ID: 1106780757

View in Genome Browser
Species Human (GRCh38)
Location 13:33056971-33056993
Sequence AGTGGAATCCACTCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 176}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106780757_1106780763 -7 Left 1106780757 13:33056971-33056993 CCCTCCTCAGAGTGGATTCCACT 0: 1
1: 0
2: 2
3: 15
4: 176
Right 1106780763 13:33056987-33057009 TTCCACTGTGGGGTTCAGAGAGG 0: 1
1: 0
2: 2
3: 14
4: 219
1106780757_1106780769 19 Left 1106780757 13:33056971-33056993 CCCTCCTCAGAGTGGATTCCACT 0: 1
1: 0
2: 2
3: 15
4: 176
Right 1106780769 13:33057013-33057035 TGAGGTGGGAGAAGTGAGGCTGG 0: 1
1: 0
2: 13
3: 112
4: 1081
1106780757_1106780766 4 Left 1106780757 13:33056971-33056993 CCCTCCTCAGAGTGGATTCCACT 0: 1
1: 0
2: 2
3: 15
4: 176
Right 1106780766 13:33056998-33057020 GGTTCAGAGAGGATCTGAGGTGG 0: 1
1: 0
2: 1
3: 40
4: 293
1106780757_1106780767 5 Left 1106780757 13:33056971-33056993 CCCTCCTCAGAGTGGATTCCACT 0: 1
1: 0
2: 2
3: 15
4: 176
Right 1106780767 13:33056999-33057021 GTTCAGAGAGGATCTGAGGTGGG 0: 1
1: 0
2: 0
3: 22
4: 210
1106780757_1106780770 24 Left 1106780757 13:33056971-33056993 CCCTCCTCAGAGTGGATTCCACT 0: 1
1: 0
2: 2
3: 15
4: 176
Right 1106780770 13:33057018-33057040 TGGGAGAAGTGAGGCTGGTGAGG 0: 1
1: 1
2: 0
3: 59
4: 696
1106780757_1106780765 1 Left 1106780757 13:33056971-33056993 CCCTCCTCAGAGTGGATTCCACT 0: 1
1: 0
2: 2
3: 15
4: 176
Right 1106780765 13:33056995-33057017 TGGGGTTCAGAGAGGATCTGAGG 0: 1
1: 0
2: 3
3: 40
4: 395
1106780757_1106780768 15 Left 1106780757 13:33056971-33056993 CCCTCCTCAGAGTGGATTCCACT 0: 1
1: 0
2: 2
3: 15
4: 176
Right 1106780768 13:33057009-33057031 GATCTGAGGTGGGAGAAGTGAGG 0: 1
1: 0
2: 4
3: 44
4: 622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106780757 Original CRISPR AGTGGAATCCACTCTGAGGA GGG (reversed) Intronic
900374742 1:2348366-2348388 AGTGGAGTCCACCGTGAGGCTGG + Intronic
900602205 1:3507794-3507816 AGTGGAACTAACTGTGAGGATGG - Exonic
902719207 1:18292836-18292858 AGTGAGATTCCCTCTGAGGAGGG - Intronic
903186407 1:21631845-21631867 AGTGGGATGCACGCTGTGGAAGG - Intronic
908170112 1:61495960-61495982 AGGGGACTCCACTCTTAGGATGG - Intergenic
910937804 1:92500121-92500143 AGTGGTAACCACTCTTGGGATGG - Intergenic
912363300 1:109112817-109112839 AGAGGAATTCCCTCAGAGGAGGG + Intronic
913291390 1:117275690-117275712 AGTGTCATCCAATCTGAAGATGG - Intergenic
918267866 1:182863670-182863692 AGTGGCATGCAGTCTGAGAAAGG + Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920075644 1:203334594-203334616 TGTGGAACCCACCCTGATGACGG + Intergenic
921746272 1:218743634-218743656 AGTGGACTCCCCTCTGATGTAGG - Intergenic
921822341 1:219631405-219631427 AATGGAATCCAGTCTGAGGCAGG - Intergenic
923383642 1:233446014-233446036 GGTGGAATGCCCTCAGAGGAAGG - Intergenic
1063312699 10:4969532-4969554 GATGAAATCCACACTGAGGAAGG + Intronic
1063315240 10:4998015-4998037 GATGAAATCCACACTGAGGAAGG - Intronic
1064251328 10:13708526-13708548 AGTGAAATGCACTCTGAGCCGGG - Intronic
1064731287 10:18333313-18333335 AGAGGGATAAACTCTGAGGAAGG + Intronic
1065750066 10:28877792-28877814 AGGGGAATCCTATCTTAGGAAGG - Intronic
1067283242 10:44888880-44888902 TGTGGATCCCAATCTGAGGATGG + Intergenic
1069406971 10:68111795-68111817 AGTGCACTCCACTCTCAGGGAGG + Intronic
1070666981 10:78351904-78351926 GGAGGAAGCCAATCTGAGGATGG - Intergenic
1071211405 10:83345872-83345894 AGTGCATTTCTCTCTGAGGAAGG - Intergenic
1072478322 10:95785028-95785050 AGTGGAAATCACTTTGATGAGGG + Intronic
1076198958 10:128542661-128542683 TGTGGAATCCACTCTGGAAATGG + Intergenic
1076429609 10:130392291-130392313 AGTGGAACCTGCTCTGAGGCAGG - Intergenic
1079252957 11:18800892-18800914 AGTGCCATCCACTGTGAGGAAGG + Intergenic
1080801630 11:35615555-35615577 ACTGCATTCCACTTTGAGGAAGG + Intergenic
1084564201 11:69920276-69920298 AGGGGAACTCACCCTGAGGAGGG - Intergenic
1087341720 11:96915479-96915501 AGTGAAATCCAGGCTGAGAATGG + Intergenic
1087614321 11:100470900-100470922 AGTGAAGTGCTCTCTGAGGAAGG - Intergenic
1088713311 11:112527367-112527389 AGAGAAATCCAGCCTGAGGAAGG + Intergenic
1089702252 11:120252516-120252538 GGTGGGAGCCACTCTGAGAAGGG - Intronic
1091078144 11:132640655-132640677 AAATGTATCCACTCTGAGGATGG - Intronic
1091109204 11:132949940-132949962 AGGGGAAGCCTCTCTGAAGAGGG + Intronic
1092785778 12:12025334-12025356 AGTGGAGCCCAAACTGAGGATGG + Intergenic
1092833194 12:12464623-12464645 AGTGGGGTCCATGCTGAGGAAGG + Intronic
1093929089 12:24937216-24937238 AGTAGCATCCAATCTGAGGTTGG + Intronic
1095047677 12:37526835-37526857 AGAGGAATCCACACATAGGAAGG + Intergenic
1101543645 12:105688969-105688991 AGTGGAATCCTCACTCAGTAAGG - Intergenic
1102784829 12:115595940-115595962 AGTGGAGTCCACTGTGATGATGG - Intergenic
1103597813 12:122034872-122034894 AGTGGAGTACACTTTGAGAAAGG + Intronic
1104146824 12:126042096-126042118 AGTGGAAGTCAATCTGAAGATGG - Intergenic
1104710445 12:130982104-130982126 AGTGGAGTCTTCTCTGAGAATGG + Intronic
1104851917 12:131880232-131880254 TGTGGCATCCACTCTCAAGATGG + Intergenic
1104992652 12:132634852-132634874 AGTGTAGACCGCTCTGAGGAGGG - Intronic
1106287255 13:28328713-28328735 CATGGAAGCCCCTCTGAGGACGG - Intronic
1106541691 13:30696444-30696466 ACTGGAAGCCACTGAGAGGAAGG + Intergenic
1106780757 13:33056971-33056993 AGTGGAATCCACTCTGAGGAGGG - Intronic
1107017990 13:35723530-35723552 TGTGGAATTCACTTTCAGGAAGG + Intergenic
1107938948 13:45367538-45367560 GAGGGAGTCCACTCTGAGGATGG - Intergenic
1108573150 13:51769596-51769618 ATTAGAATCCTCTCTTAGGATGG - Intronic
1111612149 13:90617984-90618006 GCTGGAATACATTCTGAGGATGG - Intergenic
1112517045 13:100062877-100062899 AGTGAACACCACTCTGAGGAAGG - Intergenic
1113398167 13:109968253-109968275 AGTGGAAGCATCTGTGAGGAAGG + Intergenic
1113675812 13:112207160-112207182 AGGAGAAGCCACCCTGAGGAAGG + Intergenic
1117625870 14:57637544-57637566 AATGGGATCCTCTCCGAGGATGG + Intronic
1117936689 14:60914608-60914630 AATAGAGTCCACTCTGGGGATGG + Intronic
1122038673 14:98966356-98966378 AGTGGAATTCACACTGGAGATGG - Intergenic
1122076138 14:99236002-99236024 ACTAGAATCCAGTCTGAGGAGGG + Intronic
1123939187 15:25208545-25208567 AGGGGAATCCCCACTGGGGAGGG + Intergenic
1126029240 15:44480051-44480073 AGTGGAATCAAATGTGAGTAGGG - Intronic
1128231873 15:66040888-66040910 ATTCGTATCCACTCAGAGGAAGG + Intronic
1128685017 15:69677608-69677630 AGTGACATCCACTTTGAGGCAGG + Intergenic
1130139209 15:81209452-81209474 AGTGGAGTCAAGTCTGAGGCAGG + Intronic
1130155035 15:81343000-81343022 AGTAGAATACACTCTTAGGGAGG - Intronic
1133935977 16:10269710-10269732 AGGGCAATACATTCTGAGGATGG - Intergenic
1134435700 16:14254360-14254382 TGGGGAATCCACACTCAGGAAGG + Intronic
1134760200 16:16707799-16707821 AGTGGAGGCCCCTCTGAGCAGGG + Intergenic
1134985872 16:18651406-18651428 AGTGGAGGCCCCTCTGAGCAGGG - Intergenic
1137709220 16:50555009-50555031 TGTGGCATCCAGTCTGATGAAGG + Intronic
1138397523 16:56716952-56716974 AGTTGGATCCACTCCCAGGAAGG - Intronic
1138438359 16:57019602-57019624 GGTGGAACCCATACTGAGGAAGG - Intronic
1142913792 17:3117096-3117118 AGTGGAAGGGACCCTGAGGATGG - Intergenic
1145410959 17:22663336-22663358 AGAGGAATCCACACATAGGAAGG + Intergenic
1146647566 17:34585209-34585231 ATTGGAATCCATTCTGAGGACGG + Intronic
1147910572 17:43853630-43853652 AGATGAAGCCACTTTGAGGAAGG - Intronic
1150666816 17:67147766-67147788 GGTGGAACCCTCTCTGTGGAGGG - Intronic
1151277900 17:73049729-73049751 AGTGGAAGCCCCTCTCAGGCGGG - Intronic
1153043888 18:838380-838402 AGTGGAATAAACTCTGAGCCGGG - Intergenic
1153619750 18:6966318-6966340 AATAGAATCCATTCTCAGGAGGG + Intronic
1157109258 18:44804649-44804671 AGTTCTATCCACTATGAGGAAGG + Intronic
1157277089 18:46318716-46318738 AGTGGAATCCACAGTGAGGATGG + Intergenic
1158010162 18:52719408-52719430 CGTTGAGTCCACTCTCAGGAAGG + Intronic
1158737033 18:60094070-60094092 TGAGGAATCCACTCTTATGATGG - Intergenic
1159047422 18:63382699-63382721 AGTGGAATCAGGGCTGAGGAGGG - Intergenic
1160186246 18:76678806-76678828 CGTGGAAGCCAGCCTGAGGACGG - Intergenic
1160337547 18:78055713-78055735 AGGTGATTCCACTGTGAGGAGGG - Intergenic
1161437788 19:4273875-4273897 AGGGGTTCCCACTCTGAGGAAGG - Intergenic
1161846077 19:6712716-6712738 AGTGGACTCTACTCTGAGGGAGG - Intronic
1162737860 19:12756372-12756394 AGTGGAATCAATTCTGGAGATGG + Intronic
1162847751 19:13406601-13406623 GGTAGAATCCACTCTGATGCTGG - Intronic
1164767988 19:30786428-30786450 AGTGTAATAGAGTCTGAGGAAGG - Intergenic
1164820175 19:31243868-31243890 TGTGGAATACACTTGGAGGAGGG + Intergenic
1166128612 19:40731787-40731809 GGTGGGATCCTCTCTGGGGAGGG + Intronic
1168717751 19:58539113-58539135 AGAAGAATCCTGTCTGAGGAGGG - Intergenic
1168717846 19:58539578-58539600 AGAAGAATCCTGTCTGAGGAGGG - Intergenic
1168717991 19:58540197-58540219 AGAAGAATCCTGTCTGAGGAGGG - Intergenic
1168718337 19:58541590-58541612 AGGAGAATCCTGTCTGAGGAGGG - Intergenic
1168718621 19:58542791-58542813 AGGGGAACCCTGTCTGAGGAGGG - Intergenic
926059827 2:9798303-9798325 AGTAGACTCCTCACTGAGGAGGG + Intergenic
929959312 2:46484547-46484569 ATCAGAATCCACTCTTAGGAAGG + Intergenic
931668558 2:64627086-64627108 AGTGCATTCCACTCAGAGCATGG + Intergenic
931823598 2:65976822-65976844 GGTAGAATCCACTCAGAGTAGGG + Intergenic
932246881 2:70203598-70203620 ACTGGAATACATTCTGGGGATGG + Intronic
934477170 2:94601567-94601589 AGTGGAAGCCAGATTGAGGAGGG + Intronic
935173482 2:100628624-100628646 AGCCGAATCCACTCTGAGGGTGG - Intergenic
937206519 2:120240134-120240156 AGTGCAATCCACACCGAGGGCGG - Intronic
941715858 2:168762623-168762645 AGTTGTATTCACTCTGGGGAAGG - Intronic
941857909 2:170249130-170249152 ACTGGTTTCCACTCAGAGGAAGG + Intronic
944678427 2:202053689-202053711 AGTGGAATCTTCTCTGAGATGGG - Intergenic
948466738 2:238155837-238155859 AGTGGCTTTCACTCAGAGGAAGG - Intergenic
948604626 2:239126987-239127009 TGTGGTAGCCACTCTGGGGAAGG - Intronic
1168866023 20:1087312-1087334 AGGGAAGGCCACTCTGAGGAGGG + Intergenic
1171770570 20:29319709-29319731 TGAGGGATCCACTCAGAGGAGGG + Intergenic
1171798803 20:29589596-29589618 AGAGGAATCCACACATAGGAAGG - Intergenic
1171845258 20:30266964-30266986 AGAGGAATCCACACATAGGAAGG + Intergenic
1173247590 20:41347348-41347370 AGTGAAGGCCTCTCTGAGGAAGG + Intronic
1175922227 20:62455630-62455652 GGTGGCATCCCCTCCGAGGATGG - Intergenic
1179373392 21:40827743-40827765 AGTGGGCTCCATTCTCAGGAAGG + Intronic
1183765650 22:39871391-39871413 AATGGACTTAACTCTGAGGATGG - Intronic
950915378 3:16639101-16639123 AGGGGGATCGACTCTTAGGAGGG + Intronic
952007202 3:28855597-28855619 AGTGGAATCAACTTTGAGTTTGG + Intergenic
952997501 3:38899170-38899192 AGAGAAATCCAATCTGAGAAGGG - Intronic
952998562 3:38908954-38908976 AGTGGGATCTGCTCTGGGGAGGG - Intronic
953369591 3:42376213-42376235 AGTGGAATCCACCCTTCGCAGGG + Intergenic
954277503 3:49552233-49552255 CCAGGAATCCACTCTGAGGAGGG + Intergenic
955039727 3:55304133-55304155 AGTGGAAGCCTCTCTGCGTATGG - Intergenic
956433282 3:69208618-69208640 AGGGAAAGCCTCTCTGAGGAAGG - Intronic
960316881 3:116189167-116189189 ATTGAAGGCCACTCTGAGGAGGG + Intronic
961439426 3:126944080-126944102 AGTTGGATCCACAGTGAGGATGG + Intronic
961543739 3:127617928-127617950 AGGGGAATCCACCCTGATGGAGG + Intronic
961928531 3:130509152-130509174 TGTGGAATCCAGTGTGAAGAGGG - Intergenic
962069317 3:132016921-132016943 GATGGACTTCACTCTGAGGAAGG - Intronic
964707909 3:159640349-159640371 TGTGGAATTGACTCTGAGAAAGG - Intronic
966242179 3:177766830-177766852 ACAGGAAACCACGCTGAGGATGG + Intergenic
968077906 3:195826467-195826489 ACTGGGAGCCATTCTGAGGAGGG + Intergenic
969325659 4:6442386-6442408 AGTGGAACCCACACAGAGAAGGG + Intronic
972970406 4:44567785-44567807 ACTGGAATACATTCTGAGTAAGG - Intergenic
973879138 4:55251064-55251086 AGAGGAAGCCTTTCTGAGGATGG - Intergenic
976328730 4:83803207-83803229 CGTGGAGTCCACTTTGAGAAGGG - Intergenic
976590905 4:86848989-86849011 AGTGGTGTCCACTGTGATGATGG - Exonic
985856130 5:2428959-2428981 AGGGGAAGCCACTTTGAAGAGGG + Intergenic
987826926 5:23043779-23043801 AGTGAAATGCAATCTAAGGAAGG - Intergenic
988682379 5:33496404-33496426 AGTGGGACCCTCTCTGGGGATGG + Intergenic
989345400 5:40423795-40423817 AGGGTATTCCACTCTGAGCATGG - Intergenic
994267773 5:97738448-97738470 AGTGTAATCCACCATGATGAGGG - Intergenic
997445811 5:133939381-133939403 AATGGAGTCCACTCTGAGGTGGG - Intergenic
998341091 5:141418638-141418660 AGTGGCCTTCACTCTCAGGATGG - Exonic
999044161 5:148449562-148449584 AAGAGAATCCACTCTGAGGAGGG + Intergenic
1001752370 5:174141468-174141490 ACTTGAATCCAATCTGAGAATGG - Intronic
1001970533 5:175951762-175951784 AGTGGAGTCAAGGCTGAGGATGG - Intronic
1002246904 5:177892003-177892025 AGTGGAGTCAAGGCTGAGGATGG + Intergenic
1003743190 6:8967245-8967267 AGTGGAAGCTACTTGGAGGAAGG - Intergenic
1003750099 6:9045806-9045828 AGTGAAAACCACACTGGGGATGG + Intergenic
1004459006 6:15818164-15818186 AGTGGAAGGCAGTCTCAGGAAGG + Intergenic
1004707246 6:18135917-18135939 AGTGAACTGCACTCTGAGCAAGG - Intronic
1007581371 6:42962202-42962224 AATGGAGTCCACCCTGAGTACGG - Exonic
1013088515 6:106876987-106877009 AGTGAAGTCCAGACTGAGGAGGG - Intergenic
1015969830 6:138732399-138732421 TGTGTAATCCTCTCTCAGGAAGG + Intergenic
1017933308 6:158979791-158979813 AGTGCTTTTCACTCTGAGGAAGG + Intronic
1024492736 7:50004135-50004157 AGTGCAACCCACTTTGAGGATGG - Intronic
1024677929 7:51654647-51654669 AGGGGTATCCCCTCTGAAGATGG + Intergenic
1025293671 7:57756638-57756660 AGAGGAATCCACACATAGGAAGG + Intergenic
1026533232 7:71218432-71218454 AGTGGAAGCAATTCTTAGGAGGG - Intronic
1028034542 7:85964681-85964703 AGTGGCATCCACATTCAGGAAGG + Intergenic
1028725081 7:94077398-94077420 GGTGGAATCCACTTAGAGGCTGG - Intergenic
1029619146 7:101679149-101679171 ATTGGGATCCACTGTGGGGAAGG - Intergenic
1032060360 7:128718939-128718961 AGTGGAAGACAGTCTCAGGATGG - Exonic
1033742514 7:144285490-144285512 AGAGGGATCCAGGCTGAGGAAGG - Intergenic
1033751388 7:144364124-144364146 AGAGGAATCCAGGCTGAGGAAGG + Exonic
1037705359 8:21312437-21312459 ACTGGGATCCAGTCTGGGGATGG + Intergenic
1037914839 8:22766702-22766724 AATGGAATCCAATATGAAGATGG + Intronic
1038747756 8:30269020-30269042 AATAGAATCCACGGTGAGGAGGG + Intergenic
1040692885 8:49961184-49961206 AGTGGAAACAGCTCTGAGGGGGG - Intronic
1041566938 8:59289216-59289238 AATGCCCTCCACTCTGAGGATGG - Intergenic
1042801270 8:72720583-72720605 AGTGTAATGCACTATGATGAAGG - Intronic
1043864634 8:85361092-85361114 ACTGGCATCCACTCTCAGGATGG - Intronic
1044176257 8:89126958-89126980 AGTGGTAGGGACTCTGAGGATGG + Intergenic
1048225790 8:132584145-132584167 AGTGGAAAGCACTCTGAGATGGG + Intronic
1048625902 8:136184612-136184634 AGTGGATTTCTCCCTGAGGAAGG - Intergenic
1052852802 9:33387985-33388007 AGTGGAAGCCAGATTGAGGAGGG - Intronic
1053173672 9:35907813-35907835 AGTGGGATCCACAGCGAGGAAGG + Intergenic
1053930891 9:43112840-43112862 AGTGGAAGCCAGATTGAGGAGGG - Intergenic
1054162821 9:61688893-61688915 AGAGGAATCCACACATAGGAAGG - Intergenic
1056179178 9:84065028-84065050 AGGGGAATCCACCTTGAGGCAGG + Intergenic
1057014944 9:91643075-91643097 AGTGACATCCACTAAGAGGAAGG + Intronic
1057049044 9:91908086-91908108 AGTGGAATCCAAACTGAGTCTGG + Intronic
1058670123 9:107354303-107354325 AGTGACTTCCACTCTTAGGATGG + Intergenic
1191786824 X:64925157-64925179 AGTGGAAACCACTCTGGTGAAGG - Intronic
1192859178 X:75047825-75047847 AGTTGACTGCACTCTCAGGACGG + Intergenic
1199972788 X:152873005-152873027 ACTGGAATCCACGAGGAGGAGGG + Intergenic
1202192637 Y:22260390-22260412 AGGGGAATCCATACTGGGGATGG + Intergenic