612-144045634 CTGCAGGAGGAGCTTGGGCAGGG + Intronic
1049812725 8:144582681-144582703 CTGCAGGAGGAGGATGAGGCGGG + Intronic
1049818340 8:144618946-144618968 CTGCAGGACGAGGATGAGGACGG - Intergenic
1050253824 9:3773409-3773431 CTGCAGCAACAAATTGAGCAAGG - Intergenic
1050447611 9:5742112-5742134 ATGTAGGAAAAGAATTAGCAAGG - Intronic
1051274651 9:15387166-15387188 CAGCAGGAAGAGAGAGAGGAGGG - Intergenic
1051613633 9:18985698-18985720 CTGCCGGAACAGAAAGGGCAGGG - Intronic
1051767013 9:20535622-20535644 CAGCAGGAAGAGACTCTGCAAGG + Intronic
1052456325 9:28703643-28703665 CAGCAGGCAGAAAATAAGCAAGG - Intergenic
1052484317 9:29076499-29076521 CAGAAGGAACAGAATGAGTATGG + Intergenic
1052772344 9:32701184-32701206 CTGAGGGAAGAGCATAAGCAAGG - Intergenic
1052823550 9:33158909-33158931 CCCCAGGAAGAGAATGAACAGGG - Intronic
1054736168 9:68752538-68752560 AAGAAGGAAGAGAAGGAGCAAGG - Intronic
1054759713 9:68993366-68993388 CTGAAGGAAGTGAGGGAGCATGG - Intronic
1056232155 9:84557781-84557803 CTGTAGGAATAGACTGGGCATGG + Intergenic
1056275236 9:84988257-84988279 CTGGAGGGAGAGAGAGAGCAAGG + Intronic
1056454435 9:86746325-86746347 CTCCAGGAACAGAGTGAGCGAGG + Intergenic
1057227959 9:93302378-93302400 CTGCAAGTAGAGGAGGAGCAGGG + Intronic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1058767450 9:108195683-108195705 GTACAGGAACAGAATGTGCAAGG + Intergenic
1058930167 9:109710878-109710900 CTTCTGGAAAAGAAAGAGCAGGG + Intronic
1059189490 9:112310909-112310931 TGGCTGAAAGAGAATGAGCAAGG + Intronic
1059322169 9:113478230-113478252 GGGGAGGAAGAGAAAGAGCAGGG - Intronic
1060405501 9:123371047-123371069 CTGCAGGGAGAGAAGGTGCCAGG - Intronic
1060809145 9:126600161-126600183 ATGCAGGTAGAGACTGAGCAAGG + Intergenic
1061670362 9:132185056-132185078 CTGCAGGCTGAGAATGGGCTGGG + Intronic
1061862444 9:133475030-133475052 CTGCAGGAGGCGCATCAGCAAGG + Exonic
1062457056 9:136644837-136644859 CCACAGGAAGAGTCTGAGCAGGG - Intergenic
1186672757 X:11783436-11783458 AGGCAGGCAGAGAAAGAGCAAGG + Intergenic
1187111832 X:16309951-16309973 CTGCAGGAGGTGGAAGAGCATGG + Intergenic
1187122289 X:16421145-16421167 CTGGAGCAAGAGAGAGAGCAAGG + Intergenic
1187738025 X:22324242-22324264 CTGCAGGAAGCAAATGAGCAGGG - Intergenic
1188314414 X:28656205-28656227 CTAAAGGAGGAGAATGACCAGGG - Intronic
1188986460 X:36772670-36772692 GTGCAAGAAGAGCATGGGCAAGG - Intergenic
1189384197 X:40523966-40523988 CTGCAGGAATACAAAGACCAAGG - Intergenic
1189778436 X:44491059-44491081 TTGCAGGAAGAGAAGGGGGATGG - Intergenic
1190489981 X:50972190-50972212 CTGCAGTTTGAAAATGAGCATGG + Intergenic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1192296191 X:69851285-69851307 ATGAAGGAAGAAATTGAGCAGGG - Intronic
1192762455 X:74107427-74107449 CTGAAGGAATAGAATGGTCAAGG + Intergenic
1193031645 X:76905506-76905528 CTCCAAGAAGAAAATGAGAATGG + Intergenic
1194300836 X:92183705-92183727 TGGCAGGAACAGAATGATCAAGG - Intronic
1194388434 X:93286791-93286813 CAGGAGGAAGACAATGAGCAGGG + Intergenic
1195669524 X:107457882-107457904 ACGCTGGAAGAGAAAGAGCAGGG - Intergenic
1196155823 X:112428701-112428723 TTGCAGGCAGAAAATCAGCAAGG - Intergenic
1196697931 X:118634240-118634262 CTTCAGGAAGAGAATCATCACGG - Intronic
1196868533 X:120090952-120090974 AAGCATGAAGAGAATGGGCAAGG + Intergenic
1197286924 X:124606689-124606711 TTGGAGGAATGGAATGAGCATGG + Intronic
1199564712 X:149203321-149203343 GTGCAAGAAGAGAAAGAGAAAGG - Intergenic
1199764704 X:150932663-150932685 TTGGAGGGAGAGACTGAGCATGG - Intergenic
1200053039 X:153444822-153444844 GTGCAGGAAGATCAGGAGCAGGG + Exonic
1201303152 Y:12527577-12527599 ATGCAGGAAGGGAAGGAGAAAGG + Intergenic
1201474385 Y:14364718-14364740 AAGGAGGAAGAGAAGGAGCATGG + Intergenic
1202017242 Y:20422949-20422971 CTGCAGGAAGCTATTTAGCAAGG - Intergenic