ID: 1106792797

View in Genome Browser
Species Human (GRCh38)
Location 13:33172775-33172797
Sequence ATTATTATCAGACATGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106792792_1106792797 23 Left 1106792792 13:33172729-33172751 CCTTTCTAAATGACCAAAAATTC 0: 1
1: 0
2: 3
3: 24
4: 284
Right 1106792797 13:33172775-33172797 ATTATTATCAGACATGTAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 117
1106792796_1106792797 -9 Left 1106792796 13:33172761-33172783 CCAAATTAAAATTTATTATTATC 0: 1
1: 0
2: 7
3: 118
4: 1061
Right 1106792797 13:33172775-33172797 ATTATTATCAGACATGTAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 117
1106792795_1106792797 -8 Left 1106792795 13:33172760-33172782 CCCAAATTAAAATTTATTATTAT 0: 1
1: 0
2: 16
3: 240
4: 1887
Right 1106792797 13:33172775-33172797 ATTATTATCAGACATGTAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 117
1106792794_1106792797 10 Left 1106792794 13:33172742-33172764 CCAAAAATTCAAATGAGGCCCAA 0: 1
1: 0
2: 0
3: 31
4: 351
Right 1106792797 13:33172775-33172797 ATTATTATCAGACATGTAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106792797 Original CRISPR ATTATTATCAGACATGTAGC TGG Intronic
902687464 1:18087953-18087975 ATGCATATCAGTCATGTAGCAGG + Intergenic
906002410 1:42438275-42438297 ATTATTACTTGACATGTAGAAGG + Intronic
906813598 1:48854268-48854290 ATGATTAACAGATATGGAGCAGG - Intronic
906831806 1:49040350-49040372 ATCCTTATCAGCCATGTAGGAGG - Intronic
908143300 1:61210435-61210457 ATTATTATCACATATGGAGAAGG + Intronic
909506666 1:76398718-76398740 ATTTTTATAGGACATATAGCAGG + Intronic
911381690 1:97122679-97122701 AGTATCATCAGGCATGTAACAGG - Intronic
916987940 1:170211802-170211824 ATAATAATCAGACATGTTTCAGG + Intergenic
918245929 1:182659402-182659424 AGTATTATAAAACATGTAGCCGG + Intronic
918795279 1:188887287-188887309 ATTGGTATCAGCCATGTAGTGGG + Intergenic
920727591 1:208450653-208450675 ACTATTATAAGACCTGTCGCGGG + Intergenic
922307756 1:224358701-224358723 CTTATGCTCAGAAATGTAGCTGG + Intronic
1063799065 10:9551574-9551596 ACTAATATTAAACATGTAGCAGG + Intergenic
1064183238 10:13137395-13137417 ATTATTATCAGAAGAGTAGTAGG - Exonic
1064543870 10:16432197-16432219 ATAATTATCAGATAAGCAGCAGG - Intergenic
1064824630 10:19382975-19382997 ATTAATATCAGAAATGAAGTAGG + Intronic
1064907289 10:20360567-20360589 ATTATTATCAACCAAGCAGCTGG - Intergenic
1068118700 10:52762309-52762331 ATTATTCTCATAAATGTAGCAGG + Intergenic
1070452070 10:76569448-76569470 ATTTTTATCATACATGTATGAGG + Intergenic
1070999556 10:80817081-80817103 TTTATTATCAGAGCAGTAGCAGG + Intergenic
1073016516 10:100404291-100404313 AAAATTGTCTGACATGTAGCAGG - Intergenic
1078568160 11:12434855-12434877 ATTATCTTCAGACCTGGAGCAGG - Intronic
1079402392 11:20116183-20116205 AATATTATAAGAGATGTAGCAGG + Intronic
1079588745 11:22156854-22156876 ATTATTAATAGACATGAAACCGG + Intergenic
1083010455 11:59392371-59392393 ATTATTTTCAGTCATGAAGCTGG + Intergenic
1086284029 11:85224546-85224568 AATATTAGCAGAAATGTTGCTGG + Intronic
1086322850 11:85668594-85668616 ATTATTATTAGACATGAATCTGG - Intronic
1086322998 11:85670200-85670222 ATTAATTTCAGACATGTAGAGGG + Intronic
1088202645 11:107356666-107356688 ATTACTATCTGGCATGTAGTTGG - Intronic
1090210587 11:124918404-124918426 AGTAGTTTCAGACATGTAGTAGG - Intergenic
1093354584 12:18150703-18150725 AATATTATGAGATATGTAGGAGG - Intronic
1095163053 12:38939149-38939171 ATTATTATCATGGATGTAGGGGG + Intergenic
1095206467 12:39444479-39444501 AATCTTAACAGACATGTAACTGG + Intergenic
1101193211 12:102355964-102355986 TTTATTATCTGACATGTGCCTGG + Intergenic
1101458805 12:104867327-104867349 ATTATTATCAGAGATATTCCTGG + Intronic
1104714129 12:131005420-131005442 ATTATAACCAGCCATGAAGCAGG - Intronic
1106792797 13:33172775-33172797 ATTATTATCAGACATGTAGCTGG + Intronic
1107132625 13:36912455-36912477 ATTATTATCAGGCAAGTAATAGG + Intronic
1107222887 13:38006862-38006884 ATCATTAACAGACATGTACAAGG - Intergenic
1108238102 13:48430125-48430147 ATTATTATTAGACTTTTAACAGG + Intronic
1110618821 13:77572053-77572075 ATTATTTTCAGACATGTGGGTGG + Intronic
1118988955 14:70780822-70780844 ATTTTTATCTGGTATGTAGCTGG - Intronic
1119584888 14:75824001-75824023 ATTATTCTTAGAAATGTTGCTGG + Intronic
1119956869 14:78808319-78808341 TTTATTATTAGACAAGAAGCTGG - Intronic
1120344065 14:83261740-83261762 ACTATTATCAGAGATGAAGGTGG - Intergenic
1127744067 15:61946202-61946224 TTTATTATCTGTCATGTACCAGG - Intronic
1133601125 16:7341664-7341686 ATTGTTCTCTGAAATGTAGCAGG - Intronic
1134330069 16:13242537-13242559 TTCAATATCAGACATGAAGCCGG - Intergenic
1139129098 16:64118726-64118748 AGTATTATCAGAGATATAGAGGG + Intergenic
1140561147 16:75983319-75983341 ATTATGATTAGACACATAGCAGG - Intergenic
1145118411 17:20233062-20233084 ATTATTATCTGAAATTTAGATGG + Intronic
1146942940 17:36856506-36856528 ATTATTATCAGAGAGGTGGAGGG + Intergenic
1148137762 17:45306089-45306111 ATTATTATCTGCCATGTATTAGG + Intronic
1149822450 17:59792886-59792908 ATTATTATCAGATGAGTGGCTGG + Intronic
1154262859 18:12853070-12853092 CATAGTATCAAACATGTAGCTGG + Intronic
1155707578 18:28836483-28836505 ATTATTTTCATATATGTAGATGG + Intergenic
1158065915 18:53408206-53408228 AATATTATCACAAATGTAGCAGG + Intronic
1159161150 18:64645146-64645168 ATTATTTTCACAAATGGAGCCGG + Intergenic
1160179687 18:76623365-76623387 ATTATTATCACAAAAGTCGCTGG + Intergenic
927629265 2:24757428-24757450 ATTAATATGTGACATATAGCAGG - Intronic
933027533 2:77279761-77279783 ATTATAATAAGACATGAAGTTGG + Intronic
935533196 2:104261016-104261038 ATCAGTATCAGCCATGTGGCGGG + Intergenic
935886871 2:107630544-107630566 ATGATTATCAGAAATGAAGGAGG - Intergenic
937817921 2:126274265-126274287 CTTGTTATCAGACAGGTAGAAGG - Intergenic
940440988 2:153716110-153716132 ATTATTTTCTCACCTGTAGCAGG + Intergenic
943792863 2:191954348-191954370 ATTATTATCATAAATGTAAAAGG - Intronic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1169393868 20:5212887-5212909 ATTATAAGCAGACATGTTGCTGG - Intergenic
1170551145 20:17477611-17477633 ATTATTATTAAACATTTAACAGG + Intronic
1175027704 20:55920145-55920167 AACATTATCAGAGATTTAGCAGG - Intergenic
1177466162 21:21483130-21483152 AATGTTATCAAACATGTGGCAGG - Intronic
1179104819 21:38389504-38389526 ATTATTATCAGTCATGCTTCAGG - Intronic
954318498 3:49814489-49814511 ATAATTACCATACATGTGGCCGG + Intergenic
956190359 3:66602132-66602154 TCTATTATCAGACATTTAGATGG + Intergenic
959823683 3:110767686-110767708 TTTAGTTTCAGACATGCAGCAGG - Intergenic
962971809 3:140408381-140408403 ATCAGTATCAGCCATGTCGCAGG + Intronic
963459748 3:145595694-145595716 ATTAATAACAGAAATATAGCTGG + Intergenic
965132897 3:164724057-164724079 TTTATTATCAGAAATGCAGAAGG - Intergenic
969081819 4:4624989-4625011 ATTTGTATCAGATAAGTAGCAGG - Intergenic
969998160 4:11336340-11336362 ATTATAATAAAACCTGTAGCGGG + Intergenic
973624750 4:52760092-52760114 ATTAATCTCACACATGTTGCTGG + Intergenic
974684890 4:65215220-65215242 ATTGGTATCAGTCATGCAGCAGG + Intergenic
974895144 4:67928811-67928833 ATTTTTATCAGACATGAAACAGG - Intronic
976880236 4:89913366-89913388 CTTATTAGTAGACATGTGGCAGG + Intronic
978204122 4:106059190-106059212 ATTATTATTACACATTTAACAGG - Intronic
981455754 4:144951863-144951885 GTCAGTATCAGCCATGTAGCAGG + Intergenic
982679553 4:158412446-158412468 TTTTTTATCTGACATGGAGCTGG - Intronic
984047758 4:174822666-174822688 AATATTATCAGAAATATATCAGG + Intronic
989438922 5:41447162-41447184 ATCATAATCAGACATGAATCAGG - Intronic
994475476 5:100263012-100263034 GTTATTTTCTGAAATGTAGCTGG - Intergenic
996267961 5:121565155-121565177 AGTATCAGCAGACATTTAGCTGG + Intergenic
996793793 5:127321889-127321911 ATAATTCTCTGACATGTAGCAGG - Intronic
998399435 5:141840892-141840914 ATTAATATCAGACACGTGGCAGG + Intergenic
999463237 5:151774847-151774869 ACTATTATCTTACATGTAGTTGG + Intronic
1001499462 5:172218163-172218185 ATGAATATCAGACAGGTAGTTGG + Intronic
1002842688 6:920130-920152 TTTGTACTCAGACATGTAGCAGG - Intergenic
1003415814 6:5906801-5906823 ATTTTTATGAGACATCTGGCAGG + Intergenic
1007874112 6:45076460-45076482 ATGATAATCAGACACGTAACAGG - Intronic
1008685112 6:53917123-53917145 ATCATTTTCTGACTTGTAGCTGG + Intronic
1008808294 6:55458649-55458671 AGTAATATCAGACATGTAGCAGG + Intronic
1009501827 6:64423446-64423468 ATTACTGACAGACATGTAGTAGG + Intronic
1010642796 6:78350843-78350865 ATTATAATTAGACATACAGCAGG - Intergenic
1010998960 6:82565585-82565607 ATTTTCATGAGACATGGAGCTGG + Intergenic
1011924954 6:92630994-92631016 ATTAATATCAGAAATGAAGGAGG - Intergenic
1012497591 6:99851436-99851458 ATTAATTTCATACATGTAGATGG - Intergenic
1012541979 6:100371963-100371985 ATTATTATTATACAAGTAGAGGG + Intergenic
1012863813 6:104594284-104594306 AAATTTATCAGACATATAGCTGG + Intergenic
1014435587 6:121417408-121417430 AATATTATCAGACATTAAGAAGG + Intergenic
1019585104 7:1796594-1796616 ATTATTATCATAAATGAAGGGGG + Intergenic
1020548031 7:9558439-9558461 ATTAATATGTGACCTGTAGCAGG - Intergenic
1021596158 7:22319268-22319290 ATTTTTCTCAGACATGGAGGCGG - Intronic
1022151674 7:27614310-27614332 TTTGTTATCAGTCAGGTAGCAGG - Intronic
1030429349 7:109422900-109422922 ATTAATATCAGAAATGAAGGAGG - Intergenic
1031122080 7:117733383-117733405 ATTTTTATCAGAGAGCTAGCGGG + Intronic
1031517472 7:122718928-122718950 ATTATTATCATAAATCCAGCAGG - Intronic
1034990770 7:155546829-155546851 ATTTTTATGGGAAATGTAGCTGG + Intergenic
1039998076 8:42552007-42552029 ATTATTATTATTCATGTATCAGG - Intronic
1040788059 8:51190583-51190605 CTTAATGTCAGACATGTAGCAGG - Intergenic
1043073556 8:75667430-75667452 ATTATTAGAAGAAATGTAGAAGG + Intergenic
1043824566 8:84910175-84910197 ATTACAATCAAACATGAAGCAGG + Intronic
1045446601 8:102271875-102271897 AAGATTATCAGACTTGTAGGTGG - Intronic
1046181187 8:110650390-110650412 ATTTTTATAAGCCATTTAGCAGG + Intergenic
1048045458 8:130768502-130768524 AATTTTATCATACTTGTAGCTGG + Intergenic
1048766862 8:137854231-137854253 GTTGTTATCAGCCATGTAGCTGG - Intergenic
1051334351 9:16053078-16053100 ATTCTTTTCAGAATTGTAGCTGG + Intronic
1051724609 9:20076165-20076187 ATTTTTATGTGTCATGTAGCCGG - Intergenic
1051794146 9:20845283-20845305 ATTATTATCAGAGTTATATCTGG - Intronic
1052095393 9:24378068-24378090 AATACTTTCAGACATTTAGCTGG - Intergenic
1052980725 9:34447088-34447110 CTTATTCTCAGAAAGGTAGCTGG - Intronic
1189967326 X:46388084-46388106 ATTAGTATCAGACTGGAAGCAGG + Intergenic
1190902270 X:54687886-54687908 ATTAATATCAGACATGAAACAGG - Intergenic
1195864717 X:109417873-109417895 AGTATTATCAGACATAAAGAGGG + Intronic
1200795217 Y:7334919-7334941 TTTATTAACAGACATACAGCAGG - Intergenic
1201505748 Y:14697789-14697811 ATTATAATCATACATGTATATGG + Intronic