ID: 1106794253

View in Genome Browser
Species Human (GRCh38)
Location 13:33188069-33188091
Sequence TTTCCCATGGCCCAGCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106794253_1106794256 -7 Left 1106794253 13:33188069-33188091 CCTGGTTGCTGGGCCATGGGAAA 0: 1
1: 0
2: 1
3: 18
4: 202
Right 1106794256 13:33188085-33188107 TGGGAAAGAGCACTGGCCAAAGG 0: 1
1: 0
2: 2
3: 26
4: 258
1106794253_1106794261 28 Left 1106794253 13:33188069-33188091 CCTGGTTGCTGGGCCATGGGAAA 0: 1
1: 0
2: 1
3: 18
4: 202
Right 1106794261 13:33188120-33188142 TCTGCCATGTGACCTGCCACCGG 0: 1
1: 0
2: 2
3: 12
4: 172
1106794253_1106794259 1 Left 1106794253 13:33188069-33188091 CCTGGTTGCTGGGCCATGGGAAA 0: 1
1: 0
2: 1
3: 18
4: 202
Right 1106794259 13:33188093-33188115 AGCACTGGCCAAAGGCAGGTGGG 0: 1
1: 0
2: 1
3: 26
4: 242
1106794253_1106794257 -3 Left 1106794253 13:33188069-33188091 CCTGGTTGCTGGGCCATGGGAAA 0: 1
1: 0
2: 1
3: 18
4: 202
Right 1106794257 13:33188089-33188111 AAAGAGCACTGGCCAAAGGCAGG 0: 1
1: 0
2: 2
3: 24
4: 247
1106794253_1106794258 0 Left 1106794253 13:33188069-33188091 CCTGGTTGCTGGGCCATGGGAAA 0: 1
1: 0
2: 1
3: 18
4: 202
Right 1106794258 13:33188092-33188114 GAGCACTGGCCAAAGGCAGGTGG 0: 1
1: 0
2: 0
3: 27
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106794253 Original CRISPR TTTCCCATGGCCCAGCAACC AGG (reversed) Intronic
900458017 1:2786724-2786746 TCTCCCCTCGCCCAGCGACCTGG - Intronic
901176381 1:7302438-7302460 TTTCTCATGTCACAGCAATCTGG - Intronic
901392592 1:8956809-8956831 TTTCCCTGGGGCCAGCAAGCTGG + Intronic
904365901 1:30010720-30010742 CCTCCCAAGGCCCAGGAACCTGG + Intergenic
904635545 1:31878078-31878100 TCTCCCATGGCCCAGGACCGTGG - Intergenic
906551193 1:46667983-46668005 TGTCCTAAGGCCCAGCAGCCCGG + Intronic
907783710 1:57591337-57591359 TTTCACATGGGCCAGTCACCAGG - Intronic
907815194 1:57911654-57911676 TGGCTCATGGCCCAGCACCCTGG + Intronic
908653208 1:66358996-66359018 TTCCCCTTGCACCAGCAACCTGG - Intronic
908934663 1:69360172-69360194 TTTAAGATGGCCCAGCAAACTGG - Intergenic
909066568 1:70942075-70942097 ATCCCCATAACCCAGCAACCAGG + Intronic
910069540 1:83195236-83195258 TTTCCCAGTGCCCAGTACCCTGG + Intergenic
910828893 1:91439995-91440017 TTTCTCATGCCCCAGCAAGTAGG + Intergenic
913660494 1:121002587-121002609 TTTGCCTTCTCCCAGCAACCTGG - Intergenic
914011857 1:143785744-143785766 TTTGCCTTCTCCCAGCAACCTGG - Intergenic
914165975 1:145175390-145175412 TTTGCCTTCTCCCAGCAACCTGG + Intergenic
914650485 1:149694404-149694426 TTTGCCTTCTCCCAGCAACCTGG - Intergenic
917307938 1:173646301-173646323 ATACCCATGTACCAGCAACCAGG + Intronic
919727712 1:200894887-200894909 GTTCCCCTGGCCCGGCAGCCTGG + Exonic
919878860 1:201889226-201889248 CCTCCCATGGCCCAGCATCCTGG - Intronic
922504284 1:226117699-226117721 TTCCCCAGCCCCCAGCAACCTGG + Intergenic
922768119 1:228166382-228166404 TCACCCAGGGCCCAGCACCCGGG + Intronic
923347216 1:233066297-233066319 TTTCCCATGGTCCAGTGAACAGG - Intronic
1062792404 10:316872-316894 TTTCCCATGGCAGAGGAGCCAGG - Intronic
1063284043 10:4663364-4663386 CTTCACATGCCTCAGCAACCTGG + Intergenic
1063383138 10:5598976-5598998 TTTCCCAGGACCCTGCCACCCGG + Intergenic
1065168111 10:23001710-23001732 TTTCCCAGGGCCCGAAAACCGGG + Intronic
1065562372 10:26976744-26976766 TTTCTCGTGGCACAGCAGCCAGG + Intergenic
1065807448 10:29407985-29408007 TTTAAGATGGCCCAGCAAGCTGG - Intergenic
1066539019 10:36424073-36424095 TTTCCCATTGCCCATTAAACGGG + Intergenic
1067571364 10:47373691-47373713 TGTCCCATGTCCCAGCAGCATGG - Intronic
1068106793 10:52628272-52628294 TTTCACATAGATCAGCAACCTGG + Intergenic
1068543572 10:58322931-58322953 TTTCCCATTCCCCTGCAGCCAGG - Intergenic
1069913850 10:71775331-71775353 TTCCCCAGGGCCTAGCAGCCGGG + Intronic
1073686263 10:105757469-105757491 ATTTCCATGCCCCAGCTACCTGG - Intergenic
1073941229 10:108700660-108700682 ATTCCCATCTCCCATCAACCTGG + Intergenic
1074111027 10:110423040-110423062 GTGCCCAGTGCCCAGCAACCAGG + Intergenic
1074135915 10:110626279-110626301 TTGCCCAAGGCCATGCAACCTGG + Intergenic
1074219299 10:111420657-111420679 CTTCCCTTGGCCCAGCCACAAGG - Intergenic
1074225023 10:111476387-111476409 ATTCTCATGGCCCAGTAACAAGG + Intergenic
1075438129 10:122460234-122460256 TTTCCCATGCCCCAGGCTCCTGG + Intergenic
1076791274 10:132777994-132778016 CTGCCCATGGCCCAGGAACTCGG - Intronic
1077979152 11:7282064-7282086 TTGGCCATGACCCAGCAACTTGG + Intronic
1078358870 11:10652974-10652996 TTCCCCATGGTGCAGCAGCCTGG + Intronic
1078456951 11:11482878-11482900 TGTTCCATGGCCCAGCAGCATGG + Intronic
1081579386 11:44341440-44341462 TTTTCCATTGCTCAGCATCCTGG - Intergenic
1083398049 11:62404866-62404888 TTCTCCAGGGCCCAGCTACCTGG - Intergenic
1083777415 11:64900957-64900979 TTTCCCAGTGCCCAGCACTCGGG - Exonic
1084147525 11:67273002-67273024 TCTCCCATGGCCCAGCAGGCGGG + Intronic
1084502727 11:69544469-69544491 TTTCCCAAGGCCTAGCAAGGAGG + Intergenic
1090137206 11:124210396-124210418 TTTCTCAGGGCACAGGAACCTGG + Intergenic
1092663381 12:10764693-10764715 GATCCCATGGCCCAGGATCCAGG - Intergenic
1093929572 12:24942153-24942175 TTTCCCATTGCCCTGCATACTGG - Intronic
1094189028 12:27677896-27677918 ATTCACATGGACCAGCAAACGGG + Intronic
1096156418 12:49343798-49343820 TTCCCCAGGGCACAGCAACTAGG - Intergenic
1096551952 12:52378796-52378818 TTTCCCCTAGCCCAGCACACAGG + Intronic
1096806672 12:54145246-54145268 TTACCCCTGGCCCAGCAAGGCGG - Intergenic
1098702407 12:73645657-73645679 TCTCCCATTGCTCAGCAACTGGG + Intergenic
1104725698 12:131074455-131074477 ATTCCCATTCCCCAGCCACCTGG + Intronic
1106794253 13:33188069-33188091 TTTCCCATGGCCCAGCAACCAGG - Intronic
1112349802 13:98623260-98623282 TTTCCAATTGCCCAGCATCTGGG + Intergenic
1112726583 13:102311280-102311302 CTCCCCAGGGCCCAGAAACCAGG - Intronic
1113854804 13:113437312-113437334 TACCCCATGACCCAGCACCCAGG + Intronic
1114758131 14:25283019-25283041 TTACACATGGCTCAGCAACATGG - Intergenic
1116846300 14:49867937-49867959 TCTCTCACGGCCCAGCAATCAGG - Intergenic
1117131491 14:52691555-52691577 TCTCCCACGGCCCAGCCACCAGG + Intronic
1119785940 14:77314373-77314395 TTTCTCATGGCACAGCAAGTGGG - Intronic
1121335251 14:93074002-93074024 GCTCCCAGGGCCCAGCAGCCTGG + Intronic
1121540829 14:94724943-94724965 TTTCCCATGTCCCAGCACGTTGG - Intergenic
1122848461 14:104513567-104513589 TATCCCCGGGCCCAGCCACCCGG - Intronic
1130170648 15:81509394-81509416 TTTGCCATGTCCCAGCAAGCGGG - Intergenic
1130725159 15:86431840-86431862 TTTCCCATGTCACAGCAACCGGG - Intronic
1130895026 15:88163259-88163281 TTTCCCAGCATCCAGCAACCTGG + Intronic
1131816352 15:96224919-96224941 TGTCCCATGTCCCACCGACCTGG - Intergenic
1134138052 16:11692923-11692945 GTTCCCAAGGCCCAGCACCAGGG + Intronic
1134379080 16:13707750-13707772 TTTTCCATGGACCAGGAAGCGGG - Intergenic
1135678857 16:24439997-24440019 CTTCCCAGGGCACAGCAACTAGG - Intergenic
1136127664 16:28196170-28196192 TGTCCCATGCCCCAGCCACTAGG - Intronic
1136479053 16:30530312-30530334 TTACTTATGGCCCAGAAACCAGG - Intronic
1137015423 16:35369501-35369523 ATTTCCATGGCCCAGCATTCAGG - Intergenic
1137814070 16:51381610-51381632 TTTAACATTGCCCAACAACCTGG - Intergenic
1140509970 16:75499936-75499958 TTTACCATCGCCCAGAATCCTGG + Intergenic
1141437305 16:84007535-84007557 TCTCCCATCCCCCAGCAGCCAGG + Intergenic
1143731545 17:8885357-8885379 CTTCCCATGGCCCTGCCTCCCGG + Intronic
1143731614 17:8885521-8885543 CTTCCCATGGCCCTGCCTCCCGG + Intronic
1144391939 17:14801821-14801843 TTTACCTTGGCCCAGTCACCGGG - Intergenic
1147862179 17:43530103-43530125 TTACCCATGGCCCCGTCACCTGG + Exonic
1148779028 17:50111429-50111451 CCTCCCATGGCCCTGCCACCAGG + Exonic
1149141040 17:53434270-53434292 TTTCCCAAGCCCCATCTACCAGG + Intergenic
1150478269 17:65490125-65490147 TTTCTCTTAGCCCATCAACCTGG + Intergenic
1151696866 17:75722282-75722304 TTTCCCATGGCTCAGCCTCTGGG + Intronic
1151963635 17:77420055-77420077 TCTTCCATGGCCCAGGCACCTGG - Intronic
1152573666 17:81131069-81131091 TTGCCCATGGCCAAGCAGCCTGG - Exonic
1156064560 18:33124364-33124386 ATTCCCATGGCCCCGGAATCAGG - Intronic
1158495411 18:57950868-57950890 TTTCCCATGGCAGAGCTACAAGG + Intergenic
1158963224 18:62603377-62603399 CTTCCCATTGCCCAGCAATCCGG - Intergenic
1160938734 19:1610153-1610175 TGTCCCATGTCCCAGCACCCAGG - Exonic
1161384956 19:3986271-3986293 TTTGCCATGTCCCAGGCACCCGG + Intergenic
1162001330 19:7746723-7746745 TTCCCCAGGTCCCAGGAACCAGG + Intronic
1162949278 19:14061208-14061230 GTTCCCATTGCTAAGCAACCAGG + Intergenic
1163272746 19:16263846-16263868 GTTCCTCTAGCCCAGCAACCAGG - Intergenic
1164127088 19:22328335-22328357 TTTCACAGGGCCCAGCAGACAGG + Intergenic
1164256337 19:23531530-23531552 TATCACAGGGCCCAGCATCCAGG - Intronic
1166310287 19:41958824-41958846 CTTCTCACGGCCCCGCAACCTGG - Exonic
1167611712 19:50511006-50511028 CTTCCTATCACCCAGCAACCAGG + Intronic
1168559689 19:57372536-57372558 TTTCCCAACTCCCAGGAACCAGG - Intronic
1168599955 19:57709392-57709414 TTTCTCATCGCCCAGCGCCCTGG - Intronic
928161505 2:28930585-28930607 TTTACCATGGCATAGAAACCTGG + Intronic
928659616 2:33488478-33488500 TTTCCTACGGCCCAGCTACTTGG - Intronic
930442335 2:51424898-51424920 TCCCCCATGGCTCAGCAAGCAGG + Intergenic
930832451 2:55759563-55759585 TATCCCAGGGCCCAGGTACCAGG + Intergenic
932580224 2:72988551-72988573 TTTCTCATGGGCCAGTTACCTGG - Intronic
932583764 2:73009393-73009415 TTTCACATGGACAAGCAACATGG - Intronic
934573263 2:95385036-95385058 CCTCCCATGGCCCAGCAGCTTGG + Exonic
935087775 2:99865215-99865237 ATTGCCATGGCCCAGCCATCAGG + Intronic
936039938 2:109142167-109142189 CTTCCCATGGTCCAGCCCCCTGG + Intronic
936081994 2:109438599-109438621 TTTCCCAGGGCCCTGGAGCCAGG - Intronic
941237738 2:162996070-162996092 TTTCCCTTGGCTCTGCATCCTGG - Intergenic
945592005 2:211745478-211745500 TCTTCCATGTCCCAGCCACCAGG + Intronic
947102857 2:226639901-226639923 CTTCCCATGGCCCTGTCACCTGG - Intergenic
947280573 2:228448483-228448505 TTTCCCATAGCCCACCCTCCAGG + Intergenic
1168908669 20:1427560-1427582 TCTCCTATGCCCCAGCCACCAGG + Intergenic
1169021892 20:2336451-2336473 TTTCCCAAGCCCCAGAAACCAGG + Intronic
1171026201 20:21632709-21632731 TTTCCCAAGGCCCAGCCTTCAGG + Intergenic
1171288690 20:23966863-23966885 TTTCCCCTGGGCCAGGACCCAGG + Intergenic
1172424948 20:34849764-34849786 TTTCCCAAGGCCACACAACCAGG + Intronic
1172836566 20:37877156-37877178 TTTCCCATGGGAGAGCAGCCAGG - Intergenic
1172908641 20:38388903-38388925 TTTCCCCTGGCACACCAACTGGG - Intergenic
1175201621 20:57281812-57281834 TTTCCCTGTGCCCAACAACCAGG - Intergenic
1175204340 20:57300421-57300443 TCTGCCATGGCCCTGCATCCAGG + Intergenic
1175226715 20:57448860-57448882 TTTCACCTGGCTCAGCCACCAGG + Intergenic
1175595265 20:60225773-60225795 TTGCCCTCGGCCCAGCAGCCAGG - Intergenic
1175667019 20:60869599-60869621 ACCCCCATGGCCCAGGAACCAGG - Intergenic
1175756065 20:61530985-61531007 TTTCCCTTGGCCCACCCATCTGG - Intronic
1175991429 20:62791690-62791712 TGTCCCCAGGCCCAGCCACCAGG - Intergenic
1178308726 21:31511825-31511847 TTTCCCTTGCCCTAGCAACGAGG - Intronic
1179121491 21:38550163-38550185 TTTCCTGTGACTCAGCAACCAGG - Intronic
1180882422 22:19215433-19215455 TTCCGCATGGGCCAGCCACCTGG - Intronic
1183113448 22:35670157-35670179 TTTCAGATGGCCCAGCAAACTGG + Intergenic
1184343722 22:43900498-43900520 TAACCCAGGGCCCAGCAGCCAGG + Intergenic
1184371138 22:44082811-44082833 ATTCCCTTGGCCCAGAAACACGG - Intronic
950246419 3:11423655-11423677 TTTCCCATGGCTAATCAGCCTGG + Intronic
955408437 3:58640680-58640702 TTTCCCAGGGTCCAGTAACCTGG + Intronic
957502129 3:81070402-81070424 TTACATATAGCCCAGCAACCTGG + Intergenic
960514765 3:118591093-118591115 TTTAAGATGGCCCAGCAAACTGG + Intergenic
961195000 3:124994075-124994097 TTTTCCATGGACCAGCAAGGGGG + Intronic
961645992 3:128393060-128393082 TTTCCCAGCGCCCAGGCACCTGG + Intronic
962207282 3:133445308-133445330 TTTCACATGGCCCTGCCCCCAGG - Intronic
963909760 3:150806709-150806731 TTTCCCATGGCACATCAAAATGG - Intergenic
965052103 3:163663952-163663974 TGTGCCATGGCACAGCAGCCTGG - Intergenic
965545621 3:169913364-169913386 TTTCCCAGTGCCCAGGAGCCGGG - Intronic
967899754 3:194437372-194437394 TTTCCTATCCCCCAGCACCCTGG + Exonic
968955318 4:3716057-3716079 TGTCCAAGGGCCCAGCCACCAGG - Intergenic
969344763 4:6563734-6563756 CCGCCCATGGCCCAGCAGCCGGG - Intergenic
969440217 4:7212591-7212613 TTTCCCATGGACCAGGACCTGGG - Intronic
973589760 4:52429103-52429125 TTTCCCATGGCTGAGCAAAATGG - Intergenic
974786499 4:66624890-66624912 TTTCCGTGGGCTCAGCAACCTGG + Intergenic
977089919 4:92658627-92658649 TTTCCAATGGCCCAGTGACCTGG - Intronic
980253554 4:130348948-130348970 TTTCTCATTGCCCAGTAACTTGG + Intergenic
987211268 5:15686018-15686040 TTTGCCATAGAGCAGCAACCAGG + Intronic
990446060 5:55895763-55895785 TTTCCCATGGCCCAATAAAAAGG - Intronic
992178778 5:74176361-74176383 TTTCCCATTGTCTAGAAACCAGG - Intergenic
992846531 5:80754999-80755021 TGTTCCATGAGCCAGCAACCGGG + Intronic
998047943 5:139004971-139004993 ACTCCCCTGCCCCAGCAACCTGG - Intronic
998272430 5:140718826-140718848 TTTAGCATGACTCAGCAACCAGG - Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1000248467 5:159470041-159470063 CTTCCCGTGGCCCAGCCCCCAGG - Intergenic
1004298694 6:14437516-14437538 TATGCCTTGGCCCAGCAACATGG + Intergenic
1005278960 6:24250278-24250300 TCTCCTTTGGCCCTGCAACCTGG - Intronic
1007487108 6:42188549-42188571 CTGCCCATGGGCCAGCAGCCTGG - Intronic
1007907240 6:45474169-45474191 TTTCCCTTTGCCCAGCATCAGGG + Intronic
1008602369 6:53108739-53108761 TTTCCAATGGCACAGCAGACTGG + Intergenic
1012923469 6:105244337-105244359 TTTCCCATGGCCCAGGCACTGGG - Intergenic
1016345687 6:143111746-143111768 TTTCTCCTGGGCCAGCAGCCTGG + Intronic
1017944932 6:159088470-159088492 ATTCCTATGGCCCAGGCACCAGG - Intergenic
1017986788 6:159450784-159450806 TTTCTCTTGGCCCAGCAAGGAGG + Intergenic
1019610774 7:1935613-1935635 CTTCCCACAGCCCAGCACCCAGG - Intronic
1025781036 7:64602062-64602084 TATCGCAGGGCCCAGCAACCAGG + Intergenic
1029460826 7:100693422-100693444 TTTCCCGCGGCCGAGCAACTGGG + Intergenic
1029605981 7:101599650-101599672 CTCCCCATCTCCCAGCAACCGGG + Intergenic
1029713698 7:102314226-102314248 AGTCCCATGGCCCAGCATCTAGG - Intronic
1034935751 7:155199567-155199589 TTTCCCATGGCTGAGAAGCCAGG + Intergenic
1035292916 7:157851065-157851087 TGTCCCATGGCCCCGCACACCGG + Intronic
1036498536 8:9292927-9292949 TTTCCCATGGCTTAGCAAGCTGG + Intergenic
1037708456 8:21335502-21335524 TTCTCCATGGCCCATCAACATGG + Intergenic
1038004544 8:23418532-23418554 GTCCCCATGGCCCAGCGCCCTGG - Intronic
1038238703 8:25787804-25787826 CTTGCCATGTCCCAGAAACCAGG - Intergenic
1038428775 8:27483287-27483309 TTTCCCATGCCCCACCTGCCAGG + Intergenic
1039275506 8:35931115-35931137 ATTCCCATAGCCCAGGAAGCTGG + Intergenic
1039527141 8:38226897-38226919 TTTTGCATGGCTCAGCAACATGG - Intronic
1041503035 8:58560048-58560070 TTTTCAATGACCCCGCAACCTGG - Intronic
1044800106 8:95945252-95945274 CTTGCCAGGGCCCAGCAGCCAGG - Intergenic
1046321343 8:112580931-112580953 TTTCCCACTGCCCAGCAAAAAGG + Intronic
1046395470 8:113633638-113633660 TCTCCCAAGGCACAGGAACCTGG + Intergenic
1046737748 8:117795191-117795213 CTTAACATGGCCCAGCAACTAGG - Exonic
1048628718 8:136216508-136216530 TGTCCCATGTTCCAGGAACCAGG - Intergenic
1049525204 8:143121928-143121950 AGTCCCAGAGCCCAGCAACCTGG + Intergenic
1049720943 8:144115217-144115239 TGACCCATGGCCAAGCACCCTGG - Intronic
1053183427 9:35993804-35993826 TTTCCAATAGCCCAGCAAAATGG - Intergenic
1057100471 9:92354384-92354406 TTACGCATGGCTCAGCAACAAGG - Intronic
1060193857 9:121610348-121610370 CTTCCCATGGACCAGCCACTCGG + Intronic
1060777262 9:126384253-126384275 CTTCCCGAGGCCCAGCTACCTGG + Intronic
1186872134 X:13783683-13783705 CTGCCCATGTCCCAGCAACCTGG + Intronic
1190454626 X:50615694-50615716 GTTCCCATTGCCTGGCAACCTGG - Intronic
1190658471 X:52633828-52633850 TTTCCCATTGCCGTGCATCCTGG + Intergenic
1193363829 X:80607109-80607131 TTTAAGATGGCCCAGCAAACCGG + Intergenic
1193645729 X:84066519-84066541 TTTACCATGGCGCAGCAAAGCGG + Intronic
1194073057 X:89351017-89351039 TTTCCCATGAACCTGCAACCTGG - Intergenic
1194138484 X:90177963-90177985 TTTAAGATGGCCCAGCAAGCTGG - Intergenic
1196400935 X:115315634-115315656 TTCAACATGGCCCAGCAAGCTGG - Intergenic
1197815375 X:130493132-130493154 TGGGCCATGGCCCAGCAACTTGG + Intergenic
1198480038 X:137032962-137032984 TTTCCCATGGCCCCTCACCTTGG + Intergenic
1198806657 X:140501375-140501397 TCTCCCCTGGCCCCTCAACCCGG - Intergenic
1199864017 X:151826818-151826840 ATTCCCATTGCCCATCAAACAGG + Intergenic
1200484281 Y:3748200-3748222 TTTAAGATGGCCCAGCAAGCTGG - Intergenic
1200727294 Y:6686757-6686779 TTTCCCATGAACCTGCAACCTGG - Intergenic
1200728446 Y:6702532-6702554 TTTCCCATGAACCTGCAACCTGG - Intergenic
1202251774 Y:22880424-22880446 TATCCCATGGCTCAGCACCTGGG - Intergenic
1202368907 Y:24184396-24184418 TTCCCCATGCCCCAGCAAGATGG - Intergenic
1202404762 Y:24514173-24514195 TATCCCATGGCTCAGCACCTGGG - Intergenic
1202466017 Y:25155909-25155931 TATCCCATGGCTCAGCACCTGGG + Intergenic
1202501878 Y:25485721-25485743 TTCCCCATGCCCCAGCAAGATGG + Intergenic