ID: 1106785834

View in Genome Browser
Species Human (GRCh38)
Location 13:33107416-33107438
Sequence GATTATGCACAGAGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106785834 Original CRISPR GATTATGCACAGAGGGCTCT GGG Intronic
902894497 1:19469571-19469593 GAGTCAGCTCAGAGGGCTCTGGG + Intronic
903660169 1:24972270-24972292 GAGTGAGCTCAGAGGGCTCTGGG - Intergenic
904282682 1:29432449-29432471 GGATATGCACAGAGGGCTGTGGG - Intergenic
904927412 1:34059834-34059856 GATTCAGCCCAGAGGGATCTGGG - Intronic
906713972 1:47953215-47953237 GATGATGCACAGAGGGGTGTGGG + Intronic
908725366 1:67170339-67170361 GATTAGGAACAGAGGACTGTAGG - Intronic
910583004 1:88848781-88848803 CATGAGGCACAGAGGCCTCTTGG + Intergenic
911065163 1:93781578-93781600 GATGATGAAAACAGGGCTCTGGG + Intronic
911218289 1:95219352-95219374 CATTAGGCTGAGAGGGCTCTGGG + Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
913550328 1:119911034-119911056 GATTATGCAGGGAGGACTCGGGG - Intergenic
917858533 1:179122547-179122569 GATTATCCAGAGAGAGATCTTGG - Intronic
917928781 1:179809759-179809781 GCTTATGGACAGAGAGGTCTAGG - Intronic
922452741 1:225750120-225750142 GATAGTGCACAGAAAGCTCTTGG + Intergenic
924270914 1:242331820-242331842 TATTATGCACAGGGCACTCTAGG - Intronic
1066714036 10:38267038-38267060 TATTATGCACAGGGCACTCTAGG + Intergenic
1069795495 10:71049340-71049362 GATTATGCAAAGACTGTTCTGGG + Intergenic
1071492862 10:86147905-86147927 GAGTAAGCCCAGTGGGCTCTGGG - Intronic
1071524548 10:86350597-86350619 GATGATGCCCAGACAGCTCTGGG + Intronic
1077224376 11:1433688-1433710 GATTATGGATGAAGGGCTCTAGG + Intronic
1078281685 11:9908664-9908686 GATTATGAACAGATGGCATTTGG - Intronic
1079983668 11:27178073-27178095 CATTCTGCACTGAGGGCTATTGG + Intergenic
1081561953 11:44225927-44225949 TATTATCCACAGAAGGCTCATGG + Intronic
1083608229 11:63991856-63991878 GATAAGCCAAAGAGGGCTCTGGG + Intronic
1088633050 11:111792621-111792643 GATTATGCACTGAGGGAGCTTGG - Intronic
1089162812 11:116452564-116452586 CCACATGCACAGAGGGCTCTGGG - Intergenic
1089305212 11:117522153-117522175 AATTAGGCACAGAATGCTCTAGG - Intronic
1089494007 11:118899438-118899460 GTTCATGCCCATAGGGCTCTGGG + Exonic
1089906583 11:122046386-122046408 GAATATGCACAGTGTACTCTGGG + Intergenic
1090093098 11:123716836-123716858 CAACATGCACAGAGGGCTGTGGG - Intergenic
1100510076 12:95261957-95261979 GATTGTGCACAGAGTGCACATGG - Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1106894657 13:34286473-34286495 GATTCTGGACAGAGAGCTGTGGG - Intergenic
1109154525 13:58889871-58889893 CAATATTCACAGAGTGCTCTGGG + Intergenic
1111847364 13:93528301-93528323 GAGTAAGCAAAGAGGGCTGTGGG + Intronic
1113554886 13:111225014-111225036 CATTATGTACAAAGGGGTCTTGG + Intronic
1114159194 14:20144147-20144169 GATAATGCATAGCAGGCTCTAGG - Exonic
1118728393 14:68648966-68648988 GATTGTGCACACTGGACTCTTGG - Intronic
1121285633 14:92733370-92733392 GAATATCCAGAAAGGGCTCTGGG + Intronic
1121325107 14:93015294-93015316 GAGTCTGCACTGAGGGCTGTGGG + Intronic
1122091430 14:99343453-99343475 GGTTCTGCACAGAGGCCTCACGG + Intergenic
1122276780 14:100594759-100594781 GGTGATGCATAAAGGGCTCTGGG - Intergenic
1128552222 15:68605688-68605710 GAGGAGTCACAGAGGGCTCTTGG + Intronic
1128801110 15:70497725-70497747 GATTGTCCACAGAGTGCACTTGG - Intergenic
1129116107 15:73366316-73366338 GAGTTTGCAAAGAGGGCTCTGGG + Intronic
1130321455 15:82846017-82846039 GACTGTGCACAGAGGGCAGTTGG - Intronic
1132058449 15:98670259-98670281 CATTTTGCCCAGAGGGATCTTGG + Intronic
1133545620 16:6803491-6803513 GATTATACACAGATTGCACTGGG - Intronic
1134173751 16:11989723-11989745 GATTATGCATTGTGAGCTCTCGG - Intronic
1134641393 16:15832043-15832065 GATTGTGAACAGAGGCCTCCTGG - Intronic
1134776862 16:16860772-16860794 GATAACGCACAGAGTGCTCTTGG + Intergenic
1135287707 16:21208371-21208393 GATTGATCACAGAGGGCTTTAGG + Intronic
1137674584 16:50298014-50298036 GATGAACCTCAGAGGGCTCTCGG + Intronic
1141112388 16:81281018-81281040 TATTATGTAAAGAGGCCTCTGGG - Intronic
1148634627 17:49138957-49138979 GATAATGCACACAAAGCTCTTGG + Intronic
1149351763 17:55795997-55796019 AATTCTGCACAGAGGCGTCTAGG + Intronic
1149406470 17:56356957-56356979 AATTATGCACAGGGGGCTTTGGG - Intronic
1149854524 17:60068838-60068860 GAATATTCACAGAGTACTCTGGG - Intronic
1151346644 17:73506633-73506655 GATTATGCACATCAGGCCCTGGG + Intronic
1156446488 18:37241004-37241026 GATTATGGAGAGAGAGCTCAGGG - Intergenic
1157814585 18:50721578-50721600 GATTGTGCAGAGAGGTCTATGGG + Intronic
1158022292 18:52857621-52857643 GATTATTCACAGAAGTCACTGGG - Intronic
1163604551 19:18266861-18266883 GACCCTGCACACAGGGCTCTGGG + Exonic
1163838009 19:19587880-19587902 GATTCTTCACAGAGCACTCTGGG - Intronic
1164417219 19:28057353-28057375 CATTATGCACTGAGGCCTGTGGG + Intergenic
1164947606 19:32309707-32309729 GATTTTGCAGAGAAGGCCCTCGG - Intergenic
1165703021 19:37952929-37952951 GTGTATGCACAGAGGATTCTTGG + Intronic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
926115500 2:10210484-10210506 AAGAATGCACAGAGGGCGCTGGG + Exonic
926973397 2:18489188-18489210 TATTATGAACACTGGGCTCTTGG - Intergenic
927320995 2:21745567-21745589 GATTCTTCCCAGTGGGCTCTTGG + Intergenic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
930257809 2:49111726-49111748 GAGTTTTCACAGAAGGCTCTGGG + Intronic
932188104 2:69715750-69715772 GCCTATGCACAGAGGGCAGTGGG + Intronic
932752773 2:74382042-74382064 TAGAAAGCACAGAGGGCTCTGGG - Intronic
934983911 2:98870194-98870216 GAGTGTTGACAGAGGGCTCTGGG + Intronic
935832830 2:107018570-107018592 GATAATGCACATAAGGCTCTTGG + Intergenic
937950227 2:127380280-127380302 AAGTGTGCACAGAGTGCTCTAGG + Intronic
938294073 2:130166439-130166461 CATGATGCCCAGATGGCTCTTGG - Intronic
938462573 2:131507447-131507469 CATGATGCCCAGATGGCTCTTGG + Intergenic
944210132 2:197198416-197198438 TAGTCTGCACAAAGGGCTCTGGG + Intronic
947131814 2:226934824-226934846 AATTATGCACAGAGGGATGTGGG - Intronic
947811441 2:233006699-233006721 GATGGTGCACAGAAAGCTCTTGG - Intronic
1169474572 20:5919254-5919276 GATTATGCCCTGAGGTCTTTTGG + Intronic
1171154264 20:22858056-22858078 GATTATGCCCAGGGTGCTATGGG - Intergenic
1173642951 20:44616265-44616287 CATTATGCTCAGTGGGCTCATGG - Intronic
1175812518 20:61866129-61866151 GATTTTGCCCAGAGGACCCTCGG + Intronic
1176186838 20:63784868-63784890 GATGATGCACAGAGGGGTTGGGG + Intronic
1179107272 21:38413350-38413372 AAGTATGCAGAGAGGGCTCTTGG - Intronic
1179991316 21:44949501-44949523 GCTGCTGCACAGAGGGTTCTGGG - Intronic
1184514109 22:44950694-44950716 TATTATGCAAAGAGGGCTTGGGG + Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949409537 3:3748899-3748921 AATTATGCACAGAGGGCTATGGG + Intronic
950190902 3:10975412-10975434 GAGACTGCACAAAGGGCTCTAGG + Intergenic
952688573 3:36176911-36176933 GTTTAAGCACAGAGGGCTGTAGG + Intergenic
953180438 3:40589756-40589778 CAGCATGCTCAGAGGGCTCTTGG - Intergenic
953205724 3:40827106-40827128 GTTTATGGTCAGAGAGCTCTGGG - Intergenic
954190394 3:48955942-48955964 GCTTTTGCTCAGAGGACTCTGGG + Intronic
955634192 3:61008079-61008101 GATTAGTAAGAGAGGGCTCTTGG - Intronic
955853574 3:63248062-63248084 GGTGATGCACAGAGGGGCCTTGG + Intronic
960313816 3:116151238-116151260 AATGATGCACAGAGTGCCCTGGG + Intronic
961380187 3:126492002-126492024 GATTATCCCCAGAGGGGCCTTGG + Intronic
961380384 3:126492785-126492807 GATTATCCCCAGAGGGGCCTTGG + Intronic
967193493 3:187005827-187005849 GAATATGGTCAGAGGGCTGTGGG + Intronic
968652015 4:1763886-1763908 GAGGCTGCCCAGAGGGCTCTGGG - Intergenic
978616182 4:110598960-110598982 GATTATGCCCTGAAGTCTCTTGG + Intergenic
984851200 4:184154088-184154110 GAGGGTGCAGAGAGGGCTCTGGG - Intronic
985336870 4:188905483-188905505 GGTTATGCACAGAGGGCGGATGG - Intergenic
986003575 5:3649259-3649281 GATGATCCACTGAGAGCTCTTGG + Intergenic
991396474 5:66209525-66209547 GATTTTGCCCTGAGGGCACTGGG - Intergenic
991413336 5:66366790-66366812 AAATATGAACAGAGGGCTATGGG + Intergenic
991618153 5:68518063-68518085 GATTCTGCACAGAGGCCTAGGGG + Intergenic
999691260 5:154147833-154147855 TATGATGCACAGAGGGTTCCAGG - Intronic
1003501229 6:6704554-6704576 ATTTATGCCCAGAGGCCTCTGGG - Intergenic
1006506792 6:34494315-34494337 ATTTAAGCACAGAGAGCTCTGGG - Intronic
1013362596 6:109408078-109408100 GATTCTGCAGAAAGGGCTCATGG + Intronic
1014787464 6:125634928-125634950 GATTATGGACAAGGGGGTCTGGG - Intergenic
1015110065 6:129582622-129582644 GATTATGTCCTGAGGGCACTTGG - Intronic
1020042424 7:5014164-5014186 GCCTATGCACAGAGGGCAGTGGG + Intronic
1033834108 7:145288113-145288135 GATTATGAAAAGGGGGCTCAAGG + Intergenic
1034936246 7:155202749-155202771 GATTCTGCACAGGCGGCTCAGGG + Intergenic
1035582789 8:750291-750313 GATTGTGCAGAGTGGGCTCAGGG + Intergenic
1042745729 8:72103600-72103622 GATTCTTCCCAGAGGGCTCCTGG + Intronic
1046877096 8:119267391-119267413 AATTATACACAGAGTGCTATAGG + Intergenic
1048294501 8:133204548-133204570 GAATATTCAAAGAGGGATCTAGG + Intronic
1048854810 8:138677323-138677345 GATTATGCAGAGAGAGTGCTTGG + Intronic
1053151077 9:35743491-35743513 GATGAGGCAGAGAGGGATCTTGG + Intronic
1058671008 9:107360319-107360341 GATTCTGCACAGACGGCCCCGGG - Intergenic
1185531408 X:821938-821960 CATTCTGCATAGAGGGCCCTTGG - Intergenic
1195746457 X:108123497-108123519 GATTATGTACATGGGGGTCTAGG - Intronic
1196776262 X:119340715-119340737 GAGTAAGCACAAAGTGCTCTGGG + Intergenic
1197568936 X:128125184-128125206 GATGATGCACAGAAAGCTTTTGG + Intergenic
1200021725 X:153217357-153217379 GATTATGTAAATAGTGCTCTTGG + Intergenic
1200119204 X:153782514-153782536 GAGCAGGCACAGAGGCCTCTCGG - Intronic