ID: 1106778521

View in Genome Browser
Species Human (GRCh38)
Location 13:33032242-33032264
Sequence TAATGGGAACAGATGTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106778521 Original CRISPR TAATGGGAACAGATGTATCT GGG (reversed) Intronic
901542606 1:9929662-9929684 TAATGGGGCCCGTTGTATCTCGG - Exonic
906908169 1:49917538-49917560 TAATGGGCACATATATATTTAGG - Intronic
906954591 1:50361874-50361896 TATTGGGTACATATGTATTTAGG - Intergenic
907979160 1:59463819-59463841 TATTGGGCACATATGTATTTAGG - Intronic
910966789 1:92815955-92815977 TATTGGAAACAGAGGAATCTTGG - Intergenic
910967045 1:92818337-92818359 TACTGGAAACAGATGAATCTTGG + Intergenic
911364936 1:96926815-96926837 TCATGGGATCAGATGTATGGTGG - Intergenic
912870841 1:113303967-113303989 TAATGGGTACAGATTTATTTTGG + Intergenic
913636064 1:120762033-120762055 TAATGGGAAGCAGTGTATCTTGG + Intergenic
913678092 1:121161329-121161351 TAATTGGAAAAGATGAATTTGGG + Intergenic
913990158 1:143604122-143604144 TATTGGGTACATATGTATTTAGG - Intergenic
914029928 1:143948958-143948980 TAATTGGAAAAGATGAATTTGGG + Intronic
914159521 1:145118992-145119014 TAATTGGAAAAGATGAATTTGGG - Intergenic
914944414 1:152051352-152051374 TCATGGGAAGAGAGGAATCTGGG - Intergenic
915931877 1:160065766-160065788 CAATGCCAACAGATGTGTCTGGG + Intronic
916594538 1:166231328-166231350 TATTGGGTACATATGTATTTAGG + Intergenic
916722944 1:167498585-167498607 TAATGGGCCCAGATGGAGCTAGG - Intronic
918187853 1:182143778-182143800 GAAAGGGAACAGATGTTTATTGG - Intergenic
918359469 1:183741060-183741082 TATAGGCACCAGATGTATCTGGG + Intronic
918504248 1:185234302-185234324 TATTGGGTACAGATGTATTTAGG + Intronic
918684106 1:187394005-187394027 CCAAGGGAATAGATGTATCTTGG - Intergenic
918704755 1:187646544-187646566 TACTGGGAAGAGTTGTCTCTTGG - Intergenic
918776513 1:188638556-188638578 TTATGGGATCTGATTTATCTCGG + Intergenic
919666796 1:200300293-200300315 TCATGGGAACACATGTCTCGTGG - Intergenic
920465392 1:206179843-206179865 TAATTGGAAAAGATGAATTTGGG + Intergenic
923026012 1:230204849-230204871 GAATGGGACCAGATTTTTCTGGG - Intronic
923227080 1:231948402-231948424 TAATGGGAACACATGGACATAGG + Intronic
924137906 1:240989861-240989883 TAAAGGGAAAGGATGTATTTAGG + Intronic
924301950 1:242648792-242648814 TCATGGAAACAGATGAATGTGGG - Intergenic
1063929087 10:11011125-11011147 TAATGGGAACAGATGTTGGAAGG + Intronic
1065785934 10:29214717-29214739 AATTGGGAACAGATGATTCTTGG - Intergenic
1066073218 10:31843124-31843146 TACTGGGATCAAATGTATCAAGG + Intronic
1069776085 10:70928080-70928102 TAATGGGGACAAAGGTAACTGGG + Intergenic
1070278171 10:75028258-75028280 TATTGGGAACACATGGATATAGG - Intronic
1071049966 10:81435372-81435394 TACTGGGAACTCATGTATATAGG + Intergenic
1072564185 10:96603746-96603768 TAATGGGGACAGGTGTATTAGGG - Intronic
1074490864 10:113938453-113938475 GAATGGGAACGGATGCATCAAGG - Intergenic
1076369986 10:129946309-129946331 AAATGGGAACAAATGTGTTTGGG + Intronic
1079274239 11:19018906-19018928 TACTTGGAACTGATGAATCTTGG - Intergenic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079511482 11:21216105-21216127 TAATGGGAAAAGCTGTACCCTGG - Intronic
1080378587 11:31743201-31743223 TATTGGGAACATATATATTTGGG - Intronic
1081712363 11:45225572-45225594 TAATGTGAACAAAGGCATCTTGG - Intronic
1083414790 11:62518453-62518475 TGCTGGGAACAGATGCATCCAGG + Exonic
1088450231 11:109973661-109973683 CAATGGGAACAGATGGCTCAGGG + Intergenic
1090477342 11:127035647-127035669 TGATGGAAAAAGATGTCTCTGGG - Intergenic
1090486793 11:127120229-127120251 TTATGTGAATAGATGGATCTTGG - Intergenic
1090717943 11:129446798-129446820 TAATGGGAGCAGCAGTGTCTGGG + Intronic
1090854946 11:130603017-130603039 TCATGGGAGGAAATGTATCTTGG - Intergenic
1091267188 11:134280567-134280589 TGATGGTAACTGATGTATCCAGG + Intronic
1097673945 12:62576338-62576360 TAATGGGTACAGATCTTTTTGGG + Intronic
1098697300 12:73574859-73574881 TATTGGGTACAGATATATTTAGG - Intergenic
1100479041 12:94960251-94960273 TAATGGGTACAAATTTATATTGG - Intronic
1101128185 12:101661075-101661097 TAATAGGAAAATATGTTTCTTGG - Intronic
1102133883 12:110556357-110556379 TAAGGGGAAGAGTTGTATTTGGG + Intronic
1104369306 12:128208975-128208997 TATGGGGAAAAAATGTATCTTGG - Intergenic
1104610024 12:130220079-130220101 TACTGGGAACAACTTTATCTGGG + Intergenic
1104919334 12:132282505-132282527 TTTTGGGAACAGCTGGATCTAGG + Intronic
1105395864 13:20033806-20033828 TAATAGTAACAGATGTATCATGG - Intronic
1105547595 13:21362136-21362158 TCATGGGAACAGACATGTCTTGG - Intergenic
1106778521 13:33032242-33032264 TAATGGGAACAGATGTATCTGGG - Intronic
1107346486 13:39467159-39467181 TAAGGGGAACAGATGAATAACGG - Intronic
1107761305 13:43682326-43682348 TAATAGGAACATCTGAATCTGGG + Intronic
1108815751 13:54287657-54287679 CACTGGCAACAGAGGTATCTAGG - Intergenic
1109170621 13:59092838-59092860 AAATTTGTACAGATGTATCTAGG + Intergenic
1111192450 13:84827164-84827186 AATTGGGAATAAATGTATCTAGG + Intergenic
1111704521 13:91731725-91731747 TAATGAGAACACATGTATATAGG - Intronic
1114595197 14:23906164-23906186 GAATGGGAAGAGATGTGTTTGGG - Intergenic
1120871836 14:89344862-89344884 TAATGAGAAATGACGTATCTAGG + Intronic
1122354153 14:101113257-101113279 TGATGGGAACAGATAAATCCAGG + Intergenic
1124992569 15:34690578-34690600 TAATGGGGAAAGATCTCTCTGGG + Intergenic
1130055210 15:80518093-80518115 TAATAGGAACTGAGGTAACTAGG + Intronic
1133165630 16:3945137-3945159 TCATGGGATCACATGTATTTTGG + Intergenic
1135352538 16:21741117-21741139 GAATGGGATGAGATGTGTCTTGG + Intronic
1135451026 16:22557239-22557261 GAATGGGATGAGATGTGTCTTGG + Intergenic
1135636308 16:24078507-24078529 TGAGGGGAACAGATGTTTATGGG + Intronic
1137881569 16:52054263-52054285 TAATGTGAAAAGATGTGTCTGGG - Intronic
1138960155 16:62019468-62019490 CCATGGGGCCAGATGTATCTTGG + Intronic
1141142112 16:81503376-81503398 TAAAGGGATCAGAGGTATCTGGG - Intronic
1141560642 16:84865534-84865556 AAAAGGCAACAGATGTATTTGGG - Intronic
1143841312 17:9734304-9734326 TAATGGGATCACATGCAACTTGG + Intergenic
1144322130 17:14137022-14137044 TAATGGGTAAAGATGTTTTTAGG + Intronic
1146833536 17:36090738-36090760 TAATGGCTACAGATATTTCTAGG - Intergenic
1150478454 17:65491388-65491410 TCATGTTAACAGATGTATGTTGG - Intergenic
1153769778 18:8406004-8406026 TAATGGGAAGACATCAATCTGGG - Intronic
1155474473 18:26224455-26224477 TAATGGAAAGAGATGTACTTTGG + Intergenic
1155647977 18:28103695-28103717 TAATGAGAACACATGTATGCAGG - Intronic
1156232080 18:35163599-35163621 TGAAGGGAACAGGGGTATCTTGG - Intergenic
1157634361 18:49135598-49135620 TATTAGGTACAGATGTATTTAGG + Intronic
1161318316 19:3629251-3629273 TGAAGGGAACACATTTATCTTGG - Intergenic
925421357 2:3715333-3715355 CAATGGGCACAGATTTAACTTGG - Intronic
925823433 2:7823020-7823042 TAATGGGGACGGATGTTTTTAGG - Intergenic
926103008 2:10132623-10132645 TAATTGGAACTGAAGTATTTTGG + Intergenic
926465777 2:13185079-13185101 TGTTGGGCACAGCTGTATCTAGG - Intergenic
929066722 2:37983148-37983170 TCATGGGTACAGATGCATGTGGG - Intronic
930330304 2:49975009-49975031 CACTGGAAACAGATGTATTTGGG - Intronic
930502623 2:52241207-52241229 TAATGGGATGAGGTGTTTCTAGG + Intergenic
930582192 2:53225691-53225713 TATTGGGAAAAGATATATGTGGG + Intergenic
930844492 2:55887508-55887530 TACTGGAATCAGATTTATCTGGG + Intronic
931047144 2:58367226-58367248 AAAAGTGAACAGATGTATTTTGG - Intergenic
931243762 2:60476111-60476133 TGAGGGGAACAGGTGTATCCTGG - Intronic
931523224 2:63122991-63123013 TAAGGGCAACACATGTATGTAGG + Intronic
935757867 2:106290877-106290899 CAAAGAGAACAGATGTGTCTAGG - Intergenic
936533331 2:113291875-113291897 GAATGGGAAAAGATGGACCTGGG - Intergenic
943262645 2:185686038-185686060 TATTGGGTACATATGTATTTAGG + Intergenic
947301679 2:228694955-228694977 TAATGGGTGCAGATATATTTAGG + Intergenic
1169001537 20:2171370-2171392 TAAGAGGAACAGCTGTATCAGGG - Intronic
1169924311 20:10766819-10766841 AAATAGGAACAGATGAATCCAGG + Intergenic
1176672350 21:9746192-9746214 TAATGGGAACGGAATGATCTTGG + Intergenic
1178626176 21:34220746-34220768 TACTGGGAATAGAGGAATCTTGG + Intergenic
949126571 3:452188-452210 TAATGGGAACTGATGGATAGAGG + Intergenic
949800274 3:7896499-7896521 TATTGGGTACATATGTATTTAGG + Intergenic
951876116 3:27427867-27427889 TCATGGGAAAAAATGTATGTTGG + Intronic
952786294 3:37158726-37158748 AAATGGGAACACATGTAACAAGG + Intronic
955307375 3:57847772-57847794 TAATGTCAAAAGATGTATTTTGG - Intronic
956756670 3:72394814-72394836 TTTTAGGAACAGATGTTTCTTGG + Intronic
956869044 3:73398418-73398440 TAATGGGCACCGAGGTACCTAGG + Intronic
959058946 3:101598266-101598288 TAATGGTAACAGCCATATCTTGG + Intergenic
959855397 3:111149213-111149235 TAATTGAAACAGCAGTATCTTGG - Intronic
962451128 3:135518031-135518053 CCATGGGAACTGATGTTTCTAGG + Intergenic
962694271 3:137932175-137932197 TAATGGGAACAGACCAATCAAGG - Intergenic
963223552 3:142837329-142837351 CAATGGGAAAAGAATTATCTAGG + Intronic
963732721 3:148988230-148988252 TAATGGGTACAGATTTCTTTTGG + Intergenic
964119412 3:153166734-153166756 TTTTGGGACCAGATGTATTTGGG + Exonic
964716215 3:159725163-159725185 AGATGGAAACAGAGGTATCTTGG - Intronic
966018503 3:175175826-175175848 TAATGGGAAGAGATGCATGTAGG + Intronic
966510951 3:180762791-180762813 TACTTGGAACAGAAGTCTCTGGG + Intronic
967618977 3:191608921-191608943 AAATGGGAAAAGATGAAGCTAGG - Intergenic
971217082 4:24671741-24671763 CAATTGGCACACATGTATCTGGG - Intergenic
973633102 4:52838012-52838034 AAAAGGGAACAGAAGCATCTTGG - Intergenic
973927659 4:55755951-55755973 TAATGGGTACAGATGTCATTTGG + Intergenic
974480518 4:62437426-62437448 TTATGGGAAAAGATGTCTGTGGG - Intergenic
975182201 4:71359087-71359109 AATTAGGAACAGATGGATCTTGG + Intronic
975378546 4:73672149-73672171 GAAAGGGAACATATGTATCAGGG + Intergenic
977564234 4:98565593-98565615 CAATGGGATGAGATGTATGTAGG - Intronic
978805159 4:112791894-112791916 TAAAGGGAATATATGTATATTGG + Intergenic
979225088 4:118275695-118275717 TAATGTAAACAGTTGTAACTTGG + Intergenic
979303931 4:119120502-119120524 AAATAGGAACAGATATATTTTGG + Intergenic
979758758 4:124374084-124374106 TAAAGAGAACAGATGGATGTAGG + Intergenic
980217773 4:129874431-129874453 TAATGGGTACATATATATTTAGG + Intergenic
982433942 4:155359386-155359408 TAATGTGTACACATGTATATAGG + Intronic
983616848 4:169716026-169716048 TCATGGGAACTGGTGTTTCTTGG + Intronic
985402379 4:189605656-189605678 TAATGGGAACGGAATGATCTTGG - Intergenic
986434690 5:7717586-7717608 TAATAAGAACAGATGCATTTTGG - Intronic
987151471 5:15045107-15045129 GAATGGGAACAGAAGTATGGTGG + Intergenic
988866125 5:35337220-35337242 TAATGGGGATAGATTTTTCTTGG + Intergenic
989215493 5:38900586-38900608 CAATGGGAATACATGTATTTGGG + Intronic
990544757 5:56812218-56812240 TAGTGGGAACAGAAGTATGCAGG + Intergenic
992163165 5:74022016-74022038 CAATGAGAACACATGGATCTGGG - Intergenic
993585207 5:89716201-89716223 GAGTGGGAAAAGATGTAGCTGGG + Intergenic
994562382 5:101392433-101392455 TTATGGGAAATAATGTATCTGGG + Intergenic
998989734 5:147802519-147802541 TACTGGGAACTGATGTCTATTGG - Intergenic
1000183140 5:158832327-158832349 TATTGGGCAAATATGTATCTTGG - Intronic
1001286540 5:170427809-170427831 TGATGGGAAGAGTTGTCTCTGGG - Intronic
1001859729 5:175043412-175043434 TAATGGGAAGATCTGTATGTAGG + Intergenic
1002689261 5:181038841-181038863 TAATGTGAACAGATGTCCCTAGG - Intergenic
1003404080 6:5814546-5814568 TCATGGGAACAGACATGTCTTGG + Intergenic
1003684750 6:8291097-8291119 TCATGGGTATAGATGTATATAGG - Intergenic
1007163347 6:39810655-39810677 TTATGGGGACAAATGTGTCTCGG + Intronic
1008062191 6:47010054-47010076 TGATGGGAATAGATGTATTTTGG + Exonic
1009590161 6:65658376-65658398 TAGTTGCAACAGATGTATCATGG + Intronic
1010369397 6:75089848-75089870 TAATGGGAAAAACTCTATCTTGG - Intronic
1012035103 6:94126533-94126555 TAATGTGAATATATTTATCTAGG + Intergenic
1012197309 6:96359632-96359654 ACATGGGAACAGATGTAGGTTGG - Intergenic
1012480274 6:99659417-99659439 TTATGGGAAAAGTTGTATTTGGG + Intergenic
1013822658 6:114174075-114174097 GAGTGGGAACAGATGAAGCTGGG - Intronic
1015996578 6:139000550-139000572 TAATGGGAGCAGAAGTGTGTAGG - Intergenic
1022055498 7:26729044-26729066 TGAGGGGAACAGATCTTTCTGGG + Intronic
1023098288 7:36686000-36686022 TAATGGGAACTAATTCATCTAGG - Intronic
1023802633 7:43848205-43848227 TAAAGGGAACAGATGAAGCAGGG + Intergenic
1024202747 7:47122908-47122930 GAATGGGAACGGATGCCTCTTGG - Intergenic
1024370163 7:48573825-48573847 TAATGGCAACAGCTTGATCTCGG - Intronic
1025041985 7:55653764-55653786 TATTGGGTACATATGTATTTAGG - Intergenic
1028975220 7:96905225-96905247 TAATGGGAGCATCTGTAACTTGG + Intergenic
1030862712 7:114656663-114656685 TATTGGGAACAGATGCACTTGGG + Intronic
1031096911 7:117431238-117431260 TATTGGGTACATATGTATTTAGG + Intergenic
1031173150 7:118316640-118316662 TACTGGGTGCAGATGTATTTAGG + Intergenic
1032238042 7:130141399-130141421 TGATGGGAGCAGAAGTGTCTCGG - Intergenic
1035380211 7:158433422-158433444 TGTTGGGAATACATGTATCTAGG + Intronic
1036675247 8:10826535-10826557 TAATGTGAACATTTGTGTCTAGG - Intronic
1037870543 8:22490971-22490993 TAATGGGATAAGATATATCCAGG + Intronic
1038073937 8:24048469-24048491 TACTGGGTACATATGTATTTAGG - Intergenic
1038342920 8:26703063-26703085 GAGTGGAAACAGATGTTTCTGGG + Intergenic
1039902084 8:41760098-41760120 TAAAGGAAACAGATGTTCCTGGG - Intronic
1040921588 8:52626523-52626545 AAATGTTAACAGATGAATCTGGG + Intronic
1041153922 8:54964121-54964143 TAGTGGGAACAGATATACTTAGG + Intergenic
1041159534 8:55025339-55025361 TAATGGAGACAGATGGATCGAGG + Intergenic
1043821316 8:84868724-84868746 GAATGGGTATAGATGTATGTAGG + Intronic
1045561418 8:103267533-103267555 TCATGGGAACAGTTATATCTAGG + Intergenic
1045752861 8:105507058-105507080 TAGAGAGAACAGATGGATCTAGG + Intronic
1047925722 8:129680715-129680737 TAATGGGTACAGGTTTATTTTGG + Intergenic
1049011539 8:139890665-139890687 TTATGAGAACAGATGTTTCCAGG - Intronic
1050893694 9:10857607-10857629 CAATGGGAACAGATGGATACAGG + Intergenic
1051904573 9:22080438-22080460 TATTGTGAACAGAAGTAGCTAGG - Intergenic
1055616714 9:78080913-78080935 CAATGGGAACACATGGATATAGG + Intergenic
1055805931 9:80093243-80093265 TAAAGGGTAAAGATGTATATTGG + Intergenic
1057822185 9:98341245-98341267 TTGTGGGCACAGATGTGTCTGGG - Intronic
1058170119 9:101670413-101670435 CAATGGGAGCTGCTGTATCTCGG + Exonic
1058629011 9:106966898-106966920 GAAAGGGAACAGAAGTACCTTGG - Intronic
1059800246 9:117742877-117742899 TAATATAAAAAGATGTATCTGGG + Intergenic
1060351303 9:122863047-122863069 TAATGGGTACAGGTTTCTCTTGG - Intronic
1185553576 X:1002911-1002933 AAATGGGAACAGATGTAGCCGGG - Intergenic
1187767828 X:22662598-22662620 TAATGGGAAAAGTTGCTTCTAGG + Intergenic
1191173077 X:57469553-57469575 TATTGGGTGCAGATGTATTTAGG - Intronic
1192385615 X:70666160-70666182 TAATGAGAAAACAAGTATCTAGG + Intronic
1193979719 X:88167328-88167350 TATTGGGAACATATATATTTAGG + Intergenic
1195149880 X:102056196-102056218 TTCTGGGAACAGATGTTTTTTGG + Intergenic
1195627649 X:107020229-107020251 TAATGGTAGCACAAGTATCTGGG + Intergenic
1195998097 X:110751464-110751486 TAATGGGTACTAATGTATCAAGG + Intronic
1196569588 X:117249906-117249928 TAGTCTGAACAGATTTATCTGGG - Intergenic
1198444714 X:136700677-136700699 TAATAGGAACTGAGGTAACTAGG - Intronic
1199163357 X:144641194-144641216 TAATTTGAATATATGTATCTAGG + Intergenic
1199775479 X:151007374-151007396 TAATGGGTACAGGTTTTTCTTGG + Intergenic
1201327499 Y:12779541-12779563 CAAAGGAAAGAGATGTATCTGGG - Exonic