ID: 1106788911

View in Genome Browser
Species Human (GRCh38)
Location 13:33134878-33134900
Sequence CTCTCAAGACTATTAATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106788911_1106788913 21 Left 1106788911 13:33134878-33134900 CCTGCTATTAATAGTCTTGAGAG 0: 1
1: 0
2: 1
3: 5
4: 105
Right 1106788913 13:33134922-33134944 TGTGACTTAACCATGTAATATGG 0: 1
1: 0
2: 0
3: 13
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106788911 Original CRISPR CTCTCAAGACTATTAATAGC AGG (reversed) Intronic
900152843 1:1186758-1186780 CTCTAAAGAATATACATAGCTGG - Intronic
903390097 1:22957946-22957968 CTCTTAAGAATATTAAGGGCTGG - Intronic
908378284 1:63569022-63569044 ATATCAATAGTATTAATAGCAGG - Intronic
908429376 1:64041006-64041028 GTCTCAAGTCAATTAATAGTGGG + Intronic
913011191 1:114685393-114685415 TTCTCAAGATTATTAATTCCTGG - Intronic
913580178 1:120218894-120218916 CTCTGAAGACTATACATAGTAGG - Intergenic
913627998 1:120679499-120679521 CTCTGAAGACTATACATAGTAGG + Intergenic
914562103 1:148830335-148830357 CTCTGAAGACTATACATAGTAGG - Intronic
914610727 1:149299886-149299908 CTCTGAAGACTATACATAGTAGG + Intergenic
916420491 1:164633457-164633479 CTCTTTAGACTATTAATAGTTGG + Intronic
916776539 1:167971050-167971072 CTCTGAGGACTATAAGTAGCTGG - Intronic
917186419 1:172361609-172361631 CTTTAAAGACTATTGATACCTGG - Intronic
917801641 1:178576189-178576211 CCATAAAGACTATAAATAGCAGG + Intergenic
918919357 1:190688133-190688155 CTTTGAAGACTATTTATTGCTGG - Intergenic
921345184 1:214176355-214176377 CCATCAAGACTATCACTAGCAGG - Intergenic
1063893849 10:10658262-10658284 CTCTCAAGGCCATAAAGAGCAGG - Intergenic
1065312963 10:24433956-24433978 CTCTCAATCCCATCAATAGCAGG - Intronic
1068470692 10:57458341-57458363 CCCTCATGACTATAAATAGGAGG - Intergenic
1068518604 10:58054530-58054552 CTCACAAGACTTTTAATAATAGG + Intergenic
1076159510 10:128232612-128232634 CTCTCATGACTCTTACTAGTAGG - Intergenic
1080935150 11:36855556-36855578 CTCACAAGACTAATGATAGAGGG + Intergenic
1082014997 11:47478805-47478827 CTCCCAAGACTGTTGTTAGCTGG + Intronic
1087247708 11:95859154-95859176 CTATCAAGTCTACTAGTAGCAGG - Intronic
1093729142 12:22547997-22548019 CTCCAAAAACTATTAATATCTGG + Intergenic
1096264227 12:50110890-50110912 CCCTCCGGACTATTTATAGCTGG - Exonic
1097771406 12:63590809-63590831 ATCTCAAAAATAATAATAGCAGG - Intronic
1106788911 13:33134878-33134900 CTCTCAAGACTATTAATAGCAGG - Intronic
1110000521 13:70193547-70193569 CTCTTAAGACAAATATTAGCAGG - Intergenic
1110093412 13:71484280-71484302 TCCTCATGAATATTAATAGCTGG + Intronic
1111802888 13:93001776-93001798 CTCTAAAGACTATTAGTTGAAGG - Intergenic
1112703774 13:102042832-102042854 CTCTCAAAACTATGGATAGTTGG + Intronic
1116699488 14:48221414-48221436 CTCTCAACACTATTCCTAGCTGG + Intergenic
1117481806 14:56153342-56153364 CTCTAATGACAATTAAGAGCAGG - Intronic
1124503060 15:30247430-30247452 CTCTAAAGAGTATTACTACCAGG - Intergenic
1124740496 15:32291216-32291238 CTCTAAAGAGTATTACTACCAGG + Intergenic
1125709066 15:41769100-41769122 CTCTAAGGACAATTATTAGCAGG - Exonic
1126758148 15:51944235-51944257 ATCTCAAGACGATAAAGAGCTGG + Intronic
1127489506 15:59448965-59448987 CTCAAAAGAATATCAATAGCTGG - Intronic
1127881739 15:63164065-63164087 CCCTCCAGACAATTTATAGCAGG - Intergenic
1128487384 15:68107531-68107553 CTCCAAAGACTATAAATATCTGG - Intronic
1128829794 15:70757295-70757317 TTGGCAAGACTATTAATAGGTGG + Intronic
1133825171 16:9271915-9271937 CTCTCAACAAAATGAATAGCTGG - Intergenic
1136299250 16:29322211-29322233 CTCTCTTGAATATTCATAGCTGG + Intergenic
1139895051 16:70281849-70281871 CTCTAAAAAATAATAATAGCTGG + Intronic
1140195672 16:72853163-72853185 CCTTCAATACTATGAATAGCAGG + Intronic
1141363124 16:83415721-83415743 CTCTCAAAACTAGGAATAGAAGG + Intronic
1143617271 17:8060038-8060060 CTCTCAGGACTGTAAATTGCAGG - Intergenic
1150427798 17:65090513-65090535 CTGCCATAACTATTAATAGCTGG - Intergenic
1150958919 17:69893302-69893324 CTCTCCACACTATTAACAGACGG - Intergenic
1153705871 18:7745275-7745297 CTCTCATGACTTCAAATAGCTGG - Intronic
1153949148 18:10043674-10043696 TTCATAAGCCTATTAATAGCTGG + Intergenic
931058817 2:58503421-58503443 CTCTCAGGACAATGAATAGATGG - Intergenic
933263947 2:80160938-80160960 CTCTGAAGAATATGAATAGAGGG - Intronic
934474320 2:94583343-94583365 TTTCCAAGACTATTAATATCCGG + Intergenic
935377637 2:102416310-102416332 CTCTCAAAAATATGAATAGTTGG + Intergenic
937390717 2:121483948-121483970 TTCTCTAGACAAATAATAGCAGG - Intronic
937584338 2:123527520-123527542 CTCTCAAGAGAACTAATAGAGGG + Intergenic
945622476 2:212157892-212157914 GTGTCAAGACTGTTAAGAGCAGG - Intronic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
1168746950 20:251738-251760 CTCTCAAGACAAACAATAACTGG - Intergenic
1170064437 20:12295225-12295247 GTCTCAAAGGTATTAATAGCAGG - Intergenic
1170847542 20:19974965-19974987 GTGTGGAGACTATTAATAGCGGG - Exonic
1173793252 20:45841538-45841560 CTCTCCAGCCTATAAACAGCCGG + Exonic
1174826218 20:53771072-53771094 CTCTCAACACTATTGACAGTTGG + Intergenic
1178751319 21:35306250-35306272 CTCTGTAAACTGTTAATAGCAGG - Intronic
1182977117 22:34633935-34633957 CACTTAAGAATAATAATAGCCGG + Intergenic
1185262692 22:49878346-49878368 TTCTCAAGAGTAATAATAACTGG + Intronic
952064934 3:29557872-29557894 CTCTGAAGATTATTTATAACAGG + Intronic
952234588 3:31465923-31465945 CTCTCATTTCTATTAATAGCTGG + Intergenic
957798379 3:85042259-85042281 TGCTCAAGACGACTAATAGCTGG - Intronic
968416209 4:436546-436568 CTCTCAAGACTGTTTCCAGCTGG + Intronic
971915053 4:32858859-32858881 ATAACAAGACTATTAATACCAGG - Intergenic
972064611 4:34925313-34925335 CCATCAATACTATTAATGGCAGG - Intergenic
972847815 4:43010627-43010649 CTCTCTTAATTATTAATAGCAGG + Intronic
979996239 4:127434691-127434713 CACTCAAGACTACTAAAAGGGGG + Intergenic
980480643 4:133382859-133382881 CTCTTTATACTATTAATAGGTGG + Intergenic
980977032 4:139621118-139621140 CTCCTAGGACAATTAATAGCAGG + Intergenic
982074328 4:151723444-151723466 CTATCAAGACTACTAACAGCAGG + Intronic
982463554 4:155701977-155701999 CCTTCAAGACTTTGAATAGCTGG + Intronic
982724018 4:158886442-158886464 CTCTCCAGACCACTAACAGCAGG - Intronic
990770140 5:59234472-59234494 CTGTCATGACTATGTATAGCTGG - Intronic
993770663 5:91921520-91921542 CTTTCAAGAATATTAATGACTGG + Intergenic
995178448 5:109206417-109206439 CCCCCAAAAGTATTAATAGCCGG - Intergenic
995695574 5:114875365-114875387 ATCTCCAGACTTTAAATAGCAGG - Intergenic
995987532 5:118197239-118197261 CTGTTAAGACTATAAAGAGCAGG - Intergenic
997504871 5:134409301-134409323 TTCTGAAAAGTATTAATAGCTGG + Intronic
1000697754 5:164409813-164409835 CTCTCATGACTGATAATACCAGG - Intergenic
1007480327 6:42145510-42145532 CTCTCAAGAATATTAGTTACAGG - Intergenic
1009992107 6:70856061-70856083 CTATGAAGACTAGTAAAAGCTGG - Intronic
1011993543 6:93555332-93555354 CTCTCATGACTATTAAAAAAGGG - Intergenic
1013020736 6:106214430-106214452 TTGTCAAGACTATTAAAAGTGGG - Intronic
1017122363 6:151036625-151036647 TTTCCAAGACTATTAATATCCGG - Intronic
1017130965 6:151107939-151107961 CTCTCTGGGCAATTAATAGCAGG + Intergenic
1018019685 6:159748971-159748993 CTCTCATGACTATTGAAAGTTGG - Intronic
1020862154 7:13507320-13507342 ATTTCAAGACTATTAATAGACGG - Intergenic
1022931004 7:35114589-35114611 ATCTCAAAAATAATAATAGCAGG - Intergenic
1023640563 7:42252842-42252864 CTATCAAGACTTTTAAAAGATGG - Intergenic
1029182506 7:98713587-98713609 GTCACCAGATTATTAATAGCTGG + Intergenic
1030573277 7:111253538-111253560 CTCTCAAGACTTTTATTTTCTGG - Intronic
1037157710 8:15725392-15725414 CTCTCAAGGCTGATAATATCAGG + Intronic
1039880896 8:41624938-41624960 ATCAAAAGACCATTAATAGCAGG - Exonic
1045729877 8:105225127-105225149 CTCTGAAGGCTACTAATATCAGG - Intronic
1053683752 9:40502766-40502788 TTTCCAAGACTATTAATATCCGG - Intergenic
1053933730 9:43131078-43131100 TTTCCAAGACTATTAATATCTGG - Intergenic
1054279965 9:63122161-63122183 TTTCCAAGACTATTAATATCCGG + Intergenic
1054296853 9:63338257-63338279 TTTCCAAGACTATTAATATCCGG - Intergenic
1054394869 9:64642763-64642785 TTTCCAAGACTATTAATATCCGG - Intergenic
1054429517 9:65147963-65147985 TTTCCAAGACTATTAATATCCGG - Intergenic
1054500865 9:65873568-65873590 TTTCCAAGACTATTAATATCCGG + Intergenic
1186753498 X:12645971-12645993 CTCTCAAGGCTATGAAGAACAGG - Intronic
1187193381 X:17057889-17057911 CTCTAAAGGGAATTAATAGCTGG + Intronic
1196080511 X:111625473-111625495 GTCTCTAGACTTTTAATTGCAGG - Intergenic