ID: 1106788782

View in Genome Browser
Species Human (GRCh38)
Location 13:33133226-33133248
Sequence CAAGCTGGGCACTGTGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 495}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106788776_1106788782 3 Left 1106788776 13:33133200-33133222 CCTTTATTTAGGTTAAGAACACA 0: 1
1: 0
2: 2
3: 17
4: 247
Right 1106788782 13:33133226-33133248 CAAGCTGGGCACTGTGGCCTGGG 0: 1
1: 0
2: 2
3: 50
4: 495
1106788774_1106788782 27 Left 1106788774 13:33133176-33133198 CCACATACTAGTTGGATAGGGAC 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1106788782 13:33133226-33133248 CAAGCTGGGCACTGTGGCCTGGG 0: 1
1: 0
2: 2
3: 50
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106788782 Original CRISPR CAAGCTGGGCACTGTGGCCT GGG Intronic
900283697 1:1889528-1889550 CAGGCTGGGCACGGTGGCTAAGG + Intronic
900309645 1:2027545-2027567 CAAGCATGGCAGTGAGGCCTTGG - Intronic
900760396 1:4466666-4466688 AAAGCTTGGCACTGTGTCCATGG - Intergenic
900910503 1:5594010-5594032 CAAGCTGGGCCTTGTGCACTGGG - Intergenic
901661451 1:10800357-10800379 CCAGGTTGGCACGGTGGCCTTGG + Intergenic
901938893 1:12646825-12646847 CATGATGGGCAGTGTGCCCTGGG - Intronic
902561460 1:17280161-17280183 CAAGATGTGCACAGTGGCCAAGG + Intronic
902787668 1:18743593-18743615 CAAGCTGGGATCTGTGGCTGTGG - Intronic
902923063 1:19678854-19678876 CATGCTGGGAAGGGTGGCCTGGG + Intronic
903026093 1:20430753-20430775 CAAGTGGGGCACTTTGTCCTGGG + Intergenic
903445365 1:23419153-23419175 CAAGGTGAGGACTGGGGCCTGGG + Intronic
903446767 1:23427319-23427341 AAAGCTGGGCATGGTGGCGTGGG + Intergenic
903743535 1:25572172-25572194 TAGGCTGGGCACTGAGGCCATGG - Intergenic
904399482 1:30246816-30246838 GAAGCTTGGCCATGTGGCCTGGG + Intergenic
904678790 1:32214799-32214821 TTACCTGGGCCCTGTGGCCTTGG - Exonic
905401896 1:37709746-37709768 CAAGCTGTGCTCTGTGGACTAGG + Intergenic
905907321 1:41627693-41627715 CAGGCTGGGAAATGTTGCCTTGG + Intronic
905922228 1:41727378-41727400 CCAGCTGGGAAATGTGGCCCAGG + Intronic
907202463 1:52739272-52739294 CCAGCTGGGCACTGTGGCTCTGG - Intronic
907359569 1:53903565-53903587 CAGGCTGGGCACGGTGGCTCAGG + Intronic
907409227 1:54273063-54273085 CCAGCTGGGCTCTGTAGCATGGG + Intronic
907857671 1:58319715-58319737 CAAACTGAGCACAGTGGCCAAGG + Intronic
908199303 1:61778024-61778046 CTAGCTAGGCATGGTGGCCTGGG - Intronic
910035183 1:82780119-82780141 CAAGCTGGGGACTCTTGTCTGGG - Intergenic
910231336 1:84990634-84990656 TAAGCTGGGCATGGTGGCTTAGG + Intronic
910845939 1:91604926-91604948 CAAGCTGGGCTCTGAGGCAGAGG + Intergenic
910999212 1:93144794-93144816 GAAGCTGGGCACAGTGGCTCAGG - Intergenic
911309770 1:96278017-96278039 CAAGCTGGAAACTGGGGACTTGG + Intergenic
911727549 1:101258009-101258031 CAAGCAGGGAACTGTGGCTGAGG - Intergenic
912021679 1:105114152-105114174 CTAACTGGGCACTGGTGCCTGGG - Intergenic
912094599 1:106122032-106122054 CGAGCTGAGCACCGTGGGCTGGG + Intergenic
912163905 1:107019657-107019679 TCAGCTGGGCACTGTGGCTGTGG - Intergenic
912406948 1:109447375-109447397 CAAACTAGGCACTTTAGCCTAGG - Intergenic
912626351 1:111207643-111207665 CAAGTTGGGCAGTGTGGCACAGG - Intronic
912705751 1:111910682-111910704 CAACCCAGGCAGTGTGGCCTGGG - Intronic
912826775 1:112911652-112911674 CATGCTGGGCACAGTGGCTCAGG - Intergenic
913329405 1:117654615-117654637 GAGGCTGGGCACTGAGGCCTAGG + Intergenic
914195186 1:145444670-145444692 CAAGCTTGCCACAGTGGCGTAGG + Intergenic
914476457 1:148027246-148027268 CAAGCTTGCCACAGTGGCGTAGG + Intergenic
915118151 1:153612976-153612998 CCAGCAGGGCTCTGGGGCCTGGG + Intronic
918512877 1:185330337-185330359 TAGGCTGGGCACAGTGGCTTAGG - Intergenic
920263218 1:204703683-204703705 CAAGCAGGGAACTGGAGCCTAGG + Intergenic
920627694 1:207619099-207619121 CAGGCTGGGCACGGTGGCTCAGG + Intronic
923522550 1:234746939-234746961 CAGGCTGTGCACTGTGACCTGGG - Intergenic
923794579 1:237141830-237141852 TTGGCTGGGCACTATGGCCTTGG + Intronic
923992579 1:239455330-239455352 AAGGCTGGGCACTGTGGCTCAGG - Intronic
924693541 1:246376305-246376327 CAAGCAGGGCACAGTAGCTTTGG + Intronic
1063152637 10:3350785-3350807 CAAGCTGGACACTCAGGCCATGG - Intergenic
1063579861 10:7296687-7296709 ATATCTGGGCACTGTGGCCCAGG - Intronic
1065116491 10:22488253-22488275 CTAGCTGGGCACAGTGGCTCAGG - Intergenic
1065977472 10:30855175-30855197 AAAGGAGGCCACTGTGGCCTGGG + Intronic
1066555446 10:36607914-36607936 CGGGCCGGGCACTGTGGCTTAGG - Intergenic
1067099041 10:43321549-43321571 CAAGCTGGAGACAGTGGCTTGGG + Intergenic
1067182250 10:43997148-43997170 CAGGCTGGGCACAGTGGCTCAGG + Intergenic
1067857296 10:49805753-49805775 CCAGCTGGGCACAGTGGCTCAGG - Intergenic
1068894550 10:62185334-62185356 CAGGCTGGGCACGGTGGCTCAGG + Intronic
1068922455 10:62499015-62499037 GAAGCTGGGCACTCTAGCCAAGG - Intronic
1069832294 10:71288804-71288826 CAGGCTGGGCACTGAGGCATGGG - Intronic
1069951416 10:72021048-72021070 CAGGCTGGGTACTTTGCCCTAGG - Intergenic
1070748039 10:78946878-78946900 CAAGCTGGGCATAGTGGCCCAGG + Intergenic
1070772553 10:79090818-79090840 CCAGCTGGGCAGTCTGGCCCTGG - Intronic
1071190080 10:83089611-83089633 CATTCTGGCCACAGTGGCCTTGG - Intergenic
1071750412 10:88469253-88469275 CAGGCTGAGCACTGTGGCCAGGG - Intronic
1072094805 10:92167623-92167645 CAAGGTGGGCACAGTGGCTCAGG + Intronic
1072248438 10:93563200-93563222 CAAGTTGGGTACAGTGGCATGGG - Intergenic
1072422473 10:95300679-95300701 TAGGCTGGGCACAGTGGCTTAGG + Intergenic
1072865009 10:99050015-99050037 TAAGCTGGGCACAGTGGCTGAGG + Intronic
1073397071 10:103226701-103226723 TATGCTGGGCACGGTGGCTTTGG + Intergenic
1074853592 10:117457494-117457516 CTAGCTGGCCTCTATGGCCTGGG - Intergenic
1075523982 10:123166886-123166908 TAAACTGGGCATTCTGGCCTTGG - Exonic
1076368852 10:129938889-129938911 CCAACTGGTCACTTTGGCCTTGG - Intronic
1077220543 11:1413624-1413646 GGAGCTGGGCCATGTGGCCTGGG + Intronic
1077389492 11:2293328-2293350 CAGGCTGGGCACGGTGGCTCAGG - Intergenic
1078214153 11:9297410-9297432 TAGGCTGGGCGCAGTGGCCTAGG + Intronic
1078609350 11:12806585-12806607 CAAGTTGGGCCCTCTGGCCGAGG + Intronic
1079299210 11:19262518-19262540 GGAGCTGGGCACTGGGGTCTTGG - Intergenic
1079333569 11:19552449-19552471 CCTGCTGGGCCCTGTGGCCACGG + Intronic
1079633852 11:22711555-22711577 CAAGCAGGGCTCTCAGGCCTGGG - Intronic
1079855447 11:25597361-25597383 CAACCTAGGGACTGTGTCCTTGG - Intergenic
1080971267 11:37279933-37279955 CAGGCTGGGCACGGTGGCTCAGG + Intergenic
1081353622 11:42086385-42086407 GATGCTAGGCACTGTGGCCACGG + Intergenic
1082714362 11:56593673-56593695 CAGGCTGGGCAAAGTGGCTTAGG - Intergenic
1082976671 11:59079462-59079484 ACAGGTGGGCACTGTGACCTGGG - Intergenic
1083462490 11:62823690-62823712 CTAGCTGGGCATGGTGGCATGGG - Intronic
1083668813 11:64289243-64289265 CAAACTTGGCACAGGGGCCTAGG - Exonic
1084598072 11:70128973-70128995 CCAGGTGGTCACTGTGGCCTGGG + Intronic
1084622778 11:70284788-70284810 AAAGCTGGGGTCTGTGGCCATGG + Intronic
1085267595 11:75246486-75246508 CCAGCCTGACACTGTGGCCTCGG + Intergenic
1085692545 11:78675492-78675514 GAAGCTGGGCACTCAGGCCCTGG + Intronic
1087219133 11:95527033-95527055 CAAGCTGGGCTTTGTTTCCTAGG - Intergenic
1087766344 11:102159274-102159296 CAGGCTGAGCACTGCGCCCTGGG - Intronic
1088893114 11:114059854-114059876 CGAGCCGGGCACTGTGGGGTGGG - Exonic
1089371804 11:117965864-117965886 TTAGCTGGGCATTGTGGCTTGGG - Intergenic
1089675781 11:120088159-120088181 GCAGCTGGGAACTGAGGCCTGGG + Intergenic
1091266023 11:134271725-134271747 CAAGCTCGGAACTGTGGGCAGGG - Intergenic
1091745220 12:2987701-2987723 CAGGCTGGGCACGGTGGCTCAGG - Intronic
1091756193 12:3053677-3053699 GAAGCTGGGCACAGTGGCTCAGG - Intergenic
1091954674 12:4628556-4628578 CAAGTTGGGCCCTGGGGCCCTGG + Exonic
1094011496 12:25814868-25814890 CAGGCTGGGCACAGTGGCTCAGG - Intergenic
1094439168 12:30456031-30456053 TAAGTTGGGCTCTGTTGCCTAGG + Intergenic
1094495212 12:30985006-30985028 GAAGCAGGGGACAGTGGCCTTGG + Intronic
1095757416 12:45784467-45784489 GAAGCTGGGGGCGGTGGCCTGGG + Intronic
1096231059 12:49897226-49897248 CCAGCCGGGGACTGTGGGCTGGG - Intronic
1096455452 12:51781176-51781198 CCAGGTGGGGACTGTGGCCTTGG + Intronic
1096585694 12:52618251-52618273 CATGTTTGGCAGTGTGGCCTTGG - Exonic
1096880118 12:54660514-54660536 CAAGGTTGGCACTGTAGCCCTGG + Intergenic
1098042729 12:66368570-66368592 CCAGCTGTGCACTGTGGCTTGGG + Intronic
1099226144 12:79971853-79971875 CAGGCTGGGCACAGTGGCTCAGG + Intergenic
1099285663 12:80711442-80711464 CAAGCTGGGCTCAGTGGTATGGG - Intergenic
1099895002 12:88634218-88634240 TTGGCTGGGCACCGTGGCCTTGG + Intergenic
1100120655 12:91365655-91365677 CAGGCTGGGTGCTGTGGCCCAGG - Intergenic
1100878801 12:98993448-98993470 CAGGCTGGGCACAGTGGCTCAGG - Intronic
1101597210 12:106178029-106178051 CCAGCTGTGCACTCTGGCCGGGG + Intergenic
1101840869 12:108326650-108326672 CAGCCTGGGCGATGTGGCCTTGG + Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1102535782 12:113579918-113579940 CAAGCTAGCAACTGTGGCCCAGG + Intergenic
1103530461 12:121597659-121597681 TAAGATGGGCACAGTGGGCTGGG + Intergenic
1104681093 12:130752520-130752542 CAGGCTGGGCACGGTGGCTCAGG - Intergenic
1104995072 12:132649223-132649245 CCAGCTGGGCCCTGAGGTCTGGG - Intronic
1105040761 12:132958899-132958921 GAAGCAGGGCAATGTGGGCTGGG - Intergenic
1106240225 13:27906182-27906204 CAAGCTGGTCTCTGTGGCAGAGG - Intergenic
1106395771 13:29379508-29379530 CTGGCTGTGCACTGTGGCCGTGG + Intronic
1106788782 13:33133226-33133248 CAAGCTGGGCACTGTGGCCTGGG + Intronic
1107531908 13:41290539-41290561 TTAGCTGGGCACTGGGGCATAGG - Intergenic
1108139842 13:47408842-47408864 CAAGAAGGGCTCTGTTGCCTTGG - Intergenic
1108217685 13:48201101-48201123 CTTGCTGGGCTCTGTGGCATGGG - Intergenic
1108223499 13:48263423-48263445 CATGCTGGAAACTGTGGTCTTGG + Exonic
1108620634 13:52180132-52180154 TCAGCTAGGCACTGTGGCCTTGG - Intergenic
1108666116 13:52632910-52632932 TCAGCTAGGCACTATGGCCTTGG + Intergenic
1109465231 13:62723138-62723160 ATATCTGGGCACTGTGGCCTAGG - Intergenic
1109588198 13:64438222-64438244 CATGCTTGCCACTGTGTCCTTGG + Intergenic
1110372151 13:74751975-74751997 TCAGCTGGGCACCATGGCCTTGG - Intergenic
1113642843 13:111970654-111970676 TAAGCTGGGCCATGTGGCCTCGG + Intergenic
1113753912 13:112795439-112795461 CAAGCTGGGAACTGTGACAGTGG - Intronic
1115155329 14:30332382-30332404 CATCCTGGGCACTGGGGACTGGG - Intergenic
1115327074 14:32151977-32151999 CAAGCCAGGCTGTGTGGCCTAGG - Intronic
1115970520 14:38940160-38940182 CAACTTGGGCTGTGTGGCCTGGG - Intergenic
1116479086 14:45376011-45376033 CCAGCTGGGCACAGTGGCTCAGG - Intergenic
1118107348 14:62675032-62675054 AAGGCTGGGAACAGTGGCCTGGG - Intergenic
1118296127 14:64571406-64571428 CAGGCTGGGCACGGTGGCTCAGG - Intronic
1118419841 14:65589723-65589745 CAAGCTGGGCATGGTGGCTCAGG - Intronic
1118501720 14:66368405-66368427 GAAGCTGGGCATTGTTGCCCAGG + Intergenic
1118822663 14:69355295-69355317 CAAGCTGGACATTGTAGCCAAGG - Exonic
1119082905 14:71713071-71713093 CTAGCTGGGCACGGTGACATGGG + Intronic
1121867738 14:97378503-97378525 CAAGCTGAGCACAGGTGCCTGGG + Intergenic
1122310523 14:100791516-100791538 GAAGCAGGGCACTGTGGACATGG + Intergenic
1122671460 14:103375994-103376016 CCAGCTGGGCACAGTGGCTCAGG + Intergenic
1122864763 14:104598655-104598677 TGAGTTGGGCGCTGTGGCCTGGG - Intronic
1122892917 14:104741352-104741374 CATGGATGGCACTGTGGCCTTGG - Intronic
1122988105 14:105221886-105221908 CAAGCTGGACGCGGTGTCCTCGG + Exonic
1123063797 14:105606265-105606287 CAAGCAGGGCATGGGGGCCTTGG - Intergenic
1123155173 14:106218009-106218031 CATGCTGGGCACTGGGGCAGAGG - Intergenic
1123401850 15:19995155-19995177 CATGCTGGGCACTGGGGCAGAGG - Intergenic
1123511190 15:21001818-21001840 CATGCTGGGCACTGGGGCAGAGG - Intergenic
1124217412 15:27818958-27818980 CATGCTGCCTACTGTGGCCTGGG + Intronic
1125153395 15:36559836-36559858 GGAGCTGGACACTGTGGCCCAGG + Intergenic
1125575141 15:40750188-40750210 CGAGCTGGGCATGGTGGCATGGG - Intronic
1125617202 15:41025431-41025453 CAGGCTGGGCACAGTGGCTCAGG + Intronic
1126618711 15:50614886-50614908 CAGGCTGGGCGCTGTGGCTCAGG + Intronic
1126869998 15:52977473-52977495 CAAGCTGAGGACTGTGGCCTAGG + Intergenic
1127827951 15:62722378-62722400 CACGGTGGGCACTGCGGCTTTGG - Exonic
1128450647 15:67804248-67804270 TAGGCTGTGCACTGTGGACTTGG - Intronic
1128635497 15:69299625-69299647 CCAGCTGGGGGCTGTGGCCGGGG - Intronic
1129412843 15:75359403-75359425 CATGCTGGGCACTGTCACCAGGG + Exonic
1129790872 15:78340047-78340069 GAAGCTGGGCGGTGTGGACTTGG - Intergenic
1130192380 15:81749587-81749609 CAGGCTGGGCACGGTGGCTCAGG - Intergenic
1130347321 15:83059871-83059893 CAAGCTGGGTACAGTGGCTCAGG - Intronic
1130950619 15:88584100-88584122 TCAGCTGGGCACCATGGCCTTGG + Intergenic
1131153336 15:90060269-90060291 CAAGCCTGGCACAGTGGCTTAGG + Intronic
1131723214 15:95194552-95194574 CAAGATGGCCCCTGTGGGCTTGG - Intergenic
1132393887 15:101458394-101458416 CGAGCTGGGCAATGTGGCCCGGG + Intronic
1132675278 16:1118813-1118835 CAGGCTGGGCAGAGGGGCCTGGG - Intergenic
1132958063 16:2606883-2606905 CAAGCTGGGCTCTGAGGACTTGG - Intergenic
1132970537 16:2686131-2686153 CAAGCTGGGCTCTGAGGACTTGG - Intronic
1133821967 16:9244987-9245009 CAAGCTCCTCATTGTGGCCTTGG - Intergenic
1134823766 16:17267790-17267812 AAAGTTAGGCACTGTGCCCTGGG - Intronic
1135572058 16:23557241-23557263 CAACCTGGGCACTGATGCCGGGG - Exonic
1135705800 16:24673705-24673727 TTAGCTGGGCACAGTGGCGTAGG - Intergenic
1136033572 16:27520998-27521020 GAGGCTGGGCGCTGTGGCTTAGG - Intronic
1136317243 16:29461561-29461583 CAAGGTGGGGACTGCCGCCTGGG - Intronic
1136366940 16:29813299-29813321 TAAGCTGAGGTCTGTGGCCTGGG - Exonic
1136431818 16:30200904-30200926 CAAGGTGGGGACTGCCGCCTGGG - Intronic
1136671359 16:31861498-31861520 CTTCCTGGGCACTGGGGCCTTGG + Intergenic
1137728858 16:50675249-50675271 CTAGCTGGTTACTGTGGCTTCGG - Intronic
1138514774 16:57529940-57529962 CAAGCCAGGCACTGTGCCCAGGG + Intronic
1138681666 16:58688064-58688086 TAGGCTGGGCACCATGGCCTTGG - Intergenic
1138698690 16:58840227-58840249 GAGGCTGGGCACAGTGGCTTAGG + Intergenic
1139162308 16:64525720-64525742 CAAGCTAGGCACTGGGTCATAGG - Intergenic
1139988136 16:70917201-70917223 CCGGCTGGGCACTGTGGCTCAGG - Intronic
1140231243 16:73119009-73119031 CAGGGTGGGCACTGTGTCCTGGG + Intergenic
1140459254 16:75125602-75125624 CCAGCTGGGCACGGTGGCTCAGG - Intergenic
1141188482 16:81806521-81806543 CAAGCTGAGCAGTGCTGCCTGGG - Intronic
1141624425 16:85253776-85253798 CAGGCTGGGTGCTGTGGGCTTGG + Intergenic
1141624439 16:85253849-85253871 CAGGCTGGGTGCTGTGGGCTCGG + Intergenic
1141899908 16:86984419-86984441 CAAGCTGTGCCCTGGGCCCTGGG + Intergenic
1142190170 16:88713775-88713797 CAAGGTGGGCCTTGTGGGCTGGG + Exonic
1142246295 16:88971662-88971684 CCAGCTGGGAGCTGTGGACTGGG - Intronic
1142843177 17:2650101-2650123 CAGGCCAGGCACTGTGGCTTAGG + Intronic
1143493102 17:7294944-7294966 CAACCTTGGCACTGCGGCCCCGG - Intergenic
1143884385 17:10055114-10055136 CCAGCCAGGCACAGTGGCCTGGG + Intronic
1144243822 17:13341950-13341972 CAAGCCGGGCACAGTGGCTCAGG - Intergenic
1144951906 17:18998895-18998917 CAGGGTGAGCTCTGTGGCCTGGG - Intronic
1145868602 17:28256263-28256285 CAGGAAGGGCAGTGTGGCCTGGG + Intergenic
1146177633 17:30676473-30676495 CTAGCTGGGCATGGTGGCATGGG + Intergenic
1146594703 17:34158235-34158257 CCAGCTTGGCAGTGTGGCTTGGG - Intronic
1146927008 17:36752171-36752193 CTAGCTGGGCACTGGGGACAAGG - Intergenic
1146963023 17:37001035-37001057 CAGGCTGTGCACAGTGGCTTAGG + Intronic
1147673142 17:42188504-42188526 GAAGCTGGGCACAGTGGCATGGG - Intergenic
1148029331 17:44608769-44608791 CAAGCTGGGCCCTGGCACCTAGG - Intergenic
1148094562 17:45043463-45043485 TCAGCTGGGCACCATGGCCTTGG - Intronic
1148244411 17:46021145-46021167 GATGCTGCGAACTGTGGCCTGGG + Intronic
1148340913 17:46872874-46872896 CAGGAAGGGCAGTGTGGCCTGGG - Intronic
1149098693 17:52876547-52876569 AAGGCTGGGCGCTGTGGCTTAGG + Intronic
1149427637 17:56570307-56570329 CAGGCTGGGTCCTGTGGCTTTGG - Intergenic
1149841284 17:59966812-59966834 TTAGCTGGGCACTGTGGCAAGGG + Intronic
1150383372 17:64738380-64738402 TTAGCTGGGCACTGTGACTTGGG + Intergenic
1150513223 17:65778090-65778112 CAGGGTGGGGACTGTGGACTTGG - Intronic
1151423260 17:74012779-74012801 CCAGCTGGACACTCAGGCCTGGG - Intergenic
1152052964 17:77996772-77996794 GAATCTGAGCACTGTGGCCCAGG + Intergenic
1152194609 17:78909822-78909844 CAGGCCGGGCACTGTGACCCAGG + Intronic
1152318120 17:79592759-79592781 CAGACTGGGCACTGCGGCATGGG + Intergenic
1152387302 17:79982423-79982445 GAAGCTGGGCACAGTGGCTCAGG - Intronic
1152691397 17:81719734-81719756 CCAGCCAGGCACGGTGGCCTGGG - Intronic
1152728521 17:81959183-81959205 CTAGCCGGGCACCGTGGCCATGG - Intronic
1152794734 17:82301429-82301451 CATCCAGGGCACTGTGGCCTGGG - Intergenic
1155636503 18:27961816-27961838 CCAGCTGGGCACAGTGGCTCAGG + Intronic
1155706600 18:28823613-28823635 CAAGCTGGTCTTTGGGGCCTAGG + Intergenic
1156406583 18:36788454-36788476 AAAGCTGGGCGCTGGGGCCTTGG + Intronic
1156872737 18:41966314-41966336 TTAGCTGGGCACGGTGGCATGGG - Intronic
1156906822 18:42362692-42362714 CAGGCCGGGCACAGTGGCTTAGG - Intergenic
1157081063 18:44525714-44525736 CATGCTGGGCCCTTAGGCCTGGG - Intergenic
1157201544 18:45664047-45664069 CATTCGGGGAACTGTGGCCTTGG - Intronic
1157267988 18:46245420-46245442 TTAGCTGGGCACGGTGGCGTGGG + Intronic
1158295349 18:55991043-55991065 CAGGCTGGGCACGGTGGCTCAGG - Intergenic
1159530784 18:69652707-69652729 TCAGCTGAGCACCGTGGCCTTGG + Intronic
1160213319 18:76902870-76902892 CAGGCTGGGCACAGTGGCTCAGG - Intronic
1161049278 19:2153922-2153944 CAGGCTGGGCACAGTGGCAGAGG - Intronic
1161373636 19:3927745-3927767 CCAGCTGGGAACGGTGGCCCCGG - Exonic
1161443016 19:4303235-4303257 CAGGCTGGGCATGGTGGCCCAGG + Intergenic
1161508630 19:4658025-4658047 CAAGCTGGTGATTGTGGCCAAGG - Exonic
1161976020 19:7608043-7608065 CAGGCTGGGCAGGGAGGCCTGGG - Intronic
1162376945 19:10310436-10310458 CAATCTGGGCCCTGGGGCCATGG + Exonic
1162723081 19:12673979-12674001 CAAGCTGGGCACGGTGTCTCAGG - Intronic
1163287623 19:16358311-16358333 CACGCTGGGCTGTGAGGCCTGGG + Intronic
1163290345 19:16375794-16375816 CAACCTGGGCACTGCGGGCTGGG + Intronic
1163654334 19:18537055-18537077 CAAGCCGGGCACGGTGGCTCAGG + Intronic
1163688775 19:18726963-18726985 CAGGCCAGGCACGGTGGCCTAGG + Intronic
1163695758 19:18762521-18762543 CAAGCGGGGTACTGTCTCCTCGG - Intronic
1163722218 19:18903685-18903707 CCACCTGTGCACTGAGGCCTTGG - Intronic
1163722916 19:18906737-18906759 CAGCCTGGGCACCGTGTCCTTGG + Intronic
1163818973 19:19485348-19485370 CCAGCTGGGCACTGTTGCTGGGG + Intronic
1163849049 19:19653306-19653328 CAGGCTGTGAGCTGTGGCCTGGG + Intronic
1164567096 19:29333844-29333866 TAAGCTGGGCATGGTGGTCTTGG - Intergenic
1165324110 19:35104283-35104305 CAAACTCGCCACCGTGGCCTGGG - Intergenic
1165327083 19:35120419-35120441 CGGGCTGGGCACAGTGGCTTAGG - Intronic
1165591433 19:36973031-36973053 GCAGCTGGGCAGTCTGGCCTCGG + Intronic
1165704515 19:37966266-37966288 CCAGCTTGCCACAGTGGCCTCGG + Intronic
1165763781 19:38337443-38337465 CAAGCTGCTCACTGTGTCCACGG - Exonic
1166661849 19:44652528-44652550 TTAGCTGGGCACTGTGGCCAGGG - Intronic
1166693214 19:44836875-44836897 CAGGCTGGGCGCTGTGGCTCAGG + Intergenic
1167179480 19:47891642-47891664 CAGGCTGGGCACGGTGGCTCAGG - Intergenic
1167483417 19:49746538-49746560 CAGGCTGGGGAATGGGGCCTCGG - Exonic
1168094996 19:54109416-54109438 CAGGCTCGGCACAGTGGCCCAGG - Intronic
1168156716 19:54477486-54477508 CCAGCTGGGCACAGTGGCTCAGG - Intergenic
1168642389 19:58038877-58038899 CAGTCGTGGCACTGTGGCCTCGG + Intronic
926031747 2:9596924-9596946 TAAGCTGGGCACCGTGGCTCAGG - Intronic
926171682 2:10556672-10556694 CAAGCCGGGAGCTGGGGCCTGGG + Intergenic
926792539 2:16589105-16589127 GATGCTGGGCACTGTGTTCTTGG + Intronic
927477765 2:23426771-23426793 CCAGCTGTGCACTGAGACCTTGG - Intronic
927529476 2:23781381-23781403 CAGGCTGGGCACAGTGGCTCAGG + Intronic
929449792 2:42029029-42029051 CAAGCTCAGCACTGTGGCTGTGG - Intergenic
930027252 2:47036594-47036616 TAGGCTGGGCACAGTGGCTTTGG + Intronic
930706839 2:54512915-54512937 TAGGCTGGGCACGGTGGCTTAGG + Intronic
930788556 2:55298724-55298746 CTAGCTGGGCATGGTGGCATGGG + Intronic
931691490 2:64838078-64838100 CAAGCTGGGCAGAGTGCCCTGGG + Intergenic
931812902 2:65872396-65872418 GAAGGAGGGCAGTGTGGCCTAGG + Intergenic
931962486 2:67497639-67497661 CAAGTTGGGAGATGTGGCCTTGG + Intergenic
933767645 2:85721203-85721225 CAAGCTGGGAAGTGTAGCCTTGG + Intergenic
933936615 2:87209146-87209168 TGAGCTGGGCATTGTGGCATGGG - Intergenic
934068247 2:88359917-88359939 AAATCTGGGCCCTGGGGCCTAGG + Intergenic
934151928 2:89155371-89155393 CCAGCTTGGCACGGTGGTCTTGG - Intergenic
934767027 2:96885422-96885444 CTAGCTGGGGCCTGGGGCCTGGG + Intronic
936351903 2:111719375-111719397 CAGGCTGGGCAAGGTGGCCTGGG - Intergenic
936509234 2:113132077-113132099 AAATCTGGCCACTCTGGCCTTGG - Intronic
938292961 2:130160050-130160072 CAAGCAGGTGACTGTGGCCAGGG - Intronic
938313456 2:130310142-130310164 TATGCTGGGCACTGTTGCCCAGG - Intergenic
938572281 2:132571618-132571640 CAAGCTGGGAACTGGGGAGTGGG + Intronic
940321019 2:152376566-152376588 ACAGCTGTGCAGTGTGGCCTTGG + Intronic
940394021 2:153166743-153166765 TGGGCTGGGCACTGTGGCCTTGG + Intergenic
940900263 2:159120295-159120317 CAGGGTGGGCACTGTGGGATAGG + Intronic
942219638 2:173756619-173756641 CAAGCTGGTCACAGTGACATAGG + Intergenic
943337382 2:186633879-186633901 GAAGCTGGGCATGGTGGCGTGGG + Intronic
944674868 2:202027006-202027028 CAAGCTGGGCACAGTGTCTCAGG + Intergenic
946831284 2:223730716-223730738 CAGGCCGGGCACAGTGGCTTAGG + Intergenic
947574832 2:231264776-231264798 CAGGCTGGGCACAGTGGCTCAGG - Intronic
947675878 2:231979515-231979537 CAGGCCTGGCACAGTGGCCTTGG - Intronic
948080199 2:235199325-235199347 CACTGTGGGCACTGGGGCCTGGG - Intergenic
948162241 2:235834465-235834487 CAGACCGGGCTCTGTGGCCTGGG - Intronic
1169276685 20:4237912-4237934 CAGGCTGGGCACGGTGGCTTGGG - Intronic
1169396258 20:5232782-5232804 CAAGCTGGGCACAGTAGCTCAGG + Intergenic
1169468460 20:5862347-5862369 TCAGCTGGGCACCATGGCCTTGG - Intronic
1172762333 20:37331595-37331617 AGACCTGGGCTCTGTGGCCTTGG + Intergenic
1173700119 20:45062699-45062721 AAAGCTGGGCACTCCAGCCTGGG - Intronic
1173791178 20:45828691-45828713 CAGGCTGGGCACTGGGGAGTAGG + Intronic
1174204753 20:48830080-48830102 CAGGCTGGGCACAGTGGCTCCGG + Intergenic
1174325365 20:49774495-49774517 GAGGCTGGGCACGGTGGCTTAGG + Intergenic
1174334104 20:49845587-49845609 CAAGCTGGGGTCTGAGGCCAGGG - Intronic
1174604397 20:51750436-51750458 CCAGCCAGGCTCTGTGGCCTAGG - Intronic
1174644617 20:52074848-52074870 CAGGCTGGGCACGGTGGCTCAGG - Intronic
1176266927 20:64214522-64214544 CAGGATGGGCAGGGTGGCCTTGG - Intronic
1177035032 21:16032523-16032545 CAGGCTGGGCACGGTGGCTGAGG + Intergenic
1177794695 21:25761537-25761559 CATTCTGGGTACTGAGGCCTGGG - Intronic
1179103919 21:38381458-38381480 TTACCTGGGCACTGTGGCTTGGG - Exonic
1179248781 21:39655945-39655967 TAAGGTGGGCACAGTGGTCTGGG + Intronic
1180986308 22:19905795-19905817 CGAGATGGGCACTGGGGCCCGGG + Intronic
1182128431 22:27833371-27833393 ACAGCTGGGCACAGTGGCTTAGG - Intergenic
1182811730 22:33122638-33122660 CAGGCTGGGCACGGTGGCTCAGG - Intergenic
1183314608 22:37129901-37129923 CATGCTGGGCACAGAGGCCTGGG - Intronic
1184080334 22:42214866-42214888 CAAGCACAGCACTCTGGCCTTGG - Exonic
1184641358 22:45872591-45872613 TTAGCTGGGCATGGTGGCCTGGG + Intergenic
1184875760 22:47274440-47274462 ACAGCTGGGCAGTGTCGCCTGGG + Intergenic
949306154 3:2643451-2643473 CCGGCTGGGCACTGTGGCTCAGG - Intronic
950124149 3:10501308-10501330 CCTGCTGGGCAGTGTGGCTTCGG - Intronic
950494960 3:13328268-13328290 CACGTTGGGCAATATGGCCTAGG - Intronic
950578273 3:13846137-13846159 TACTCTGGTCACTGTGGCCTTGG - Intronic
950924209 3:16723934-16723956 GAAGCCGGGCACAGTAGCCTGGG - Intergenic
951741291 3:25927242-25927264 CTAGCTGGGCACGGTGGCAGGGG - Intergenic
951742720 3:25941992-25942014 GAAGCTGGGCAGAGTGGCATGGG - Intergenic
953454148 3:43028935-43028957 CAAGCAGGGCTTTGTGGCCCTGG + Intronic
953501077 3:43435211-43435233 GAAGCTGGGCAAAGTGGGCTGGG + Intronic
953914544 3:46909953-46909975 CATGCTGGGCACTGTATCCGGGG - Intergenic
953983606 3:47425544-47425566 CGAGCTGAGCACTGTGACCACGG + Exonic
954038643 3:47867699-47867721 AGAGCTGGGCACAGTGTCCTTGG + Intronic
954243255 3:49310660-49310682 CAACCTGGGCTCTGTGGACTTGG - Exonic
954711776 3:52508446-52508468 CAAGCCTGCCACTCTGGCCTTGG + Intronic
954729404 3:52645442-52645464 CCAGCTGGGCACTCTGGTTTAGG - Intronic
960769743 3:121180590-121180612 CCAGCTGGGCACAGTGGCTCAGG + Intronic
961112303 3:124295318-124295340 CAAGCTTGTCACTGGGGTCTGGG - Intronic
961263701 3:125623118-125623140 AGAGTTGGGCACTGTGGCATAGG - Intergenic
961447003 3:126985569-126985591 AGAGCTGGCCACTGTGGCCGGGG - Intergenic
961722444 3:128905949-128905971 CAAGCTGGCCAGTGTGGTCACGG + Intronic
962740357 3:138358898-138358920 CAGGCTGGGCCCTGTGGCCAGGG - Intronic
962988824 3:140560254-140560276 GAAGCCGGTCACTGAGGCCTGGG - Intronic
963564364 3:146909404-146909426 CAAGCTGGGCATGGTGGCTCAGG + Intergenic
963916023 3:150859440-150859462 CAAGCTTAACACTGTGGCTTGGG - Intergenic
963948632 3:151173614-151173636 CAAGTTGAGCACGCTGGCCTTGG + Intronic
964400489 3:156292600-156292622 CGATCTGGGCTCTGTCGCCTGGG + Intronic
964953685 3:162326465-162326487 CAAGCTTAACACTGGGGCCTGGG - Intergenic
966703496 3:182883556-182883578 CAGGCTGGGCACGGTGGCTCAGG - Intronic
966904316 3:184510729-184510751 GAAGCTGGGCCCAGTGGCATGGG + Intronic
966907954 3:184541419-184541441 CATGATGGGCACAGTGGCCACGG - Intronic
967217111 3:187220166-187220188 CCTGGTGGGCACTGTGTCCTGGG - Intronic
967621875 3:191643068-191643090 TGAACTGGGCACTGTAGCCTAGG - Intergenic
968182156 3:196603846-196603868 TCTGCTGGGCACTGTGGCCTTGG - Intergenic
968389784 4:181139-181161 AAAGCTGGGCACTGGGGCACAGG - Intergenic
968813050 4:2808781-2808803 GAAGGTGGGCACTGAGCCCTAGG - Intronic
968813067 4:2808830-2808852 GAAGGTGGGCACTGAGCCCTAGG - Intronic
968813084 4:2808879-2808901 GAAGGTGGGCACTGAGCCCTAGG - Intronic
968813101 4:2808928-2808950 GAAGGTGGGCACTGAGCCCTAGG - Intronic
968813186 4:2809173-2809195 GAAGGTGGGCACTGAGCCCTAGG - Intronic
968813218 4:2809271-2809293 GAAGGTGGGCACTGAGCCCTAGG - Intronic
968881572 4:3302898-3302920 CCTGCTGTGCACTGTGGCATTGG + Intronic
969320428 4:6409305-6409327 CAAGCAGGTCACCTTGGCCTAGG + Intronic
969487187 4:7478838-7478860 ACAGCTGGGCACCGAGGCCTGGG + Intronic
969631579 4:8341767-8341789 CAGGCTGGGCACCGTGGCTCAGG - Intergenic
969786250 4:9459502-9459524 CATCTTGGGGACTGTGGCCTAGG - Intergenic
970253546 4:14142608-14142630 CAAGCTGGAGCCTGTGGCATGGG - Intergenic
971440098 4:26676434-26676456 CAGGCTGGGCACAGTGGCTCAGG + Intronic
971571576 4:28218666-28218688 CAGGCTGGGCGCTGTGGCTCAGG + Intergenic
972673230 4:41234269-41234291 CAGGCTGGGCAGTGTAGCCTTGG + Intergenic
972972323 4:44593144-44593166 CACGCTGGGAGCTGTAGCCTGGG - Intergenic
973795373 4:54420063-54420085 CAGGCTGGGCAATTTGGACTGGG - Intergenic
973943090 4:55930162-55930184 CAGGCTGGGCACAGTGGCTTAGG - Intergenic
973981090 4:56308883-56308905 AGTGCTGGGCACTGTGGCCTGGG + Intronic
974549188 4:63349470-63349492 CAAGTTGGGCTCCCTGGCCTCGG + Intergenic
975133996 4:70856584-70856606 CCGGCTGGGCACAGTGGCTTAGG - Intergenic
975489838 4:74976276-74976298 GAAGCTGGGCAGTTTGGACTGGG + Intronic
976320117 4:83704609-83704631 TCAGCTGGGCACCATGGCCTTGG + Intergenic
976405185 4:84654964-84654986 CAAGCTGGGAACTGTGTGGTTGG - Intergenic
976454355 4:85228837-85228859 CAAGCTGCACAGTGTAGCCTGGG + Intergenic
976747485 4:88418609-88418631 TCAGCTGGGCACCGTGGCCTTGG + Intronic
979412874 4:120400647-120400669 CAAGCTGGGAACTGTGGTATAGG + Intergenic
981314736 4:143331117-143331139 CAAGCTGGGCATGGTGGCTTAGG + Intergenic
981464631 4:145054186-145054208 CAGGCTGGGCACGGTGGCTCAGG - Intronic
981715583 4:147748687-147748709 TAGGCTGGGCACTGTGGCTCAGG + Intronic
981968194 4:150632373-150632395 CAAGATGAGCATTGTGTCCTTGG - Intronic
982358822 4:154496615-154496637 CAATGTGGGCACCGTAGCCTGGG - Intergenic
984067034 4:175061899-175061921 CAGGCTGGGCACAGTGGCTCAGG + Intergenic
985082254 4:186278078-186278100 CAAGCTGGGCATAGTGGCTCAGG - Intronic
985094532 4:186400554-186400576 GAAGCTGGGCTCTGGGACCTGGG + Intergenic
985578367 5:684139-684161 CAAGGTGGAAACTGTGGCCGTGG - Intronic
985593298 5:776279-776301 CAAGGTGGGACCTGTGGCCGTGG - Intergenic
985970538 5:3374810-3374832 CAAGATGGCCACTGTAGCATGGG - Intergenic
986195700 5:5534975-5534997 CAGGTTGGGCTCTGTGGCCAAGG - Intergenic
986500948 5:8399618-8399640 TCAGCTGGGCACCATGGCCTTGG + Intergenic
988033838 5:25799379-25799401 TTGGCTGGGCACTGTGGCCTTGG - Intergenic
988210257 5:28194631-28194653 CAGGCCGGGCACTGTGGCTCAGG - Intergenic
990384204 5:55243535-55243557 TTAGCTGGGCACTGTGGCTCAGG + Intergenic
991370607 5:65915787-65915809 CAGGCTGGGCACGGTGGCTCAGG - Intergenic
991674717 5:69079579-69079601 CAGGCTGGGCACAGTGGCTCAGG + Intergenic
992694108 5:79267694-79267716 CTGGGTGGGCACTGTGGCCCAGG - Intronic
992945840 5:81809553-81809575 TTAGCTGGGCACAGTGGCATGGG + Intergenic
993469089 5:88285221-88285243 TCAGCTGGGCACTGTGGCTCGGG + Intergenic
993743909 5:91572644-91572666 ACAGCTGGGCCCAGTGGCCTTGG + Intergenic
994577752 5:101601569-101601591 CAGGCAGGGCACGGTGGCTTAGG - Intergenic
994749664 5:103722018-103722040 TTAGCTGGGCATTGTGGCATGGG + Intergenic
997315967 5:132935984-132936006 CCAGCTGGGCACAGTGGCTCAGG + Intronic
997459460 5:134042231-134042253 CATCCTGGGCACTGTGGGCTTGG + Intergenic
997558462 5:134822158-134822180 CTGGCTGGGCACGGTGGCCCAGG - Intronic
997662481 5:135600111-135600133 CATGCTGGGAACTGTGTCTTTGG + Intergenic
997676747 5:135718873-135718895 CAAGGGGGGCCCTGTGGCTTTGG + Intergenic
998172821 5:139882472-139882494 CAAGCTGGTCTCTGTCTCCTTGG + Intronic
998388541 5:141772468-141772490 CAAGCTGGGCCTTCTGCCCTCGG - Intergenic
998415399 5:141942465-141942487 CAAGATGGGCTCTGTCCCCTGGG - Intergenic
998846545 5:146315903-146315925 CAGGCTGGGCACGGTGGCTCAGG - Intronic
1000222160 5:159224523-159224545 CAGGCTGGGCCCTGTGGGCAAGG - Intergenic
1001214645 5:169844456-169844478 TAAGCTGGGCACCTTGGCCTTGG + Intronic
1001429313 5:171646906-171646928 TGAGCTGGGCACTGTGCCCGGGG + Intergenic
1001590241 5:172859762-172859784 CCAGCTGTACACAGTGGCCTTGG + Intronic
1001653553 5:173331323-173331345 CTAGATGGGAACTGAGGCCTGGG + Intergenic
1002191477 5:177480105-177480127 AATGCTGGTCACTGAGGCCTAGG - Intergenic
1002513286 5:179737308-179737330 CTAGCTGAGCTCTTTGGCCTTGG + Intronic
1002561184 5:180083363-180083385 CAGGCTGGGCTCTGGGGTCTTGG + Intergenic
1003109358 6:3240684-3240706 CAGGCTGGGCATTGTGTCCAAGG - Intronic
1003208605 6:4038430-4038452 AAAGCTGGGCATGGTGGCATGGG - Intronic
1003474176 6:6466208-6466230 CAAGCTTTGCACAGTGGGCTGGG - Intergenic
1003618444 6:7675727-7675749 CAGGCTGGGGAATGTGGGCTGGG + Intergenic
1003904899 6:10690197-10690219 AAAGATGGGCACTTAGGCCTTGG + Intronic
1004501542 6:16214469-16214491 CAGGCTGGGCACGGTGGCTCAGG - Intergenic
1004849001 6:19676977-19676999 TGAGCTGGGCACCATGGCCTTGG + Intergenic
1005678792 6:28184095-28184117 CCAGCTGGGCACGGTGGCTCAGG + Intergenic
1006294205 6:33162735-33162757 GAAGCTGGGCACAGGGTCCTGGG + Exonic
1006707248 6:36031293-36031315 CAGGCTGGGCACCGTGGCTGAGG - Intronic
1006903256 6:37516480-37516502 CAAGCAGGGCACATGGGCCTGGG - Intergenic
1007790571 6:44306071-44306093 CTAGCTGGGCACTGTGGACATGG + Intronic
1010253733 6:73734601-73734623 CAAGCAGGTCACTGTATCCTTGG - Intronic
1010893720 6:81342295-81342317 CAAGCTTAACACTGTGGCTTGGG - Intergenic
1011360492 6:86519122-86519144 CAGGCTGGGCACGGTGGCTCAGG + Intergenic
1012756251 6:103235140-103235162 CTAGCTAGGCATAGTGGCCTAGG - Intergenic
1013103226 6:107004967-107004989 CAAGCTGGGCTCAGTGGCTCAGG + Intergenic
1013234232 6:108182980-108183002 TAGGCTGGGCACAGTGGCCCAGG - Intronic
1013467467 6:110430227-110430249 CAAGCATGACACTGTGGCATCGG - Intronic
1014169463 6:118262803-118262825 CAAGCTGGGCGCTGTGGCTCAGG + Intronic
1015025299 6:128525177-128525199 CTGGATGGGCACTGGGGCCTTGG + Intergenic
1016315318 6:142779199-142779221 CAAGCTGGGCACAGTGGCTTAGG - Intronic
1016318423 6:142815596-142815618 CAAGCTGGGCATGGTGGCTCAGG + Intronic
1016404197 6:143713379-143713401 CAAGCTGGGCAATGGGTCCATGG + Intronic
1016713856 6:147202929-147202951 CGAGATGGGCAGTGCGGCCTCGG + Intergenic
1016906149 6:149152582-149152604 TAAGCAGGGCATTGTGGCCAGGG + Intergenic
1016915893 6:149244263-149244285 CATGCTGGGCACTGTGCCAAAGG + Intronic
1018761305 6:166896376-166896398 CAAGCTGAACACTGGGGCTTGGG - Intronic
1019258372 7:65908-65930 CCAGCTGTGGACCGTGGCCTCGG - Intergenic
1019468389 7:1203227-1203249 CAGGCTGGGCACAGTGGCTCAGG - Intergenic
1020352534 7:7236803-7236825 CCAGCTGGGCACAGTGGCTCAGG - Intronic
1022171791 7:27838579-27838601 TAAGCTGGGTACTGTGGACTCGG - Intronic
1022973333 7:35536542-35536564 CAACCTGGGGACTCTGGCCCTGG + Intergenic
1023018110 7:35985797-35985819 CAGGCTGGGCACGGTGGCTCAGG + Intergenic
1023538562 7:41240158-41240180 CAGGCTGAGGGCTGTGGCCTGGG - Intergenic
1023960791 7:44924363-44924385 CAAGCTGAGAACTGTGGACACGG + Intergenic
1024452533 7:49563997-49564019 CAAGCTGTGCACTGCAGCCCTGG - Intergenic
1025146845 7:56512693-56512715 CAAGCTGCGCACTGTGTCTCTGG - Intergenic
1025233082 7:57215764-57215786 TGTGCTGGGCACTGTGGGCTGGG + Intergenic
1025797849 7:64756717-64756739 CAAGATGGGCACAGTGGCTCAGG + Intergenic
1026955879 7:74376246-74376268 CAAGCTGGACTCGCTGGCCTCGG + Exonic
1026979235 7:74516899-74516921 CAGGCTGGGGACTGAGGACTGGG - Intronic
1028154752 7:87417498-87417520 CAACCTGGTTCCTGTGGCCTGGG + Exonic
1028217423 7:88151574-88151596 CAAGCTGTGCACCCTGGCATGGG - Intronic
1028439952 7:90848380-90848402 CTGGCTGGGCACTGTGGCTCAGG - Intronic
1029279158 7:99425528-99425550 GCAGCTCGGGACTGTGGCCTAGG - Exonic
1029624427 7:101711181-101711203 CAGGCTGGGCACAGTGGCAGTGG + Intergenic
1031188432 7:118513514-118513536 AAGGCTGGGCACTGTGGCTCAGG - Intergenic
1031221526 7:118972519-118972541 CTGGCTGGGCACTGTGGCTCAGG - Intergenic
1031386712 7:121160729-121160751 AACTCTGGGGACTGTGGCCTGGG - Intronic
1032132214 7:129239592-129239614 GAAGCTGGGCACAGTGGCTTGGG - Intronic
1032240825 7:130157504-130157526 AAGGCTGGGCACGGTGGCCCAGG - Intergenic
1033196259 7:139330018-139330040 CAAGCTGTGCACTCTGGGCAAGG + Intergenic
1033491500 7:141847936-141847958 TCAGCTGGGCACTATGGTCTTGG - Intergenic
1035077124 7:156187513-156187535 CTACCTGGGCACTGAGCCCTGGG + Intergenic
1035299898 7:157890358-157890380 CAGGCTGGGCACGGTGGCTCAGG + Intronic
1035812652 8:2505397-2505419 AAAGCCGGGCTCTGTGACCTTGG - Intergenic
1035876443 8:3194964-3194986 CAAGCTGGGCACTGCGGAAGGGG + Intronic
1037770163 8:21794133-21794155 CAGGCTGGGCACAGTGGCTCAGG - Intronic
1038792145 8:30677368-30677390 CAAGCCTGGCTCTGTTGCCTAGG - Intergenic
1039904132 8:41773800-41773822 GGAGCTGGGCACCGTGGCCGTGG - Intronic
1041017774 8:53608771-53608793 ATAACTGGGCACAGTGGCCTGGG + Intergenic
1041090329 8:54295864-54295886 AACGGTGGGTACTGTGGCCTGGG + Intergenic
1044534575 8:93344548-93344570 CCAGCTGGGCACCGTGGCTCAGG + Intergenic
1044662989 8:94609842-94609864 TAAGCTGGGCACAGTGGCGCAGG + Intergenic
1044668559 8:94655608-94655630 CAAACTGGGCACGGTGGCTCAGG + Intronic
1044986977 8:97764472-97764494 TGAGCTGGGCAATGTGACCTGGG + Intergenic
1044986995 8:97764577-97764599 TGAGCTGGGCAATGTGACCTAGG + Intergenic
1044987002 8:97764619-97764641 GGACCTGGGCACTGTGACCTGGG + Intergenic
1045217685 8:100164704-100164726 CAGGTTGGGCACTGTGGCTCAGG - Intronic
1045251290 8:100485301-100485323 CATGGTGGTCACAGTGGCCTTGG - Intergenic
1046779752 8:118202504-118202526 CAAGCTGGCCACTGCCTCCTGGG - Intronic
1047807459 8:128375251-128375273 CTAGCTGGGCACTGGTCCCTGGG - Intergenic
1048259834 8:132936267-132936289 CAAACTGCTCACTGGGGCCTGGG + Intronic
1048930675 8:139313290-139313312 CATGCTGGGCTCTGGGGCCATGG + Intergenic
1048988681 8:139748838-139748860 CCTGCTGGGCACTAGGGCCTGGG - Intronic
1049614967 8:143572075-143572097 CAGGGTGAGCACTGTCGCCTGGG + Exonic
1049661636 8:143822149-143822171 CGAGGAGGCCACTGTGGCCTGGG - Intronic
1049756411 8:144313047-144313069 CCAGGTGTGCCCTGTGGCCTAGG + Intronic
1050285481 9:4097389-4097411 CCAGGTGGGCACTGAGGCCCAGG - Intronic
1051357565 9:16253747-16253769 CAGGCTGGGCTCTGTGCTCTGGG + Intronic
1052751713 9:32498439-32498461 CAGGCTGGGAAGTGTAGCCTCGG - Intronic
1053389447 9:37723709-37723731 TAGGCTGGGCACAGTGGCTTAGG + Intronic
1053539429 9:38958494-38958516 CCAGCTGGGCACAGTGGCTCAGG + Intergenic
1054626712 9:67405424-67405446 CCAGCTGGGCACAGTGGCTCAGG - Intergenic
1055929388 9:81544036-81544058 CAAGCTGGGCAAAGTGGCGTAGG + Intergenic
1056818234 9:89817231-89817253 CAAGCTGGGCCCTGCAGGCTAGG + Intergenic
1057137157 9:92700182-92700204 CTAGCTGGGCACGGTGGCGTGGG + Intergenic
1057811480 9:98260209-98260231 AAAGCTGGGCACAGTGGCTCAGG - Intergenic
1058550812 9:106112797-106112819 AAAGCTGGGCACTGGAGCCCAGG - Intergenic
1058674808 9:107391191-107391213 CAGCCTGGGCACTCTAGCCTGGG - Intergenic
1058969972 9:110072277-110072299 CAAGCTGCCCACTGTTGCTTGGG + Intronic
1059108600 9:111533398-111533420 CAGGCTGGGCACAGTGGCTCAGG + Intronic
1059312803 9:113400261-113400283 CATGGTGGGCACTGAGGACTGGG - Intronic
1060351410 9:122864016-122864038 CAGGCTGGGCACGGTGGCTCAGG - Intronic
1060391788 9:123283866-123283888 CAGGCTGGGCACTCCAGCCTGGG - Intergenic
1060939064 9:127533173-127533195 AAGGCTGGGCACGGTGGCTTAGG + Intronic
1061367207 9:130178301-130178323 GAGGCTGGGCTCTGGGGCCTGGG - Intronic
1061708809 9:132473303-132473325 CAAAGTGGGCACTGTGGTATGGG + Intronic
1062000732 9:134214488-134214510 CATCCTGTGCAGTGTGGCCTGGG + Intergenic
1062475236 9:136723440-136723462 GAAGCGGCGCACGGTGGCCTCGG - Exonic
1187875928 X:23804070-23804092 CAAGCTGGAGGCTGTAGCCTGGG + Intergenic
1188650491 X:32626187-32626209 CAGGCTGGGCACAGTGGCTCAGG + Intronic
1188651272 X:32634193-32634215 CAGGCTGGCCAAAGTGGCCTTGG - Intronic
1190004827 X:46725768-46725790 CAGGCTGGGCAGTGGAGCCTTGG + Intronic
1191852641 X:65597090-65597112 CAAGTTCTGCACTGTAGCCTGGG - Intronic
1192205009 X:69089768-69089790 CAGGCTGGGCACTGTGGCTCGGG + Intergenic
1192234413 X:69286564-69286586 CAGGCTGTGCGCTATGGCCTAGG - Intergenic
1192788077 X:74354181-74354203 CAAGCCAGCCACTGTGGCCTCGG + Intergenic
1193053954 X:77129762-77129784 GAAGCTGGGAACCATGGCCTGGG + Intergenic
1193150751 X:78121917-78121939 CAGGCTGGGCATGGTGGCTTAGG + Intronic
1193713221 X:84903659-84903681 CAGGCTGGGCACAGTGGCTCAGG - Intergenic
1193933315 X:87583366-87583388 CAAGCTGTGCTACGTGGCCTGGG - Intronic
1195208060 X:102624385-102624407 CAAGCTGTACACTGTGGCTCTGG + Intergenic
1196859865 X:120016497-120016519 CTGGGTGGGCACTGTGGACTTGG + Intergenic
1197809767 X:130430747-130430769 TCAGCTGGGCACCGTGGCCTTGG + Intergenic
1197972537 X:132130265-132130287 CAAGCTGGACACTGAGGGCATGG - Intergenic
1198447037 X:136727678-136727700 TTAGCTGGGCATGGTGGCCTAGG - Intronic
1199863178 X:151820297-151820319 CAGGCTGGCCACTGTGGCCCAGG + Intergenic
1200205158 X:154310309-154310331 CTAGCTGGGCATGGTGGCGTGGG + Intronic
1200229130 X:154435378-154435400 GATGCTGGGCCCTGTGACCTGGG - Exonic
1200316062 X:155134454-155134476 TAGGCTGGGCACCATGGCCTTGG - Intronic
1201304335 Y:12537656-12537678 CAAACAGGGCACAGTGGCTTAGG - Intergenic
1201903243 Y:19064500-19064522 CAAGCTGGGCGCAGTGGAATGGG - Intergenic
1201918326 Y:19206518-19206540 TAAGCTGGGCATGGTGGCATGGG - Intergenic