ID: 1106780602

View in Genome Browser
Species Human (GRCh38)
Location 13:33055711-33055733
Sequence CATTAGGCAGAGTCCTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 433}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106780598_1106780602 17 Left 1106780598 13:33055671-33055693 CCTCTGAGTTTCAGTGGTGCTGC 0: 1
1: 0
2: 1
3: 11
4: 160
Right 1106780602 13:33055711-33055733 CATTAGGCAGAGTCCTCCAGAGG 0: 1
1: 0
2: 4
3: 45
4: 433
1106780596_1106780602 23 Left 1106780596 13:33055665-33055687 CCAAAGCCTCTGAGTTTCAGTGG 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1106780602 13:33055711-33055733 CATTAGGCAGAGTCCTCCAGAGG 0: 1
1: 0
2: 4
3: 45
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106780602 Original CRISPR CATTAGGCAGAGTCCTCCAG AGG Intronic
900764243 1:4493430-4493452 CATTAGTCAGGGTTCTCTAGAGG - Intergenic
902108609 1:14059111-14059133 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
902149557 1:14431994-14432016 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
902568297 1:17330330-17330352 TATTAGTCAGGGTTCTCCAGAGG + Intronic
902844518 1:19099409-19099431 CATTAGTCAGATGCCTCCAAAGG + Intronic
903005560 1:20295810-20295832 GATTAAGCAGACTCCTCCATGGG - Intronic
903027438 1:20439407-20439429 CATCAGGCAGCTTCTTCCAGAGG + Intergenic
903553617 1:24177167-24177189 TATTAGTCAGGGTTCTCCAGAGG + Intronic
903994034 1:27294028-27294050 CATGAAGCAGAGCCCTTCAGCGG + Exonic
905482713 1:38272361-38272383 CCTGAGACAGAGTGCTCCAGGGG + Intergenic
905765022 1:40593193-40593215 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
906865211 1:49410944-49410966 TATTAGTCAGGGTTCTCCAGAGG + Intronic
907901475 1:58745367-58745389 CATTAATCACAGTTCTCCAGTGG + Intergenic
908395611 1:63722751-63722773 CATTAGTCAGGGTTCTCTAGAGG + Intergenic
909033522 1:70569960-70569982 AAGAAGGCAGAGTCCTGCAGGGG - Intergenic
909167775 1:72250308-72250330 TATTAGTCAGAGTTCCCCAGGGG - Intronic
909173029 1:72318696-72318718 TATTAGGCAGGGTTCTCTAGAGG + Intergenic
909466855 1:75982445-75982467 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
911233031 1:95380548-95380570 TATTAGTCAGGGTCCTCTAGAGG + Intergenic
911978538 1:104534909-104534931 CATTAGTCAGGGTTCTCTAGAGG - Intergenic
912109091 1:106318130-106318152 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
913672137 1:121107087-121107109 TATTAGTCAGAGTTCTCCAGAGG + Intergenic
914023901 1:143894444-143894466 TATTAGTCAGAGTTCTCCAGAGG + Intergenic
915023051 1:152799279-152799301 TATTAGTCAGGGTTCTCCAGAGG + Intronic
918080814 1:181206559-181206581 TATTAGGCAGAGGCATCCAGGGG - Intergenic
918947951 1:191094351-191094373 CATTAGTCTGTGTTCTCCAGAGG - Intergenic
920595512 1:207265223-207265245 CATTAGCCAGGGTTCTCCAGAGG - Intergenic
920786569 1:209048008-209048030 CAGGAGGCAGAGTTCTCCAAAGG + Intergenic
921978322 1:221227307-221227329 CATTAGTCAGTGTTCTCTAGAGG - Intergenic
922494539 1:226046286-226046308 CAGCAGTCAGAGTTCTCCAGAGG + Intergenic
922546282 1:226459698-226459720 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
922861622 1:228822889-228822911 TATTAGTCAGAGTTCCCCAGAGG + Intergenic
1063804522 10:9623227-9623249 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1063827096 10:9910443-9910465 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
1063904244 10:10766399-10766421 CAGTAGGTAGAGACCTGCAGGGG + Intergenic
1065864543 10:29902694-29902716 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1066529782 10:36324716-36324738 CATTAGGCAGAGTCCTGGAAAGG - Intergenic
1066751017 10:38657269-38657291 TATTAATCAGAGTTCTCCAGAGG - Intergenic
1068007303 10:51406792-51406814 TATTAGTCAGAGTTCTCTAGAGG + Intronic
1068225798 10:54105206-54105228 TATTAGTCAGAGTTCTCTAGAGG + Intronic
1068301078 10:55140705-55140727 CATTGGGTAGACTTCTCCAGTGG + Intronic
1068537488 10:58256307-58256329 CATAAGGCAGACACTTCCAGAGG - Intronic
1068820798 10:61376334-61376356 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1068937500 10:62650189-62650211 CATTAGTCAGGGTTCTCCAGAGG - Intronic
1069817335 10:71206772-71206794 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1071032750 10:81204525-81204547 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1071281235 10:84105838-84105860 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
1071782561 10:88862847-88862869 CATGAGGCAGAATCCTTCACAGG + Intergenic
1071804693 10:89105316-89105338 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1073909845 10:108328953-108328975 CAGTAGTCAGGGTTCTCCAGAGG - Intergenic
1075257160 10:120934372-120934394 TATTAGCCAGATTTCTCCAGGGG + Intergenic
1075345513 10:121679322-121679344 CATTGGGGAAAGTCCTGCAGTGG - Intergenic
1076078627 10:127557724-127557746 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1076689781 10:132216995-132217017 CACTAGGCAGTGTGCCCCAGTGG - Intronic
1078874201 11:15377529-15377551 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1078925160 11:15868294-15868316 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1079871056 11:25798445-25798467 TATTAGACAGGGTTCTCCAGAGG + Intergenic
1082890839 11:58137024-58137046 CATTTGGCAAAGTCCTCTGGCGG + Intronic
1083581306 11:63827169-63827191 GATGAGGCAGCGTCCCCCAGTGG + Exonic
1086056201 11:82650014-82650036 TATTAGTCAGAGTTCTCCAGAGG + Intergenic
1086515859 11:87612638-87612660 CATTAGCCAGAGTTCTTCAGAGG - Intergenic
1086549228 11:88035396-88035418 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
1087464356 11:98486198-98486220 CATTAGTCAGGGTGCTCTAGAGG - Intergenic
1087781137 11:102302528-102302550 CACTAGGCAGTGTCCTGCTGGGG + Intergenic
1090975506 11:131676856-131676878 CATTATTCAGACTACTCCAGAGG - Intronic
1091046125 11:132327460-132327482 AATTAGGCCAAGTCATCCAGTGG + Intronic
1091071770 11:132571414-132571436 TATTAGTCAGGGTTCTCCAGAGG - Intronic
1091349593 11:134882259-134882281 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1093144964 12:15554320-15554342 TATTAGTCAGAGTTCTCTAGAGG + Intronic
1096735280 12:53648613-53648635 TATTAGTCAGGGTTCTCCAGAGG + Intronic
1096871206 12:54593456-54593478 CCTTAGGCAGACTTCTCCAGAGG - Intergenic
1099400894 12:82202877-82202899 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
1099690048 12:85940285-85940307 TATTAGTCAGAGTTCTCCAGAGG - Intergenic
1100241591 12:92714982-92715004 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
1100384807 12:94095966-94095988 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1101698225 12:107147015-107147037 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1101893537 12:108736492-108736514 CTTTATGCAGTTTCCTCCAGTGG + Intergenic
1101960787 12:109248276-109248298 TATTAGTCAGCGTTCTCCAGAGG + Intronic
1103422190 12:120795851-120795873 CATTAGAGAGAAACCTCCAGTGG - Intronic
1103855252 12:123963787-123963809 CATTAGATAGAGTACTCCTGTGG - Intronic
1103935385 12:124473617-124473639 CATTAGTCAGGGTTCTCTAGAGG - Intronic
1106358091 13:29003796-29003818 AACTAGGCAGAGTGCTCCTGCGG + Intronic
1106382981 13:29257864-29257886 CACTAGGCAGATGGCTCCAGGGG + Intronic
1106780602 13:33055711-33055733 CATTAGGCAGAGTCCTCCAGAGG + Intronic
1106804683 13:33293966-33293988 CATTAGTCAGGGTTCTCTAGAGG - Intronic
1107236517 13:38177042-38177064 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1107638160 13:42414238-42414260 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1107933090 13:45322472-45322494 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1108732156 13:53246407-53246429 TATTAGCCAGGGTTCTCCAGAGG + Intergenic
1108805991 13:54156970-54156992 TATTAGTCAGAGTTCTCCAAAGG - Intergenic
1108882860 13:55142476-55142498 TATTAGTCAGAGTTCTCCAGAGG - Intergenic
1110602406 13:77389597-77389619 CCTAAGGGATAGTCCTCCAGGGG - Intergenic
1110816074 13:79861170-79861192 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1110948146 13:81450422-81450444 CATTAGTCAGCGTTCTCTAGAGG - Intergenic
1111031548 13:82606593-82606615 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1111150390 13:84246050-84246072 TATTAGGCAGGGTTCTCAAGAGG + Intergenic
1111391391 13:87600068-87600090 TATTAGTCAGAGTTCTCCAGAGG - Intergenic
1111802322 13:92996108-92996130 TATTAGGCAGGGTTCTCTAGAGG + Intergenic
1113218750 13:108073936-108073958 CATTAGTCAAGGTTCTCCAGAGG + Intergenic
1115219924 14:31048950-31048972 CATTAGTCAGGGTTCTCTAGAGG - Intronic
1116158802 14:41239949-41239971 CATTAGTCAGGGTTCTCTAGAGG + Intergenic
1116266094 14:42692448-42692470 TATTAGGCAGGGTTCTCTAGAGG + Intergenic
1116307815 14:43281380-43281402 CATTAGTCAGGGTTCTCCAGAGG + Intergenic
1116754539 14:48929538-48929560 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1117417126 14:55507538-55507560 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1118053598 14:62055726-62055748 TATTAGTCAGGGTCCTCTAGAGG + Intronic
1118466407 14:66035054-66035076 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1118983503 14:70734180-70734202 TATTAGTCAGGGTTCTCCAGAGG - Intronic
1119532839 14:75375010-75375032 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1119960032 14:78844785-78844807 TATTAGTCAGGGTTCTCCAGAGG - Intronic
1120126946 14:80755354-80755376 TATTAGTCAGGGTTCTCCAGTGG - Intronic
1120423137 14:84313837-84313859 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1121610516 14:95275624-95275646 CAATAGGCAGTGTGGTCCAGAGG - Intronic
1121798587 14:96755214-96755236 CAGCATGCAGAGACCTCCAGGGG - Intergenic
1121926503 14:97931992-97932014 TATTAGACAGGGTCCTCTAGAGG + Intronic
1121954714 14:98203525-98203547 CATTAGGCAGGGGTTTCCAGAGG - Intergenic
1124430471 15:29603408-29603430 CAAGAGGCAGACTCCTCCAGAGG - Intergenic
1127145579 15:56019636-56019658 TATTAGTCAGGGTTCTCCAGGGG - Intergenic
1128698284 15:69785376-69785398 TATTAGTCAGTGTTCTCCAGAGG + Intergenic
1129574638 15:76729355-76729377 TATTAGTCAGAGTTCTCTAGAGG - Intronic
1131926109 15:97385725-97385747 GATGGGGCAGAGTCCTGCAGTGG + Intergenic
1132464225 16:70375-70397 CACCAGTCAGAGCCCTCCAGAGG + Intronic
1133459187 16:5972244-5972266 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1135892467 16:26370021-26370043 TATTAGTCAGGGTCCTCTAGAGG + Intergenic
1135934050 16:26764240-26764262 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
1136390519 16:29961662-29961684 CAGTGGACAGAGTCCTCAAGTGG + Intronic
1136731710 16:32419835-32419857 TATTAATCAGAGTTCTCCAGAGG + Intergenic
1138208351 16:55141924-55141946 CATTTGGGAGAGTCTTCCAGGGG + Intergenic
1138750940 16:59420323-59420345 CATTAGTCAGGGCTCTCCAGAGG + Intergenic
1138999395 16:62490694-62490716 TATTAGTCACAGTTCTCCAGAGG - Intergenic
1140701238 16:77583349-77583371 GTTTGGGCAAAGTCCTCCAGGGG - Intergenic
1140712475 16:77691341-77691363 AAACAGGCAGATTCCTCCAGGGG - Intergenic
1141606694 16:85158146-85158168 CATTAGGGACAGTCCTTGAGAGG - Intergenic
1141848515 16:86627748-86627770 CATAAGGCAGAGGCCTCGGGGGG + Intergenic
1202994681 16_KI270728v1_random:97431-97453 TATTAATCAGAGTTCTCCAGAGG - Intergenic
1203021368 16_KI270728v1_random:409773-409795 TATTAATCAGAGTTCTCCAGAGG - Intergenic
1144062986 17:11599555-11599577 CTTCAGGCAGACTCCTCCAAAGG - Intronic
1147372787 17:40004953-40004975 TATTAGTCAGGGTCCTCTAGAGG + Intergenic
1149252098 17:54781968-54781990 CATTAGGGAGCATCATCCAGTGG + Intergenic
1149255234 17:54818410-54818432 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1150981479 17:70147228-70147250 CATTACTCAGAGGCCTCCATTGG - Intergenic
1151174403 17:72275296-72275318 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1151450766 17:74196948-74196970 TGCTAGGCAGAGTCCCCCAGGGG - Intergenic
1154506504 18:15045671-15045693 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1156742688 18:40351559-40351581 CATAAGCCAGACTCCTTCAGAGG + Intergenic
1156896530 18:42253197-42253219 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1156898545 18:42274047-42274069 TATTAGTCAGGGTCCTCTAGAGG - Intergenic
1157340943 18:46777960-46777982 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1157546482 18:48550219-48550241 CAGTAGGCAGAATTGTCCAGAGG + Intronic
1157888170 18:51388861-51388883 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
1158126043 18:54100531-54100553 TATTAGCCAGGGTTCTCCAGAGG - Intergenic
1158317710 18:56229910-56229932 CAATATTCAGAGTCCTACAGAGG + Intergenic
1159004996 18:63003633-63003655 TATTAGACAGGGTTCTCCAGAGG - Intergenic
1159021104 18:63143867-63143889 CATTGTGCAGAGTGCTGCAGGGG + Intronic
1159105574 18:63999556-63999578 CAGTAGGCAGAGTCCCTGAGTGG - Intronic
1159720781 18:71887923-71887945 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1160246174 18:77161925-77161947 CATTAGCCAGGGTTCTCTAGAGG - Intergenic
1162098294 19:8324059-8324081 CATGAGACTGAGTCCTCAAGGGG - Intronic
1163392349 19:17038346-17038368 CAATAGACAGAGGCCTCCTGCGG - Intergenic
1164117757 19:22238614-22238636 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1164875580 19:31683679-31683701 CATTAGTCAGGGTTCTCCAGAGG - Intergenic
1165068934 19:33244091-33244113 CATTTGGCAGAGTCCTGCAGTGG - Intergenic
1165079522 19:33299449-33299471 CAGCAGGAAGAGGCCTCCAGTGG - Intergenic
925067540 2:940146-940168 TGTTAGTCAGAGTTCTCCAGAGG + Intergenic
925080250 2:1057329-1057351 TATTAGTCAGGGTTCTCCAGAGG + Intronic
925245956 2:2383077-2383099 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
926453387 2:13035174-13035196 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
926517984 2:13873669-13873691 TATTAGTCAGAGTTCTCCAGAGG + Intergenic
928172662 2:29013312-29013334 TATTAGTCAGGGTTCTCCAGAGG + Intronic
928721510 2:34126418-34126440 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
928865922 2:35917666-35917688 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
929333975 2:40717481-40717503 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
929814823 2:45222250-45222272 CCTCAGGCAGTGTGCTCCAGAGG + Intergenic
930848937 2:55937195-55937217 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
933356468 2:81216310-81216332 CATTAGGGAGAGTCCTCAGAAGG - Intergenic
933977478 2:87523180-87523202 CATCAGGGACAGTCCTCCTGAGG + Intergenic
934314012 2:91899427-91899449 TATTAATCAGAGTTCTCCAGAGG - Intergenic
934506209 2:94896809-94896831 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
935948130 2:108304490-108304512 CCTTAGGCAGAGCCATCCTGAGG - Intronic
936269070 2:111034776-111034798 CCTCTGGCAGAGGCCTCCAGGGG + Intronic
936316345 2:111427625-111427647 CATCAGGGACAGTCCTCCTGAGG - Intergenic
936530666 2:113275072-113275094 AATTAGGCAGAGTCCTTTTGGGG + Intronic
937310875 2:120902644-120902666 CATTAGCCAGAGCCCTCCAGAGG + Intronic
937521310 2:122715931-122715953 CATTAGTCAGGGTTCTCTAGAGG + Intergenic
938772379 2:134511420-134511442 GACTTTGCAGAGTCCTCCAGTGG - Intronic
939068674 2:137514562-137514584 TATTAGTCAGAGTTCTCTAGAGG - Intronic
939164540 2:138626456-138626478 CATTATTCAAAGTCCTCCTGTGG - Intergenic
940490284 2:154350667-154350689 TATTAGTCAGAGTTCTCTAGAGG - Intronic
940676380 2:156728460-156728482 CATTGGGTAGAATCCTACAGAGG - Intergenic
941184873 2:162309299-162309321 CACTAGGCAGGGTCATCCTGAGG + Intronic
942732363 2:179074415-179074437 TATTAGTCAGAGTTCTCCAGAGG - Intergenic
942837359 2:180316061-180316083 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
943143976 2:184018540-184018562 CACTAGGCAGTGTGCCCCAGTGG - Intergenic
943239664 2:185366223-185366245 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
943832082 2:192476322-192476344 CATTAGTCAGGGTTCTCTAGAGG + Intergenic
944163006 2:196686360-196686382 AATTAGGTAGAGTCCTCCAACGG + Intronic
944416566 2:199485125-199485147 CTTTAGGCAGAGCCCAGCAGAGG - Intergenic
944846032 2:203668606-203668628 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
944877628 2:203978332-203978354 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
945321751 2:208432498-208432520 TATTAGTCAAAGTTCTCCAGAGG + Intronic
945331329 2:208542565-208542587 TATTAGTCAGAGTTCTCCAGAGG + Intronic
945717483 2:213377839-213377861 TATTAGTCAGAGCTCTCCAGAGG + Intronic
945739508 2:213643097-213643119 TATTAGCCAGAGTTCTCTAGCGG - Intronic
945910218 2:215640281-215640303 CATAAGGCAAATCCCTCCAGTGG - Intergenic
946533760 2:220605041-220605063 CATTAGTCAGTGTCCTCTAGAGG + Intergenic
947034415 2:225835925-225835947 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
947059227 2:226143761-226143783 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
947843102 2:233221420-233221442 CATTAGTCAGGGTTCTCTAGAGG + Intronic
948220489 2:236265637-236265659 TATTAGTCAGTGTTCTCCAGAGG - Intergenic
1169855799 20:10101291-10101313 AATTACCCAGTGTCCTCCAGTGG - Intergenic
1170084176 20:12510646-12510668 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1171236306 20:23527912-23527934 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1173492595 20:43495286-43495308 TATTAGTCAGGGTTCTCCAGCGG + Intergenic
1173747077 20:45445925-45445947 CATCAGGCACAGTCTTCCTGGGG - Intergenic
1174677537 20:52372968-52372990 GAAAAGTCAGAGTCCTCCAGTGG + Intergenic
1174956066 20:55100081-55100103 TATTAGTCAGGGTCCTCTAGAGG + Intergenic
1175698135 20:61117780-61117802 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1176099091 20:63356850-63356872 CATGAGGCACAGTCCTGGAGGGG - Intronic
1176420215 21:6508110-6508132 CATTAGTTAGGGTTCTCCAGAGG - Intergenic
1176791360 21:13323436-13323458 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1177027520 21:15938044-15938066 CATTAGTCAGGGTTCTCTAGAGG + Intergenic
1177278713 21:18950522-18950544 TATTAGTCAGAGTTCTCCAGAGG - Intergenic
1177296833 21:19186855-19186877 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1178627267 21:34228441-34228463 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1178781951 21:35612105-35612127 TATTAGTCAGAGTTCTCTAGAGG + Intronic
1179084045 21:38201853-38201875 CATTAGTCAGGGTTCTCTAGAGG - Intronic
1179436352 21:41364595-41364617 TATTAGTCAGAGTTCTCTAGAGG + Intronic
1179695707 21:43116430-43116452 CATTAGTTAGGGTTCTCCAGAGG - Intergenic
1180540765 22:16445313-16445335 TATTAATCAGAGTTCTCCAGAGG - Intergenic
1181366938 22:22384868-22384890 CATTAGTCAGCGTTCTCTAGAGG + Intergenic
1181750661 22:24986881-24986903 CTTTAGGCTGTGACCTCCAGAGG - Intronic
1181825450 22:25511662-25511684 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1182710477 22:32319620-32319642 TATTAGTCAGTGTGCTCCAGAGG - Intergenic
1183164026 22:36133925-36133947 GATGGAGCAGAGTCCTCCAGCGG - Intergenic
1185229950 22:49674013-49674035 CATGAGGCTGGGTCCTGCAGAGG - Intergenic
1185238596 22:49728629-49728651 TGTTAGTCAGAGTTCTCCAGAGG + Intergenic
949140049 3:620902-620924 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
949445960 3:4133836-4133858 TATTAGTCAGAGTTCTCTAGAGG - Intronic
950107436 3:10397160-10397182 CCTTAGGCTCTGTCCTCCAGAGG - Intronic
950456063 3:13093431-13093453 CATTAGGAAGCTTCCTCCACAGG + Intergenic
950466100 3:13154664-13154686 CAGAACGCAGAGTCCTCTAGTGG + Intergenic
951138158 3:19129033-19129055 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
951494230 3:23308662-23308684 TATTAGTCAGGGTTCTCCAGAGG + Intronic
952035386 3:29195344-29195366 TATTAGTCAGAGTTCTCCAGAGG + Intergenic
952570766 3:34713018-34713040 TATTAGTCAGGGTCCTCCAGAGG - Intergenic
953407470 3:42666566-42666588 CTGTAGGCAGGGTCCTCCATGGG + Intergenic
954381110 3:50219743-50219765 AATCAGGCAGAGCTCTCCAGTGG + Intronic
955611880 3:60766166-60766188 TATTAGTCAGGGTTCTCCAGAGG - Intronic
955742025 3:62101660-62101682 AATTTGGCAGTGGCCTCCAGTGG + Intronic
955820010 3:62886869-62886891 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
956255844 3:67282528-67282550 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
956452513 3:69388481-69388503 CATGAGTCGGAATCCTCCAGAGG - Intronic
957162579 3:76629300-76629322 CATTAGTCAGGGTTCTCTAGAGG + Intronic
957284237 3:78196963-78196985 TATTAGTCAGAGTTCTTCAGAGG + Intergenic
957635144 3:82774109-82774131 TATTAGTCAGCGTTCTCCAGAGG - Intergenic
957683770 3:83473596-83473618 CATTAGTCAGGGTTCTCCAGAGG - Intergenic
957687344 3:83518412-83518434 CATAGGGCTGAGTCTTCCAGAGG + Intergenic
958601935 3:96305804-96305826 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
959071355 3:101704807-101704829 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
959263168 3:104105524-104105546 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
960495141 3:118364061-118364083 TATTAAGCAGGGTTCTCCAGAGG + Intergenic
960811763 3:121633066-121633088 CATTAGGCAGACTCTCCCGGAGG - Exonic
961149308 3:124623331-124623353 TATTAGTCAGAGTTCTCTAGAGG + Intronic
961751170 3:129095688-129095710 CAATGGGCAGAGTCCTCCCATGG + Intronic
962443981 3:135448821-135448843 CATCAGGCAGTGTCCACCACAGG + Intergenic
962961741 3:140317461-140317483 CAGAAGGCACACTCCTCCAGTGG - Intronic
963913698 3:150838554-150838576 TATTAGTCAGTGTTCTCCAGAGG + Intergenic
965034668 3:163423164-163423186 TATTAGTCAGAGTTCTCTAGTGG + Intergenic
965291414 3:166886805-166886827 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
965446666 3:168781573-168781595 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
966661738 3:182422064-182422086 CATTAGCCAGGGTTCTTCAGAGG - Intergenic
966897200 3:184454455-184454477 TATGAGTCAGAGTTCTCCAGAGG + Intronic
967745257 3:193047837-193047859 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
967770312 3:193327006-193327028 CAGTAGGGACAGTCCCCCAGAGG + Exonic
969071778 4:4545431-4545453 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
970145530 4:13031747-13031769 TATTAGTCAGTGTTCTCCAGAGG + Intergenic
971078830 4:23183524-23183546 TATTAGTCAGGGTCCTTCAGAGG + Intergenic
971145460 4:23971382-23971404 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
971664159 4:29460098-29460120 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
971857729 4:32063491-32063513 CATTAGTCAGGGTTCTCTAGAGG - Intergenic
972123978 4:35740792-35740814 TATTAGTCAGAGTTCTCCAGAGG - Intergenic
972276933 4:37566144-37566166 TATTAGTCAGGGTTCTCCAGAGG - Intronic
972876989 4:43374724-43374746 TATTAGTTAGAGTTCTCCAGGGG + Intergenic
972920736 4:43938446-43938468 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
972964714 4:44495251-44495273 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
973245664 4:48008870-48008892 CATTAGGCAGTGTAATCCACAGG - Intronic
973539928 4:51925611-51925633 CATTAGTCAGGGTTCTCTAGAGG + Intergenic
974362076 4:60894239-60894261 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
976284746 4:83360662-83360684 TATTAGTCAGGGTCCTCTAGAGG - Intergenic
976354624 4:84102723-84102745 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
977204001 4:94149371-94149393 TTTTAGTCAGAGTTCTCCAGAGG - Intergenic
977445926 4:97131617-97131639 TATTAGCCAGAGTTCTCTAGAGG - Intergenic
977753966 4:100643669-100643691 CATTTGCTAGAGTTCTCCAGAGG - Intronic
977946224 4:102917510-102917532 TATTAATCAGAGTTCTCCAGAGG - Intronic
978210742 4:106132551-106132573 CATTAGGCAGTGCCCTACAGAGG - Intronic
978669782 4:111232817-111232839 TATTAGTCAGGGTTCTCCAGGGG - Intergenic
979094890 4:116535027-116535049 TATTAGTCAGAGTTCTCCAGAGG - Intergenic
979217768 4:118186308-118186330 TATTAGTCAGAGTTCTCTAGAGG + Intronic
979766604 4:124471488-124471510 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
979898942 4:126193321-126193343 CATTAGTCAGCGTTCTCTAGAGG + Intergenic
980091138 4:128444025-128444047 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
980184719 4:129446803-129446825 CAATAGGCATACTCCTGCAGAGG - Intergenic
980223440 4:129949116-129949138 CATAAGGCAGAATCCTTCAAAGG + Intergenic
980365748 4:131802744-131802766 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
980750340 4:137078973-137078995 CATTTGGTATAGTCATCCAGTGG - Intergenic
980807824 4:137836462-137836484 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
981247773 4:142560374-142560396 TATTAGTCAGAGTTCTCTAGAGG + Intronic
982122507 4:152156622-152156644 CAAGAGCCAGAGGCCTCCAGGGG + Intergenic
983304862 4:165973065-165973087 TATTAGTCAGGGTTCTCCAGAGG + Intronic
983583041 4:169327618-169327640 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
984400740 4:179260894-179260916 CATTAGTCAAGGTCCTCTAGAGG - Intergenic
985830595 5:2225580-2225602 GATTAGTCAGGGTTCTCCAGAGG + Intergenic
986677031 5:10194908-10194930 AAGAAGGCAGAGTCCTCCAGTGG - Intergenic
987088862 5:14493187-14493209 TATTAGTCAGGGTCCTTCAGAGG + Intronic
987539470 5:19235385-19235407 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
987703875 5:21437997-21438019 CATTAGTCAGGGTTCTCTAGAGG - Intergenic
989535784 5:42562262-42562284 CACTAGAGAGAGTTCTCCAGAGG + Intronic
990245054 5:53856321-53856343 CATTAGTCAGGGTTCTCTAGAGG + Intergenic
990526667 5:56634938-56634960 CATTAGGCAGAGCCCTTCAGAGG + Intergenic
991104750 5:62831719-62831741 CATTAGTCAGGGTTCTCCAGAGG - Intergenic
991116402 5:62960808-62960830 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
991951135 5:71947865-71947887 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
992091900 5:73324821-73324843 CATTAGGCAGACTCTCACAGGGG - Intergenic
992769278 5:80032395-80032417 TATTAGTCAGAGTTCTCTAGAGG + Intronic
992968034 5:82023124-82023146 AATTGGGCAGATTCTTCCAGTGG + Intronic
993336890 5:86670926-86670948 CATCAGTCAGAGTTCTCTAGAGG + Intergenic
994549577 5:101213562-101213584 TATTAGTCAGAGTCCTCCAGAGG - Intergenic
994588907 5:101748914-101748936 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
994761616 5:103861500-103861522 TATTAGTCAGGGTCCTCTAGAGG - Intergenic
994859658 5:105172585-105172607 TATTAGTCAGCGTTCTCCAGAGG + Intergenic
994914797 5:105961336-105961358 CATTGTGGAGAGTCCTTCAGAGG - Intergenic
995360044 5:111286006-111286028 CATTAGCCAGAGTCGATCAGAGG + Intronic
995662258 5:114498486-114498508 CATTAGGCAGAGTCCTCTGAGGG + Intergenic
995960886 5:117837815-117837837 TATTATTCAGTGTCCTCCAGAGG - Intergenic
996523342 5:124451130-124451152 CTTTAGGCAGAGCCATCAAGGGG - Intergenic
996556001 5:124779384-124779406 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
996606899 5:125334020-125334042 TATTAGGCAGGGTTCTCTAGAGG + Intergenic
996819662 5:127612510-127612532 TAGTAGTCAGAGTTCTCCAGAGG + Intergenic
997322769 5:132992391-132992413 AGTTTGGTAGAGTCCTCCAGGGG - Intergenic
997807590 5:136934419-136934441 CATTAGCCAGCATTCTCCAGAGG - Intergenic
999805512 5:155077572-155077594 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
999913238 5:156229326-156229348 AATTAGTCAGAGTTCTCTAGAGG - Intronic
1000598917 5:163248651-163248673 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1002085446 5:176772226-176772248 CATTGATCAGAGTTCTCCAGAGG + Intergenic
1002507336 5:179688825-179688847 AATTAGCCAGAGTGCTCCAGGGG + Intronic
1004948381 6:20640417-20640439 CATTATGCAGAAGCCTGCAGGGG + Intronic
1005622886 6:27636316-27636338 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1006746232 6:36344650-36344672 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1006755402 6:36410832-36410854 CATTTGGGAGAGTCCTGGAGAGG + Intronic
1007720239 6:43880810-43880832 CCTTAGGTTGAGTTCTCCAGAGG + Intergenic
1007972229 6:46063761-46063783 CATTGGGCAGAGTCCTCGGAAGG + Intronic
1009880030 6:69555090-69555112 TATTAGTCAGAGTTCTCCAGAGG - Intergenic
1010131856 6:72503573-72503595 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
1010552027 6:77235421-77235443 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1010818176 6:80384791-80384813 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1012071830 6:94630208-94630230 CATTAGTCAGGGTTCTCTAGAGG - Intergenic
1012096791 6:94972409-94972431 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1012342364 6:98142974-98142996 CACTAGGCAGAGTCCCACTGGGG + Intergenic
1012720568 6:102737105-102737127 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1012962390 6:105635894-105635916 CTTCAGACAGAGTCTTCCAGGGG + Intergenic
1013555596 6:111254017-111254039 CATGTGGAAGAGTACTCCAGGGG - Intergenic
1013729083 6:113141693-113141715 CATTTTGCTGGGTCCTCCAGGGG - Intergenic
1013856848 6:114583022-114583044 TATTAGGCAGGGTTCTCTAGGGG + Intergenic
1014066415 6:117131939-117131961 TATTAGTCAGGGTTCTCCAGGGG + Intergenic
1014346191 6:120272687-120272709 AATGAGGCAGATTCCTCCAATGG + Intergenic
1014926523 6:127277454-127277476 TATTAGGCAGTGTTCTCTAGGGG + Intronic
1015337857 6:132061979-132062001 CTTTGTGCACAGTCCTCCAGTGG - Intergenic
1015436414 6:133194701-133194723 CATGAGACAGAATCCTCCAAAGG - Intergenic
1016769109 6:147828762-147828784 CATTAGTCAGTGTTCTCCAAAGG - Intergenic
1018654518 6:166021138-166021160 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1019392176 7:794768-794790 CATCACGCAAAGGCCTCCAGAGG + Intergenic
1019947450 7:4341314-4341336 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
1020603000 7:10300104-10300126 CATTGGGCAGAATCCTCAAGAGG - Intergenic
1020886322 7:13822927-13822949 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1021404766 7:20252188-20252210 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1021951475 7:25779143-25779165 CATTAGTCAGGGTTCTCCAAAGG + Intergenic
1022635328 7:32127331-32127353 TATTAGTCAGGGTTCTCCAGAGG - Intronic
1022951477 7:35342752-35342774 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1023198988 7:37673058-37673080 CATTAGTCAGGGTTCTCTAGAGG - Intergenic
1024211314 7:47208017-47208039 TGTTAGGCAGGGTTCTCCAGAGG + Intergenic
1024468329 7:49738315-49738337 CATTAGTCAGGGTTCTCTAGTGG - Intergenic
1026192803 7:68144890-68144912 TATTAGTCAGCGTTCTCCAGAGG - Intergenic
1027235408 7:76294902-76294924 CAGTTGGCAGAGGCCTGCAGAGG + Intergenic
1027692900 7:81370295-81370317 CATTAGTCAAGGTTCTCCAGAGG - Intergenic
1027794925 7:82680167-82680189 TATTAGTCAGAGTTCTCCAGAGG - Intergenic
1028559248 7:92155567-92155589 TATTAGTCAGGGTTCTCCAGAGG + Intronic
1029292852 7:99515857-99515879 AATTAAGCTGAGTCCTCGAGAGG + Intronic
1030321159 7:108169660-108169682 AATTATGCAGAGTCCTTCTGTGG + Intronic
1031312488 7:120216024-120216046 CATTAGTCAGGGTTCTCCAGAGG - Intergenic
1031676171 7:124615058-124615080 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1032527472 7:132590319-132590341 TATTAGTCAGGGTTCTCCAGCGG + Intronic
1032591417 7:133195228-133195250 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1032795194 7:135270803-135270825 CAGTGGGCAGAGGCCTCCGGGGG - Intergenic
1033403585 7:141050660-141050682 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1034949376 7:155286744-155286766 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1035427466 7:158790020-158790042 CAGTGGGGAGAGTCCTCCTGGGG + Intronic
1036506034 8:9356873-9356895 TATTAGTTAGAGTTCTCCAGAGG - Intergenic
1037177801 8:15967413-15967435 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1038393112 8:27223635-27223657 AATTAGTCAGAGTTCTCTAGAGG - Intergenic
1038920691 8:32080718-32080740 TATTAGTCAGGGTTCTCCAGAGG + Intronic
1039131698 8:34272278-34272300 CATTAGTCAGGGTTCTCCAGAGG + Intergenic
1039240176 8:35547792-35547814 CATTAGTCAGGGTTCTCTAGAGG + Intronic
1039797324 8:40926449-40926471 CATTAGTCAGGGTGCTTCAGAGG - Intergenic
1040356148 8:46620435-46620457 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1040458368 8:47622407-47622429 CAGGAGGCATAGTCCTCCAAGGG + Intronic
1040793782 8:51267513-51267535 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
1040916552 8:52571124-52571146 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
1042823494 8:72957138-72957160 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1043001740 8:74768252-74768274 CATTAGTCAGTGTTCTCCAGAGG + Intronic
1043187983 8:77179354-77179376 AATTAGTAAGAGCCCTCCAGGGG - Intergenic
1044000804 8:86878737-86878759 AAATAGGAAGAGTTCTCCAGGGG - Intronic
1044435224 8:92153924-92153946 CATTAGTCAGGGTTCTCTAGAGG - Intergenic
1045620759 8:103975544-103975566 TATTAGTCAGTGTTCTCCAGAGG + Intronic
1046029501 8:108766600-108766622 CATTAGTCAGGGTTCTCTAGTGG + Intronic
1046400309 8:113696764-113696786 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1046418064 8:113941123-113941145 CATTAGTCAGGGTTCTCTAGAGG + Intergenic
1047054039 8:121144693-121144715 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1047245314 8:123137792-123137814 TATCAGGCAGAGTATTCCAGGGG + Intronic
1047550909 8:125871289-125871311 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1047565129 8:126035830-126035852 TATTAGTCAGAGTTCTCCAGAGG + Intergenic
1047941723 8:129832944-129832966 CAGACTGCAGAGTCCTCCAGAGG + Intergenic
1048263600 8:132966213-132966235 CATTAGACAGAAGTCTCCAGGGG + Intronic
1048491821 8:134901344-134901366 CACTAGGCAGAGTGCTTCAGGGG + Intergenic
1049857035 8:144868810-144868832 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1050498332 9:6267643-6267665 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1050975745 9:11936108-11936130 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1051227569 9:14918033-14918055 TATTAGTCAGAGTTCTCTAGAGG + Intergenic
1051841835 9:21406690-21406712 TATTAGTCAGAGTTCTCCAGAGG + Intergenic
1051861450 9:21629360-21629382 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1051882298 9:21852020-21852042 TATTAGTCAGAGTTCTCTAGAGG - Intronic
1052411681 9:28129304-28129326 TATTAGTCAGGGTTCTCCAGAGG - Intronic
1053505521 9:38640232-38640254 CAATATGCAAATTCCTCCAGTGG + Intergenic
1053630097 9:39928613-39928635 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1053775675 9:41534919-41534941 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1054213790 9:62322089-62322111 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1055752349 9:79521167-79521189 CATTAGTCAGGGTTCTCCAGAGG + Intergenic
1055786128 9:79870701-79870723 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1055836139 9:80445256-80445278 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1055883006 9:81024286-81024308 CATTAGTCAGGTTTCTCCAGAGG - Intergenic
1056079117 9:83072383-83072405 CATTAGTCAGGGTTCTCTAGAGG + Intergenic
1056705788 9:88951932-88951954 TATTAGTCAGGGTCCTCTAGAGG - Intergenic
1056932803 9:90892792-90892814 CATTCGGCAGAGGCCCCCACTGG - Intronic
1057158219 9:92863801-92863823 CGTTAGGCAGAGGCCTAGAGTGG + Intronic
1057498390 9:95577950-95577972 CCTTTGGCAGACTCCTACAGCGG - Intergenic
1058094525 9:100844306-100844328 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1058094735 9:100846810-100846832 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1058096223 9:100863076-100863098 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1058347605 9:103982398-103982420 TATTAGTCAGAGTTCTCTAGAGG - Intergenic
1058797320 9:108511266-108511288 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1059552963 9:115248521-115248543 TATTAGTCAGGGTCCTCTAGAGG - Intronic
1060446697 9:123695514-123695536 TATTAGTCAGAGTTCTCTAGAGG - Intronic
1060704504 9:125785716-125785738 TATTAGTCAGTGTTCTCCAGAGG - Intronic
1060958054 9:127658464-127658486 CCTTAGCCAGAGTCCTCCTCTGG - Intronic
1203566871 Un_KI270744v1:99542-99564 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1185719515 X:2371044-2371066 CTATAGGCAGCGTCCACCAGTGG + Intronic
1185927021 X:4158526-4158548 CATGGGGCAGAGTCCAGCAGGGG + Intergenic
1187319493 X:18227037-18227059 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1187455038 X:19433660-19433682 TCTTAGGCAGGGTTCTCCAGAGG - Intronic
1187660266 X:21538526-21538548 TATTAGTCAGGGTTCTCCAGAGG + Intronic
1187801573 X:23069509-23069531 TATTAGTCAGAGTTCTTCAGAGG + Intergenic
1187911559 X:24116005-24116027 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1189785607 X:44556485-44556507 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1190511635 X:51179104-51179126 CAGTAGTCAGGGTTCTCCAGAGG + Intergenic
1192412637 X:70948012-70948034 TATTAGTCAGAGTTATCCAGAGG - Intergenic
1193235477 X:79101265-79101287 TATTAGTCAGAGTTCTCCAGAGG - Intergenic
1193984666 X:88225960-88225982 TATTAGTCAGAATTCTCCAGAGG - Intergenic
1194591103 X:95800668-95800690 TATTAGTCAGAGTGCTCCAGTGG - Intergenic
1194676654 X:96802664-96802686 TATTAGTCAGCGTTCTCCAGAGG + Intronic
1195420490 X:104670008-104670030 TATTAGTCAGAGTTTTCCAGAGG + Intronic
1197537213 X:127705963-127705985 TATTAGTCAGAATTCTCCAGAGG - Intergenic
1197633224 X:128886250-128886272 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1197861031 X:130970899-130970921 TATTAGTCAGGGTTCTCCAGAGG + Intergenic
1197912679 X:131501577-131501599 AATTAGTCAGAGTTCTCTAGAGG + Intergenic
1198412157 X:136381628-136381650 TATTAGTCAGAGTTCTCTAGAGG + Intronic
1199114077 X:143969659-143969681 CATTAGTCAGAGTTCTTCAGAGG + Intergenic
1199533919 X:148880498-148880520 CATTAGGCAGAGTCTTACTCTGG - Intronic
1199785307 X:151099921-151099943 TATTAGTCAGGGTTCTCCAGAGG - Intergenic
1200314986 X:155123130-155123152 CATTACCCAGTTTCCTCCAGTGG - Intronic
1201181921 Y:11356908-11356930 TATTAATCAGAGTTCTCCAGAGG - Intergenic
1201255534 Y:12104561-12104583 TATTAGTCAGTGTTCTCCAGTGG - Intergenic
1201480914 Y:14438572-14438594 CTTTAGTCAGGGTTCTCCAGAGG + Intergenic
1201751099 Y:17432901-17432923 TATTAGTCAGGGTTCTCCAGAGG - Intergenic