ID: 1106794471

View in Genome Browser
Species Human (GRCh38)
Location 13:33190197-33190219
Sequence CTTTGGAAGGCCAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69376
Summary {0: 1, 1: 13, 2: 402, 3: 7224, 4: 61736}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106794466_1106794471 -8 Left 1106794466 13:33190182-33190204 CCTGTAATCCCAGCACTTTGGAA 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
Right 1106794471 13:33190197-33190219 CTTTGGAAGGCCAATGAGGAAGG 0: 1
1: 13
2: 402
3: 7224
4: 61736

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106794471 Original CRISPR CTTTGGAAGGCCAATGAGGA AGG Intronic
Too many off-targets to display for this crispr