ID: 1106790608

View in Genome Browser
Species Human (GRCh38)
Location 13:33151959-33151981
Sequence CGTTAAACACAGAGGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106790604_1106790608 4 Left 1106790604 13:33151932-33151954 CCAGATTTCAGACTTTGCTGAAC 0: 1
1: 0
2: 0
3: 22
4: 172
Right 1106790608 13:33151959-33151981 CGTTAAACACAGAGGAAACAGGG 0: 1
1: 0
2: 0
3: 17
4: 232
1106790603_1106790608 5 Left 1106790603 13:33151931-33151953 CCCAGATTTCAGACTTTGCTGAA 0: 1
1: 0
2: 1
3: 27
4: 247
Right 1106790608 13:33151959-33151981 CGTTAAACACAGAGGAAACAGGG 0: 1
1: 0
2: 0
3: 17
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106790608 Original CRISPR CGTTAAACACAGAGGAAACA GGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900964721 1:5949981-5950003 TTTTAAACACAGAAGAAAAATGG + Intronic
901869894 1:12132164-12132186 TGCTAATCACAGAGGAAACTGGG - Intronic
903085496 1:20853899-20853921 CTTTAAAAACATAGTAAACAGGG + Intronic
905751959 1:40473057-40473079 CGTTAAAGAAAGAGGAGTCAAGG - Intergenic
907071078 1:51535405-51535427 CTTTAAAGACAGAAGAAACTAGG - Intergenic
907971343 1:59384609-59384631 CATTAAGCATAGAGGAAAGAGGG + Intronic
908515957 1:64893015-64893037 AGTCAAAAACAGAGGACACAAGG + Intronic
910461155 1:87449269-87449291 AGTTAAACATGGAGGAACCAGGG - Intergenic
912149727 1:106843484-106843506 CATAAAACACAGAGGTAAAAGGG - Intergenic
913365848 1:118037553-118037575 ATTTAAACACTGAGTAAACATGG - Intronic
914712483 1:150227537-150227559 AGTTAAACACTGGGGACACAGGG + Intronic
917220770 1:172726862-172726884 GGTTGAAGAAAGAGGAAACAGGG + Intergenic
917427239 1:174927528-174927550 CTTTAAAAAGAGAGGAAATATGG - Intronic
918192707 1:182191477-182191499 CATTAAACACAGTAGAAAGAAGG - Intergenic
919678911 1:200414059-200414081 TGTTAAAAATAGAGGAAACTGGG - Intergenic
920565536 1:206969818-206969840 CGTTAGAAAGAGAAGAAACACGG - Intronic
920965008 1:210694190-210694212 CGGTAAAGACAGGGGAAATAGGG + Intronic
1063448023 10:6132402-6132424 AGCTAAACACTGAGGACACAAGG + Intergenic
1063646821 10:7893397-7893419 AGTTAAACAGAGAAGAAGCAGGG + Intronic
1064366165 10:14710143-14710165 CGTTAATAACAGGGGAAACTAGG + Intronic
1065198997 10:23296213-23296235 AGTTAAATAGAGTGGAAACAGGG + Intronic
1069231497 10:66014633-66014655 CGGTTATCACAGTGGAAACATGG - Intronic
1069263240 10:66426797-66426819 TTTTAAAGACAGAGGAAATATGG - Intronic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1070760915 10:79023922-79023944 CTTTAGCCAGAGAGGAAACAAGG + Intergenic
1071468927 10:85965576-85965598 AGTTAAACACTGAGAACACATGG + Intronic
1072120874 10:92404779-92404801 CATTTCACAGAGAGGAAACAGGG - Intergenic
1074326101 10:112452832-112452854 TGTTAATCACAGAGAAAACTGGG - Intronic
1079346451 11:19656791-19656813 CGGTAGCCACAGAGGAAACAAGG + Intronic
1079895092 11:26109101-26109123 CTGCAAACACAGAGGAACCAGGG + Intergenic
1080402865 11:31953751-31953773 CCTTAAACATAAAGGAAACAAGG + Intronic
1081060373 11:38467553-38467575 AGTTAAACACTGAGTACACAGGG + Intergenic
1083089492 11:60185428-60185450 CCTTAGAGACAGAGCAAACATGG - Intergenic
1088708612 11:112485882-112485904 TGTTAAAAATAGAGGAATCAGGG - Intergenic
1090274741 11:125411445-125411467 AGAGAAAGACAGAGGAAACAGGG - Intronic
1090445431 11:126761003-126761025 CGTTAAACATAAATGAAAGAGGG + Intronic
1091458542 12:626599-626621 GGTGAAACACAGAAGAAATATGG + Intronic
1092436494 12:8451208-8451230 AGTTAAACACTGAGCACACATGG + Intergenic
1093118259 12:15237006-15237028 TTTTAACCACAGAGGAAACTGGG + Intronic
1095783871 12:46089333-46089355 AGTTAAACACAAAGTAAACAAGG - Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1099991647 12:89728822-89728844 CGCTAAACACTGAGTACACATGG + Intergenic
1103832399 12:123790162-123790184 AATTTAACACAGAGAAAACATGG - Intronic
1104462601 12:128967919-128967941 AGTTAAGCCCAGAGGAAACTCGG + Intronic
1104544386 12:129698500-129698522 CTTTAAACATAAAGGAAAAAAGG + Intronic
1104737735 12:131148411-131148433 AGTTAAACACTGAGCACACATGG - Intergenic
1104747061 12:131217193-131217215 TGTCAGACCCAGAGGAAACAGGG + Intergenic
1106769425 13:32947424-32947446 TGTTAAACAGAGAGGAAATGAGG + Intergenic
1106790608 13:33151959-33151981 CGTTAAACACAGAGGAAACAGGG + Intronic
1107625553 13:42279017-42279039 CATTATATACAGAGGAACCAAGG - Intronic
1108720754 13:53129283-53129305 AGTTAAAGTCAGAGGAACCACGG - Intergenic
1109036477 13:57268238-57268260 AGCTAAACACTGAGCAAACATGG - Intergenic
1112200731 13:97271632-97271654 AGTTAAACACTGAGAACACATGG - Intronic
1113508901 13:110836137-110836159 CCTTAAAAAGAGAGGAAAGAAGG + Intergenic
1115294833 14:31813736-31813758 AGTTGAACAAAGAGAAAACATGG - Intronic
1115452086 14:33559699-33559721 CGTTAAACATGGAGAAAAGACGG + Intronic
1119147591 14:72331098-72331120 TGTTAGACACAGAGGACACAAGG + Intronic
1121953613 14:98194513-98194535 CTTAAAACACAAAGGAAAGATGG + Intergenic
1122166007 14:99824313-99824335 AATAAGACACAGAGGAAACATGG - Intronic
1125020652 15:34983018-34983040 CTTTTACCACAGAGGAAAGATGG - Exonic
1126752447 15:51890865-51890887 TGTTAAAAACAGCGGAAACTGGG - Intronic
1127978071 15:64013786-64013808 CATCAAAGCCAGAGGAAACATGG + Intronic
1129267000 15:74398715-74398737 CGTTGAACACAGAGTTACCATGG + Intergenic
1129703072 15:77779053-77779075 CATTCAAAGCAGAGGAAACAGGG - Intronic
1130273988 15:82466957-82466979 GGTTATACAGAGAGGAGACAGGG + Intergenic
1130466336 15:84194331-84194353 GGTTATACAGAGAGGAGACAGGG + Intergenic
1130497928 15:84479205-84479227 GGTTATACAGAGAGGAGACAGGG - Intergenic
1130588630 15:85198924-85198946 GGTTATACAGAGAGGAGACAGGG + Intergenic
1130671703 15:85918613-85918635 TGTTATACAAAGAGGAAACATGG - Intergenic
1130752710 15:86729479-86729501 AGCTAAACACTGAGTAAACATGG - Intronic
1135878144 16:26224843-26224865 CATAAAAGACAGAGGGAACATGG + Intergenic
1138058087 16:53857287-53857309 AGCTAAACACTGAGTAAACATGG - Intronic
1140085717 16:71794523-71794545 TGATAAAAACAGAGGAAAAAAGG + Intronic
1140837529 16:78809068-78809090 CGAGAAACACTGAGGACACACGG + Intronic
1144184818 17:12787131-12787153 GGTTGAACAAAGAGAAAACATGG - Intergenic
1145967707 17:28932064-28932086 CTTGAAGCAGAGAGGAAACATGG - Intronic
1146555937 17:33824049-33824071 CTTAAAAAACAGAGAAAACATGG + Intronic
1151263422 17:72935355-72935377 GGTTAAACAAAAGGGAAACAGGG + Intronic
1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG + Intergenic
1203168160 17_GL000205v2_random:118366-118388 AGTTAAACAAAGAGAACACAGGG + Intergenic
1153760394 18:8325366-8325388 AGTTAAACACTGAGAACACATGG - Intronic
1154036924 18:10812316-10812338 AGTTAAACACTGAGTACACACGG + Intronic
1155631491 18:27898847-27898869 TTTTAAACACACAGGATACAAGG + Intergenic
1156178265 18:34573184-34573206 TTTTAAACACAGAGGAATAAAGG - Intronic
1156999211 18:43504124-43504146 AGTTAAACACTGAGCACACATGG - Intergenic
1157422656 18:47559457-47559479 CGTTACTCCCAGAGGAAAGAGGG + Intergenic
1157484110 18:48074801-48074823 TGGCAAACACAGAGGAAAAATGG + Intronic
1157883857 18:51347473-51347495 CTCTACGCACAGAGGAAACAAGG - Intergenic
1158106566 18:53891344-53891366 CAGGAAAGACAGAGGAAACAAGG + Intergenic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1162606377 19:11711453-11711475 AGTTAAACATTGAGTAAACATGG - Intergenic
1162978789 19:14224888-14224910 AGTTAAACACTGAGTACACATGG - Intergenic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1164893901 19:31852204-31852226 TGTTAATGACAGAGGAAACTGGG + Intergenic
1165611619 19:37158817-37158839 TGCTAAACACAAAGGAAAAAGGG + Intronic
1165665877 19:37627517-37627539 AGCTAAACACAGAGTACACATGG - Intronic
1168437341 19:56330035-56330057 AGTTAAACACTGAGCACACATGG - Intronic
925030155 2:644042-644064 CGACAAACTCAGAGGAAAAATGG - Intergenic
926313266 2:11690403-11690425 AGTGAAACACAGAGCACACATGG - Intronic
931667632 2:64621909-64621931 TGTTAATAACAGAGGAAACTAGG + Intergenic
934972610 2:98775160-98775182 GGGTAAGCACTGAGGAAACACGG - Intergenic
935611569 2:105031253-105031275 AGTTAAAGACAGAGGAAAAGTGG + Intergenic
937936748 2:127251753-127251775 TGAAAAACACAAAGGAAACAGGG + Intergenic
943452659 2:188064707-188064729 CATTTAATACAGAGTAAACAAGG + Intergenic
943675729 2:190715055-190715077 CGTTAAACACTCAGGGAAAATGG - Intergenic
944688736 2:202140526-202140548 CCCCAAACACAGAGAAAACAGGG + Intronic
945649863 2:212543644-212543666 TCTTAAACAAAGAAGAAACAGGG - Intergenic
947668479 2:231922315-231922337 CCTGAAACACAGAGTGAACACGG + Exonic
948130598 2:235597714-235597736 CGCTCCACACACAGGAAACACGG - Intronic
948130602 2:235597748-235597770 CGCTCCACACAAAGGAAACACGG - Intronic
948130606 2:235597782-235597804 CGCTCCACACAAAGGAAACACGG - Intronic
948130610 2:235597816-235597838 CGCTCCACACAAAGGAAACACGG - Intronic
948130614 2:235597850-235597872 CGCTCCACACAAAGGAAACACGG - Intronic
948130618 2:235597884-235597906 CGCTCCACACAAAGGAAACACGG - Intronic
948130634 2:235598014-235598036 CGCTCCACACAAAGGAAACACGG - Intronic
948130644 2:235598082-235598104 CGCTCCACACAAAGGAAACACGG - Intronic
1170798087 20:19567445-19567467 AGTTAAACACTGAGTACACATGG + Intronic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176325531 21:5445691-5445713 AGTTAAACAAAGAGAACACAGGG + Intergenic
1176333388 21:5572266-5572288 AGTTAAACAAAGAGAACACACGG - Intergenic
1176394369 21:6248686-6248708 AGTTAAACAAAGAGAACACACGG + Intergenic
1176403597 21:6340771-6340793 AGTTAAACAAAGAGAACACAGGG - Intergenic
1176433560 21:6648333-6648355 AGTTAAACAAAGAGAACACAGGG + Intergenic
1176467050 21:7067488-7067510 AGTTAAACAAAGAGAACACACGG - Intronic
1176490611 21:7449266-7449288 AGTTAAACAAAGAGAACACACGG - Intergenic
1176510031 21:7689117-7689139 AGTTAAACAAAGAGAACACACGG + Intergenic
1176658887 21:9614791-9614813 GGTTAAGGACACAGGAAACAGGG - Intergenic
1178169019 21:30017788-30017810 CCTTAAACAAAGAGGAAACTGGG - Intergenic
1179330008 21:40390721-40390743 ACTTAAACACAGAGAGAACATGG - Intronic
1179659465 21:42865201-42865223 GGGTAAACACAGAGAAAACAAGG + Intronic
953814027 3:46139264-46139286 GGTTAAACACAGAAAAAAGAAGG - Intergenic
953857152 3:46508139-46508161 TGATAAACACAGAGAGAACATGG + Intergenic
954926124 3:54236371-54236393 GGATAACCACAGAGGAAACTGGG + Intronic
955700118 3:61673971-61673993 AGTTGAACAAAGAGAAAACATGG + Intronic
956166961 3:66404463-66404485 GGTTACACGCAGAGAAAACAGGG + Intronic
960194660 3:114750312-114750334 CTTTAAACACTGAGGAGAAATGG + Intronic
962264810 3:133937316-133937338 TTATAAACACAGAGGAAGCAGGG - Intronic
962941766 3:140131016-140131038 CTTTAAACACTCAGAAAACATGG - Intronic
963367884 3:144362305-144362327 AGCTAAACACAGAGGCAAGAAGG + Intergenic
965112344 3:164443777-164443799 AGTTAAACAATGAGGACACATGG - Intergenic
965340751 3:167488332-167488354 GGTTAAACACTGAGCACACATGG + Intronic
968560851 4:1280988-1281010 CTATAAACACAAAAGAAACAGGG + Intergenic
969223762 4:5780874-5780896 CGTAAAATCCAGAGGAAACCAGG + Intronic
969327848 4:6454003-6454025 ATTTAAACACAGAGGAAAGGAGG - Intronic
969382732 4:6816162-6816184 CATCAAACCCAGAGGATACAAGG - Intronic
969763198 4:9206293-9206315 AGTTGAACATTGAGGAAACAAGG + Intergenic
970717255 4:18940785-18940807 CGTGAAACCCATAGGAAACAAGG - Intergenic
971496518 4:27271878-27271900 CGTTATAACCAGATGAAACAAGG + Intergenic
972035506 4:34514586-34514608 CCTTAAGGATAGAGGAAACAAGG - Intergenic
972953719 4:44362744-44362766 CCTTTAACACAGAAGAAACTAGG - Intronic
973077287 4:45945229-45945251 CGCTAAAGCTAGAGGAAACATGG + Intergenic
973638298 4:52879776-52879798 TGCTGAACACAGAGGAAGCAGGG + Intronic
973900674 4:55467008-55467030 TGTTAATAACAGAGGAAACTGGG + Intronic
975310985 4:72903712-72903734 CATTAAACATATAGGATACAGGG + Intergenic
976354631 4:84102792-84102814 AGCTAAACACAGAGCACACATGG + Intergenic
977189485 4:93981710-93981732 AGCTAAAGGCAGAGGAAACAGGG + Intergenic
977431139 4:96931319-96931341 CATTAATCACACATGAAACAAGG - Intergenic
977760146 4:100724400-100724422 AGTTAAAAACAAAGAAAACAAGG + Intronic
978160937 4:105547294-105547316 AGTTAAACACTGAGTACACATGG + Intergenic
979921605 4:126503229-126503251 CGTTAAAAAGTCAGGAAACAAGG + Intergenic
980196717 4:129598887-129598909 GGTTGAACAAAGAGGCAACAAGG - Intergenic
980517844 4:133888021-133888043 GCTTAAACACAGAGAAAACCTGG + Intergenic
980930696 4:139179613-139179635 TCTTGAACACAGAGGAAACCTGG + Intergenic
983839715 4:172442072-172442094 TTTTAAACACATATGAAACAAGG + Intronic
985245667 4:187977524-187977546 CCTTATACGAAGAGGAAACAGGG + Intergenic
985416438 4:189740637-189740659 GGTTAAGGACACAGGAAACAGGG + Intergenic
986374555 5:7116704-7116726 CGTTAAACATTGAGTACACATGG - Intergenic
989609942 5:43281358-43281380 AGTGAAGGACAGAGGAAACAGGG + Intergenic
990079157 5:51891352-51891374 TATTAAAGACAGAGGTAACAAGG + Intergenic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
991911440 5:71566339-71566361 TGTTAAAAACAGAGAAAATAAGG + Exonic
993090421 5:83419107-83419129 AATAAAACACAGAGGAAACGGGG + Intergenic
993649264 5:90498476-90498498 CGCTAAACACTGAGCACACATGG - Intronic
994363955 5:98889995-98890017 AGTTAAACACTGAGCACACATGG + Intronic
994595729 5:101831910-101831932 AGTTAAACAATGAGAAAACATGG - Intergenic
995353999 5:111216527-111216549 AGCTAAACACTGAGTAAACATGG - Intergenic
996183281 5:120446924-120446946 CCATAAACAAAGAAGAAACATGG + Intergenic
996638234 5:125721118-125721140 AGTTAAACACATACGAAAGAAGG + Intergenic
998673628 5:144382185-144382207 AGTTAAACACTGAGTACACATGG + Intronic
1002420713 5:179147448-179147470 CTTTAAACACAGATCCAACATGG - Intronic
1003047404 6:2746369-2746391 AGTAAAACATAGAGGAAAGAAGG + Intronic
1004594412 6:17085751-17085773 TGTTAAACACCGAGGGCACATGG + Intergenic
1008041481 6:46805778-46805800 CCTTAAAGACAGAAGAAACTTGG - Intronic
1008489587 6:52072258-52072280 CACAAAACTCAGAGGAAACATGG + Intronic
1008679878 6:53860971-53860993 CGCTAAACACTGAGAACACATGG + Intronic
1014611663 6:123555426-123555448 GGTTAAATACAGAGGAATAAAGG - Intronic
1015199801 6:130566428-130566450 CCTAAAACACAGAGAAAAAATGG + Intergenic
1015353346 6:132248378-132248400 TGTGATACACAGAGGATACAAGG + Intergenic
1016278111 6:142379239-142379261 AATTAAAGACAGAGGAAAAAAGG - Intronic
1018016108 6:159713761-159713783 CTTTAAAGACAGAGAAACCATGG - Intronic
1018732637 6:166663836-166663858 TGTTAAAGAAAGAGGAAATATGG + Intronic
1020905062 7:14053750-14053772 CGATAAACATAGAGTAAAAATGG - Intergenic
1021316075 7:19148753-19148775 CCTAGAACACAGAGGAATCAAGG - Intergenic
1022461228 7:30609538-30609560 TGTAAAAGACAGAGAAAACAAGG - Intronic
1023358276 7:39389737-39389759 TGTTAAACACAGGGGAAAAATGG - Intronic
1023466186 7:40457718-40457740 AGTCAAATACAGAGGACACATGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025048566 7:55714300-55714322 AGTTAAACACAGAGGCAGCATGG + Intergenic
1025814695 7:64900601-64900623 CGTTAAAGAAATAGGCAACATGG + Intronic
1026190448 7:68121509-68121531 GGATAAACTCAGAGGAAAAATGG - Intergenic
1030716118 7:112809167-112809189 CATTAAAGACAGAAGAATCATGG - Intergenic
1031447969 7:121878070-121878092 CTTTAAACACAGAGAAAAATTGG - Intronic
1031816103 7:126437939-126437961 CATTAAAGAGAGAGGAAACAGGG - Intergenic
1032297109 7:130649340-130649362 TGTTAAACAAAAAGGAACCAGGG - Intronic
1034294676 7:149961798-149961820 AGGTAAACACATAGGAAATATGG + Intergenic
1034294686 7:149961879-149961901 AGGTAAACACATAGGAAATATGG + Intergenic
1034309803 7:150077404-150077426 CTTTAACCACAGAGGTCACATGG - Intergenic
1034811379 7:154135073-154135095 AGGTAAACACATAGGAAATATGG - Intronic
1035908160 8:3536464-3536486 CATTAATCAAAGAGGAAACCTGG - Intronic
1036251368 8:7165663-7165685 GGGCAAACACAGGGGAAACAGGG + Intergenic
1036366121 8:8121797-8121819 GGGCAAACACAGGGGAAACAGGG - Intergenic
1036843288 8:12142598-12142620 AGTTGAACACTGAGGAAACAAGG - Intergenic
1037251283 8:16897498-16897520 CTTTAACCCCAGATGAAACATGG - Intergenic
1038753458 8:30317973-30317995 CGTTCATAACAGTGGAAACATGG + Intergenic
1039434863 8:37553183-37553205 GATGGAACACAGAGGAAACAAGG - Intergenic
1042288613 8:67142955-67142977 CGTTAACGTCAGGGGAAACAAGG - Intronic
1043918674 8:85955199-85955221 AGTTAAACACTGAGTACACATGG + Intergenic
1045351476 8:101344685-101344707 CATTGCACACAGAGGAACCATGG - Intergenic
1045351611 8:101345811-101345833 CATTCCACACAGAGGAACCATGG - Intergenic
1047537820 8:125735325-125735347 CTTTCAGCACAGAGGGAACACGG - Intergenic
1048035558 8:130674007-130674029 GGTTAAAGACAGAAGAAATAAGG - Intergenic
1048383097 8:133885540-133885562 TGTTAAAAATAGAGGAAACTGGG + Intergenic
1048527065 8:135212974-135212996 GGCTAAAGACAGAGGGAACAGGG - Intergenic
1048562875 8:135561100-135561122 GGTTAAATACACAGGAAATATGG - Intronic
1048640389 8:136351918-136351940 TGTCATACATAGAGGAAACAGGG + Intergenic
1049376398 8:142291457-142291479 CGTTAAACACAGAGCCTCCATGG + Intronic
1049660233 8:143816465-143816487 TATAAAACCCAGAGGAAACAAGG + Exonic
1050031366 9:1389544-1389566 AGTTAAACACTGAGTACACATGG - Intergenic
1052586649 9:30437938-30437960 AGTTAAACACTGAGTATACATGG + Intergenic
1052593327 9:30527286-30527308 AGTTAGACAAAGAGGAAGCATGG + Intergenic
1053399395 9:37804473-37804495 CTTAAAAGACAGAGGAAAAAGGG + Intronic
1053456626 9:38238084-38238106 CCATATACACAGAGGAATCAGGG - Intergenic
1055487899 9:76774797-76774819 AGTTAAATATGGAGGAAACAGGG + Intronic
1056121086 9:83489857-83489879 CGATAAACACAGAGAAATGAAGG + Intronic
1056411610 9:86333922-86333944 AGGGAAACACAGAGGCAACAAGG - Intronic
1058747532 9:108006766-108006788 CTGTAAACACAGAGAAATCAAGG - Intergenic
1059858236 9:118425913-118425935 CTTCATACACAGAGGAAATACGG - Intergenic
1203428309 Un_GL000195v1:62956-62978 AGTTAAACAAAGAGAACACACGG + Intergenic
1203437976 Un_GL000195v1:160337-160359 AGTTAAACAAAGAGAACACAGGG - Intergenic
1203636633 Un_KI270750v1:118398-118420 GGTTAAGGACACAGGAAACAGGG - Intergenic
1187640814 X:21287308-21287330 AGTTAAACACTGAGTACACATGG - Intergenic
1189294063 X:39906457-39906479 CGTGAAACACAGATCAAACACGG + Intergenic
1189926753 X:45962809-45962831 GGTTAAACACTGAGTACACATGG + Intergenic
1192108596 X:68341382-68341404 CTATAAACATATAGGAAACAGGG + Intronic
1195310034 X:103623877-103623899 TGTTAAAAATAGAGGAAACAGGG + Intronic
1195820402 X:108939116-108939138 AGTTAAACACTGAGGACACATGG - Intergenic
1198220181 X:134591932-134591954 ATTTAACCAAAGAGGAAACATGG - Intronic
1198562760 X:137868662-137868684 GGAAAAACACAGAGGAAACAAGG + Intergenic
1199514286 X:148658153-148658175 GGTTACGCACAGAGGACACATGG - Intronic