ID: 1106790931

View in Genome Browser
Species Human (GRCh38)
Location 13:33154144-33154166
Sequence CCATCCACAGGGAGGGTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106790922_1106790931 9 Left 1106790922 13:33154112-33154134 CCATGAGGGTGGGGCCTTTCAAC 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1106790931 13:33154144-33154166 CCATCCACAGGGAGGGTGTCGGG 0: 1
1: 0
2: 0
3: 19
4: 207
1106790924_1106790931 -5 Left 1106790924 13:33154126-33154148 CCTTTCAACAATCACAGGCCATC 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1106790931 13:33154144-33154166 CCATCCACAGGGAGGGTGTCGGG 0: 1
1: 0
2: 0
3: 19
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106790931 Original CRISPR CCATCCACAGGGAGGGTGTC GGG Intronic
900683256 1:3930782-3930804 TCACACACAGGGAGGGTGCCGGG + Intergenic
900991619 1:6100753-6100775 CCATCTACAGGGAGGATGTGAGG + Exonic
901237162 1:7673273-7673295 CCAGCAACAGGGATGGTTTCTGG - Intronic
901455742 1:9361830-9361852 ACATCTCCAGGGAGGGTGGCGGG - Intronic
901491510 1:9598636-9598658 GCATCCACAGGGCGGGGGTGGGG + Intronic
901615359 1:10535212-10535234 CCATCCATAGGGCTGGTGTCTGG + Intronic
901829062 1:11881135-11881157 CCACCCACAGGGAGGGGCTTTGG - Intergenic
902163866 1:14553754-14553776 CCAACCACCGGGTGGTTGTCAGG + Intergenic
903773921 1:25781078-25781100 CCATCTACAGGGAGTGGGGCTGG + Exonic
904312711 1:29639726-29639748 CCATCTCCAGGGAGGGATTCAGG - Intergenic
904542106 1:31239960-31239982 CCACCGACAGGGAGGGAGTTGGG + Intergenic
907239601 1:53074237-53074259 CCATCCACAGGCAGGGGGGCCGG - Intronic
909039080 1:70628674-70628696 CCAGGCACAGGTAGGGTGCCTGG + Intergenic
911025829 1:93434799-93434821 CTATCCAGAGGCAGGTTGTCTGG + Intergenic
912543505 1:110434394-110434416 CAGGCCACAGGGTGGGTGTCGGG + Intergenic
912658490 1:111508196-111508218 CCACCCACACCGAGTGTGTCAGG + Intronic
916183190 1:162105778-162105800 CAAACCACAGGGATGGTGGCTGG + Intronic
917972382 1:180217139-180217161 GCCTCCACTGGGAGGGTGCCAGG + Intergenic
919803717 1:201368437-201368459 CCATCATCAGGGAGGTTGCCGGG - Intronic
920363618 1:205436340-205436362 CCATCCACCAGGAGGGTGAGCGG - Intronic
1067533003 10:47088126-47088148 TGATCCACAGGGAGGGACTCAGG - Intergenic
1072421262 10:95291843-95291865 CACTCCACCGGGAGGGCGTCAGG - Intergenic
1072530480 10:96313967-96313989 GCAGCCACAGGGAGGCTGTCAGG - Intronic
1072895159 10:99360169-99360191 CCCTCCACTGGGAGGGAATCAGG - Intronic
1074991504 10:118712628-118712650 CTTTCCACAGCCAGGGTGTCCGG + Intronic
1075736261 10:124666414-124666436 CCATCCACAGGGAGCTCTTCGGG - Intronic
1077480093 11:2810240-2810262 CCATCCACAGGGAACTTCTCTGG - Intronic
1078927823 11:15890345-15890367 ACATTCACAGTGAGGGTGGCTGG - Intergenic
1081195187 11:40152345-40152367 GGATCCACTGGGAGGGTGGCAGG + Intronic
1083700272 11:64472733-64472755 CCATCCATAGGGATGGGCTCTGG - Intergenic
1085409750 11:76284093-76284115 TCCTGCACAAGGAGGGTGTCAGG + Intergenic
1087165525 11:94998834-94998856 CCATCCTCAGGTAGGGGCTCAGG - Exonic
1089009921 11:115123899-115123921 CCACCCACAGGAAGGGTGATTGG + Intergenic
1090527942 11:127557665-127557687 CCATCAACTCGGAGGATGTCTGG - Intergenic
1092071677 12:5636650-5636672 GCATGCACAGGGAGGGAGGCAGG + Intronic
1095655658 12:44666951-44666973 AGATCCACTGGGATGGTGTCAGG - Intronic
1096749397 12:53749063-53749085 CCATGCAGAGGGAGGGTGTGTGG - Intergenic
1096812400 12:54179752-54179774 CCAACCTCAGGGTGGGTGGCGGG - Intronic
1097979336 12:65720888-65720910 CCAGCCACAGGCATGGTGTTCGG + Intergenic
1105881757 13:24612171-24612193 CCTTCCACAGCGAGGGGGTTGGG + Intergenic
1106790931 13:33154144-33154166 CCATCCACAGGGAGGGTGTCGGG + Intronic
1107677774 13:42814673-42814695 CCATCCACATGGAGTGTGAATGG - Intergenic
1113633187 13:111901801-111901823 CCTTCCACAGGGAGAGGGCCCGG - Intergenic
1114418543 14:22560160-22560182 CCAGCCATGGGGAGTGTGTCTGG - Intergenic
1117274633 14:54180234-54180256 CCACCCACGGGGATGGGGTCTGG + Intergenic
1117334382 14:54744396-54744418 CCAGCCACAGGGAGGCTGTGCGG - Intronic
1118458519 14:65966787-65966809 CCAGCCGCAGGGAGGGATTCAGG - Intronic
1118730059 14:68659693-68659715 CCAGGCAGAGGGAGGGCGTCTGG - Intronic
1120852968 14:89187464-89187486 CCAGCCACAGTGATGGTGTGTGG - Intronic
1122027185 14:98886585-98886607 CCAGCCTCAGGGAGCCTGTCTGG - Intergenic
1122053425 14:99075613-99075635 CCTTCCCCAGGGAAGGTGCCTGG + Intergenic
1122284337 14:100641946-100641968 CCAGGAACAAGGAGGGTGTCCGG - Intergenic
1124140209 15:27070881-27070903 CCAGCCACAGGGAGGCTCTGAGG - Intronic
1124218744 15:27831638-27831660 CCTTCCAGAGGGAGCGTGTCTGG + Intronic
1124356155 15:28996374-28996396 CCATGCACAGGGAGGGAGGATGG - Intronic
1124413504 15:29456096-29456118 CCATGGACAGGGAGGGGGTGGGG - Intronic
1126077256 15:44923366-44923388 ATATCCACAGTGAGGGGGTCTGG - Intergenic
1126081459 15:44967499-44967521 ATATCCACAGTGAGGGGGTCTGG + Intronic
1127811651 15:62570228-62570250 TCACCCACGGGGAGGGTGCCAGG + Intronic
1128566340 15:68702701-68702723 CAATCCACAGAGATGGTGCCTGG - Intronic
1131077397 15:89503904-89503926 CCATCCATACAGAGGGTGACAGG + Intergenic
1131424465 15:92334297-92334319 CAATCCACAGGCAGGGTCTATGG + Intergenic
1132810454 16:1794370-1794392 CCATCCTCGGGGAGTGTGTGGGG + Intronic
1133976167 16:10601239-10601261 CCAGCCTCTGGGCGGGTGTCAGG - Intergenic
1136689720 16:32020481-32020503 CCATCCACAGGATGGGGGCCTGG - Intergenic
1136879506 16:33889889-33889911 CCATCCACAGGATGGGGGCCTGG + Intergenic
1139698404 16:68691940-68691962 CCATCCTCAGGGAGGGGGTGGGG - Intronic
1140629568 16:76834975-76834997 CCATCCACGGGGAGGAGGCCAGG + Intergenic
1141698733 16:85632793-85632815 GCATCCACAGGGAGGAAGCCGGG + Intronic
1142137903 16:88460005-88460027 CCAGCTAGAGGGTGGGTGTCAGG - Intronic
1142159268 16:88548248-88548270 CCTTCCCCCGGGAGGGTGACAGG - Intergenic
1203092511 16_KI270728v1_random:1225490-1225512 CCATCCACAGGATGGGGGCCTGG - Intergenic
1143532136 17:7511713-7511735 CCAGATCCAGGGAGGGTGTCAGG - Intronic
1145974429 17:28976122-28976144 CCATCCACAGGGAGGAGGCCAGG - Intronic
1146329761 17:31917448-31917470 CTGTCCACAGGGAGGGAATCCGG + Intergenic
1146804556 17:35855019-35855041 GCATCTTCAGGGAGGGAGTCGGG + Exonic
1148135446 17:45288932-45288954 CCATCAACAGGGAGGGTGCTGGG - Intronic
1151211399 17:72547113-72547135 GCATCCTCAGGGAGGATCTCGGG - Intergenic
1152086671 17:78223908-78223930 CCTTCCACAGTGAATGTGTCTGG + Exonic
1152623498 17:81377885-81377907 CACTCCACAGGGAGGGAGCCAGG + Intergenic
1152639731 17:81444531-81444553 CCATCCACAGGGAGGGGCTGCGG - Exonic
1153032742 18:730289-730311 ACATACACAGGGAGAGTCTCTGG - Intronic
1153669139 18:7393633-7393655 CCAGCCCCTGGGAAGGTGTCTGG - Intergenic
1160681133 19:412140-412162 CCGTCCACAGGGCAGGTGTTAGG - Intergenic
1161139568 19:2639648-2639670 CCATCCAAGGGGAGGGATTCAGG + Intronic
1161206729 19:3045330-3045352 TCAGCCACAGGGAAGGTGCCAGG + Intronic
1161871960 19:6877118-6877140 CCTACCACAGGCAGGGTATCGGG - Intergenic
1163378209 19:16947264-16947286 CCAGGCACTGGGAGGGGGTCTGG - Intronic
1163416948 19:17192684-17192706 CCAGGCACAGAGATGGTGTCAGG + Intronic
1166317163 19:41995738-41995760 CCATCCCCAGGGAGAGTCTGGGG - Intronic
1166887856 19:45972839-45972861 ACATCCCCAGGGAGGGAGGCTGG + Intronic
1168126385 19:54285797-54285819 CCAGGCCCAGGGAGGGTGTGGGG + Intergenic
1168175510 19:54625067-54625089 CCAGGCCCAGGGAGGGTGTGGGG - Intronic
925099331 2:1232001-1232023 CCATCCATAGGGAGGCCTTCAGG + Intronic
925210603 2:2042689-2042711 CCAACCTCAGGGTGGGTGACAGG - Intronic
925370694 2:3343168-3343190 GCATCCACAGGGCAGGTGGCGGG - Intronic
925858549 2:8153250-8153272 CCATCCATTGGGAGAGTTTCTGG + Intergenic
927924974 2:27005707-27005729 ACATCCAAAGGGAGAGTGGCAGG + Intronic
928371750 2:30744977-30744999 CCAGCCACAGAGCGGGGGTCAGG - Intronic
928546467 2:32333479-32333501 CCAACCAAAGGGAGGGTTTAAGG + Intergenic
928744642 2:34396897-34396919 CCATCCGCAGGCAAGGTCTCTGG + Intergenic
929506726 2:42534054-42534076 TCATCCAAAGGGAAGGTTTCAGG - Intronic
937113485 2:119385633-119385655 CCATCCACAGGGAAAGTGAAGGG - Intergenic
942073663 2:172337397-172337419 CCACCAAGAGGGAGGGTGTGAGG + Intergenic
946401883 2:219472549-219472571 CCATCCTCAGAGTGGGTGCCTGG + Intronic
947573944 2:231257615-231257637 CCAGTCACAGGGAGGGTAGCAGG - Intronic
947958218 2:234213085-234213107 CCAGAGACAGGGAGGGTGTATGG + Intergenic
948821997 2:240554749-240554771 CCATCAACAGGAAGGGTGCTAGG - Intronic
948844297 2:240675871-240675893 CCACCCAGAGGGAGGGAGTGAGG - Intergenic
948849561 2:240699008-240699030 CCACCCAGAGGGAGGGAGTGAGG + Intergenic
948851727 2:240711585-240711607 CAAGCCACAGTGTGGGTGTCTGG - Intergenic
1169194589 20:3676320-3676342 CCATCTACAGGGAGGGGAGCAGG - Intronic
1172649516 20:36492987-36493009 CCAGCCACTGGCAGGGAGTCTGG - Intronic
1174366804 20:50061446-50061468 CAGGCCACAGGGAAGGTGTCAGG - Intergenic
1174399890 20:50270290-50270312 CAGTCCATAGGGATGGTGTCTGG + Intergenic
1175234677 20:57501780-57501802 CCACCCAGAGGGAGGGAGGCAGG + Intronic
1176359551 21:5983261-5983283 CCATCTGCAGGGATGGTGTGGGG + Intergenic
1178608209 21:34057551-34057573 CCTACCCCAGGGAGGGGGTCTGG - Intergenic
1179476729 21:41651332-41651354 CCATCCACTGGGAGGGGGGGCGG - Intergenic
1179540919 21:42082860-42082882 CCACCCAAAGGGAAGCTGTCAGG - Intronic
1179763967 21:43555289-43555311 CCATCTGCAGGGATGGTGTGGGG - Intronic
1179824695 21:43957470-43957492 CCCTCCACACGGGGGGTCTCGGG + Intronic
1179824706 21:43957497-43957519 CCCTCCACACGGGGGGTCTCGGG + Intronic
1180061224 21:45386055-45386077 CCCTCCACAGGGAGGGAAGCAGG - Intergenic
1180061262 21:45386201-45386223 CCCTCCACAGGGAGGGAAGCAGG - Intergenic
1180974856 22:19842711-19842733 CCTTGCCCAGGGAGGGTTTCTGG - Intronic
1181274899 22:21682102-21682124 CCATGCACAGGTATGGTGCCAGG - Intronic
1183498881 22:38166257-38166279 CCAGCCAAAGGGAGGGTGGAAGG - Intronic
1183867215 22:40713356-40713378 CCTTCCACAGTGAGGTTGTTCGG - Intergenic
1183986230 22:41572042-41572064 CCTTCCACAGGGAGGGCAGCAGG + Exonic
1184565431 22:45288992-45289014 CCACCCACAGGGAGGCGGTGGGG - Intronic
1185086461 22:48743488-48743510 CCATGCACAGGTATGGGGTCAGG + Intronic
953094849 3:39765451-39765473 GGATCCATATGGAGGGTGTCTGG - Intergenic
953214035 3:40901300-40901322 CCATCCAAAGGATGGGAGTCAGG + Intergenic
954107181 3:48415682-48415704 ACAGCCACAGGGAGCGTGGCAGG + Exonic
955122965 3:56079957-56079979 CCATCCACAGGCATGTTGTCAGG - Intronic
960267811 3:115640812-115640834 TCATACATAGGGAGAGTGTCCGG - Intronic
961624485 3:128252204-128252226 CCATTCACAGGGAGGGAGGCAGG - Intronic
965413489 3:168362840-168362862 TCACCCACAGGGAGAGTGACAGG + Intergenic
965447978 3:168799578-168799600 ACTTACAAAGGGAGGGTGTCTGG + Intergenic
968081202 3:195847881-195847903 CCACCCCCAGGAAGGGTGTGGGG - Intergenic
968445604 4:650653-650675 CCACACACAGGGAGGGGGGCCGG + Intronic
968449193 4:667207-667229 CCATCACCAGGGAGTGTGGCCGG - Intronic
968465477 4:747794-747816 TCATCCCCAGGGAAGGTTTCTGG - Intronic
968585445 4:1414220-1414242 CCGCCCGCAGGGAGGGAGTCGGG + Intergenic
969030132 4:4205159-4205181 CCATCCCCTGGGAGGGTGGTGGG + Intronic
969204640 4:5634299-5634321 CCAACAACCAGGAGGGTGTCAGG + Intronic
971506323 4:27370009-27370031 ACATCCACAGGTAGGGTGGCTGG + Intergenic
972867757 4:43255735-43255757 CCATGCAAATGGAGGGAGTCCGG - Intergenic
973131947 4:46658630-46658652 GCACCCACTGGGAGGGTGTAGGG + Intergenic
974077909 4:57184481-57184503 CCCTGCACGGGGAGGGTCTCGGG + Intergenic
976223369 4:82775980-82776002 CCATCCACAGCAAGGTAGTCAGG + Intronic
976290689 4:83414352-83414374 CCATCCACAGGGGTGCTGTGGGG + Intronic
980306213 4:131064589-131064611 CTCTCCACAGCCAGGGTGTCTGG + Intergenic
984387272 4:179077214-179077236 AGATCCAGAGGGAGGCTGTCCGG - Intergenic
984882368 4:184421363-184421385 TCATCCACAGAGAGGGCTTCGGG + Intronic
988728739 5:33949200-33949222 CTATCCACATGGAGGTTGGCAGG - Intronic
995334466 5:110983608-110983630 TGAGCCACAGGGAGGTTGTCAGG + Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
1000157238 5:158563856-158563878 CCAGCCACAGGGAGCGTGAGGGG - Intergenic
1000165361 5:158643023-158643045 CCATCAACAGAGAGGGTGTATGG - Intergenic
1000280985 5:159781940-159781962 CCAACCACAGGGATGCTGGCTGG + Intergenic
1002942807 6:1733087-1733109 CCATCCAGAGGCAGGGTGACAGG - Intronic
1007581124 6:42960785-42960807 CCACCCCCAGGGAGCGGGTCCGG - Exonic
1011752725 6:90469524-90469546 CCAGCCAGGGGAAGGGTGTCTGG - Intergenic
1012387257 6:98696623-98696645 CCATCCTCTGGAAAGGTGTCAGG - Intergenic
1012417487 6:99025783-99025805 CCAGGCACAGGCAGGGTGCCTGG - Intergenic
1012427159 6:99127693-99127715 CCATACACAGGGAAGGGGACTGG - Intergenic
1012562490 6:100600503-100600525 CCCTCCACCGTTAGGGTGTCTGG - Intronic
1013612792 6:111810734-111810756 CCACCCACAGGGTGGGTTTTCGG - Intronic
1015169785 6:130239847-130239869 CAACCCACAGTGAGTGTGTCAGG - Intronic
1018200332 6:161388501-161388523 CCATCCACAAGTATGGTGTGTGG + Intronic
1018785151 6:167102524-167102546 CCACCCAAAGGGAGGGAGTGGGG + Intergenic
1018886362 6:167941036-167941058 CCATCCACAGGAGAGGTGTGTGG + Intronic
1018886397 6:167941208-167941230 CCATCCACAGGAGAGGTGTGTGG + Intronic
1018886433 6:167941380-167941402 CCATCCACAGGAGAGGTGTGTGG + Intronic
1018886445 6:167941438-167941460 CCATCCACAGGAGAGGTGTGTGG + Intronic
1018886457 6:167941496-167941518 CCATCCACAGGAGAGGTGTGTGG + Intronic
1018886470 6:167941554-167941576 CCATCCACAGGAGAGGTGTGTGG + Intronic
1018886483 6:167941612-167941634 CCATCCACAGGAGAGGTGTGTGG + Intronic
1019218079 6:170456346-170456368 CCATCCACAAGGAGCGATTCAGG - Intergenic
1019510879 7:1416719-1416741 CCATACACAGAAGGGGTGTCAGG + Intergenic
1021878777 7:25073663-25073685 CCATTCACAGCGAGTGAGTCAGG + Intergenic
1021909958 7:25375580-25375602 CCTTGCACAGGGAGGGAGCCGGG + Intergenic
1023483856 7:40663731-40663753 CCATGCACAGGAATTGTGTCTGG + Intronic
1023516739 7:41008891-41008913 CCACCCGAAGGGATGGTGTCTGG + Intergenic
1024296105 7:47843629-47843651 CCATCCACAGGGGCGGTGGGAGG - Intronic
1029642235 7:101828623-101828645 CCAGACACAGGGACGGGGTCTGG - Intronic
1030233570 7:107234090-107234112 CCATCCCCAAGGTGAGTGTCAGG + Intronic
1031925260 7:127632702-127632724 ATGTCCACAGCGAGGGTGTCAGG + Intergenic
1032182467 7:129692093-129692115 CCTGCCACCGGGAGGGTGGCAGG - Intronic
1034858499 7:154576678-154576700 CCATCCACAGGGGCTGTGCCCGG - Intronic
1034942129 7:155237443-155237465 CCGCCCTCAGGGAGGGTGCCTGG - Intergenic
1035619064 8:1024161-1024183 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035619098 8:1024271-1024293 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035619118 8:1024326-1024348 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035619138 8:1024381-1024403 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035619158 8:1024436-1024458 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1038435370 8:27532097-27532119 CCAACCGCAGGGTGGGGGTCTGG - Intronic
1039458050 8:37720964-37720986 CCTCCCACAGTTAGGGTGTCTGG - Intergenic
1040707357 8:50145106-50145128 CCAACCATAGGGAGGATGCCAGG + Intronic
1041059385 8:54021909-54021931 GCGTCCCCGGGGAGGGTGTCCGG - Intronic
1042254691 8:66790871-66790893 CCCTCCACAGGAAGGTTTTCAGG + Intronic
1045059722 8:98401249-98401271 CCATCCACATGTCTGGTGTCTGG - Intergenic
1045358626 8:101411861-101411883 CTATTCCCAGGGAGGGTGTGGGG - Intergenic
1045650768 8:104339970-104339992 CCATACATAGGGAGACTGTCGGG - Intronic
1048251294 8:132868779-132868801 CTCTCCACAGAGAGGGTCTCAGG - Intronic
1048549621 8:135422218-135422240 ACATCCAGAGGGAGGCAGTCAGG - Intergenic
1048877244 8:138846601-138846623 CCATCCCCAGGAAGGCTGGCTGG - Intronic
1049179048 8:141211403-141211425 CCATCCCTGGGCAGGGTGTCTGG + Exonic
1049470007 8:142771013-142771035 CCAGGCACAGGGAGGGAGACAGG - Intronic
1050903048 9:10969210-10969232 TGATGCACAGGGAGGGTTTCTGG + Intergenic
1050947965 9:11549957-11549979 CTATCCACAGGCAGTTTGTCAGG - Intergenic
1051357528 9:16253553-16253575 CAGTCCAGAGGGAGGGTGTTGGG - Intronic
1052943519 9:34148986-34149008 CCATCCACATTTAGGGTCTCTGG + Intergenic
1053412749 9:37926194-37926216 CCATCCTCAGGGTGGGGGTGGGG - Intronic
1053480739 9:38414625-38414647 CCTTCCACGTGGAGGGTGTTAGG + Intronic
1055993416 9:82131500-82131522 CCTTCCAGAGGGCGGGTGTTTGG - Intergenic
1056660234 9:88537776-88537798 GCATCCCCAGGGAGTGTGTTTGG + Intronic
1057903884 9:98969630-98969652 CCAGCCATAGGGAGGGAGTCAGG + Intronic
1062137413 9:134936982-134937004 CCAGCCTCATGGAGGGTGGCAGG + Intergenic
1062266110 9:135687287-135687309 CCTTCCACTGGGAGGGTGTGGGG - Intergenic
1062383724 9:136299866-136299888 CCAGCCACAGGGAGTGGGTCTGG - Intronic
1189331041 X:40145373-40145395 CCCACCACAGGGTGTGTGTCGGG - Intronic
1193179755 X:78440981-78441003 CCATCCAGAGGGTGGGATTCGGG - Intergenic
1196784647 X:119411169-119411191 CCTTCCTCAGCGAGGGAGTCAGG - Intronic
1200115455 X:153767931-153767953 CCATCCACAGAGAGGGGGGATGG - Intronic