ID: 1106782835

View in Genome Browser
Species Human (GRCh38)
Location 13:33076870-33076892
Sequence GCTGCTGCTGTTACACATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106782835_1106782839 13 Left 1106782835 13:33076870-33076892 CCAGCATGTGTAACAGCAGCAGC No data
Right 1106782839 13:33076906-33076928 ATGGCAGCTCCATAAGTTATAGG No data
1106782835_1106782838 -6 Left 1106782835 13:33076870-33076892 CCAGCATGTGTAACAGCAGCAGC No data
Right 1106782838 13:33076887-33076909 AGCAGCAGCAGAGGTGGCAATGG No data
1106782835_1106782841 24 Left 1106782835 13:33076870-33076892 CCAGCATGTGTAACAGCAGCAGC No data
Right 1106782841 13:33076917-33076939 ATAAGTTATAGGAAAATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106782835 Original CRISPR GCTGCTGCTGTTACACATGC TGG (reversed) Intergenic
No off target data available for this crispr