ID: 1106794471 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:33190197-33190219 |
| Sequence | CTTTGGAAGGCCAATGAGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 69376 | |||
| Summary | {0: 1, 1: 13, 2: 402, 3: 7224, 4: 61736} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1106794466_1106794471 | -8 | Left | 1106794466 | 13:33190182-33190204 | CCTGTAATCCCAGCACTTTGGAA | 0: 9594 1: 299194 2: 262940 3: 149017 4: 131705 |
||
| Right | 1106794471 | 13:33190197-33190219 | CTTTGGAAGGCCAATGAGGAAGG | 0: 1 1: 13 2: 402 3: 7224 4: 61736 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1106794471 | Original CRISPR | CTTTGGAAGGCCAATGAGGA AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||