ID: 1106797219

View in Genome Browser
Species Human (GRCh38)
Location 13:33219087-33219109
Sequence GGTACTATGTAAGATGCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106797219 Original CRISPR GGTACTATGTAAGATGCTAA GGG Intronic
904225095 1:29010592-29010614 GGACCTATGAAAGATGTTAATGG + Intronic
905117589 1:35655636-35655658 GGTACTGTGCAAGATTCTAAAGG + Intergenic
908051541 1:60237793-60237815 GGAAACATGTAAGATGCTCAAGG + Intergenic
909856282 1:80536513-80536535 GGTCCTGTGTAAGAATCTAATGG - Intergenic
916225404 1:162485066-162485088 TCTACTATGTAAGATATTAATGG - Intergenic
917694563 1:177508625-177508647 GGGACTATGCAAGGTGCTAGAGG - Intergenic
918009756 1:180575851-180575873 AGTACTATGTAACATGATAAGGG + Intergenic
920349449 1:205328377-205328399 GATACTTTGTAAGCTGTTAAAGG + Intergenic
920837694 1:209526964-209526986 GGTACTATGCAAGATCCTCAAGG + Intergenic
1065460307 10:25955511-25955533 GATACTGAGTAAGTTGCTAAAGG + Intronic
1065694371 10:28366474-28366496 GTTACTATTTAAAAAGCTAAAGG + Intergenic
1068930405 10:62583409-62583431 GGTACTAAGCAAGAGACTAAAGG - Intronic
1072750966 10:97978412-97978434 TGTACTATGTAAGATGTAAGAGG - Intronic
1073252036 10:102126411-102126433 GGTACTCTGTTAGATGCTGGAGG - Intergenic
1073279359 10:102340987-102341009 TGTTCTATGAAAGATGTTAAGGG + Intronic
1074138774 10:110652577-110652599 ACTAAAATGTAAGATGCTAAAGG - Intronic
1074301408 10:112236369-112236391 GCTTTTATGCAAGATGCTAAGGG + Intergenic
1080632064 11:34086980-34087002 GGGAATATGTAAGAGGCAAAGGG + Intronic
1085819949 11:79781574-79781596 GAGACTATTTAAGATGCAAATGG - Intergenic
1086527293 11:87742774-87742796 ATTACTATGTGAGATCCTAAAGG - Intergenic
1087477298 11:98652149-98652171 GGCACTATGTATTATGCTAATGG + Intergenic
1088512513 11:110592750-110592772 AGTAGTATGTCAGATACTAAAGG - Intronic
1096268643 12:50145411-50145433 GGGACTCCTTAAGATGCTAAGGG - Intronic
1096572793 12:52533388-52533410 GGGACTATGAAACATGCTTAGGG - Intergenic
1096613958 12:52821228-52821250 GGGAATATGTAAGCTGCTCAAGG - Intergenic
1098362446 12:69667807-69667829 GGTTCTATGCCAGATGCTAGAGG - Intronic
1098609703 12:72441099-72441121 AGTACTATACAAGATGATAAGGG + Intronic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1106797219 13:33219087-33219109 GGTACTATGTAAGATGCTAAGGG + Intronic
1107782091 13:43914628-43914650 GGTACTATGTTAAATGCTTGAGG + Intergenic
1109558324 13:64011852-64011874 GGCCTGATGTAAGATGCTAATGG + Intergenic
1110416331 13:75257437-75257459 GGTACTAAGAAAGACTCTAATGG + Intergenic
1126358822 15:47824247-47824269 GGAATTATGGAAGATGGTAAGGG - Intergenic
1127035996 15:54918137-54918159 GGTACTAAGCTACATGCTAAAGG + Intergenic
1127218511 15:56850856-56850878 GGTACTATGTAACATTTTACTGG + Intronic
1128296452 15:66524710-66524732 GGTACTATGCTAGATGGTAAGGG - Intronic
1133424695 16:5677952-5677974 TGTTCTATGTCAGATGCTCATGG + Intergenic
1133598054 16:7312007-7312029 GATATTAAGTAAGATGCAAATGG + Intronic
1138932822 16:61681905-61681927 GGTAATCTGGATGATGCTAACGG + Intronic
1139609604 16:68046098-68046120 GGTACCATGTGTGATGCTGAGGG + Intronic
1139739688 16:69024567-69024589 GGTACAATTTAAGAGGCTAGAGG - Intronic
1140171055 16:72605392-72605414 GGTACAATGTTAAATGCAAATGG - Intergenic
1146776824 17:35626534-35626556 GGTAATATGTCAGAGTCTAATGG - Intronic
1156672304 18:39485662-39485684 GATACTATCTAAAATGCTCAAGG + Intergenic
1156734516 18:40237385-40237407 TGTCCTTTGTAAGTTGCTAATGG - Intergenic
1157374556 18:47150875-47150897 GGTACTATTCAAGTAGCTAAGGG - Intronic
1159188901 18:65016684-65016706 AGTACTATATTAGATGCTATAGG - Intergenic
1164499066 19:28797748-28797770 GGTAAACTGTATGATGCTAAGGG + Intergenic
1165687452 19:37834240-37834262 GGTTCTATGAAAGATTCTGAGGG + Intergenic
928592998 2:32836268-32836290 GGCACTATGCTAGATGCTTAGGG + Intergenic
929009121 2:37423796-37423818 TGTAGTATGTCAGATGATAAGGG + Intergenic
935700739 2:105809740-105809762 AGTACTGTCTAAGATGCTAAGGG + Intronic
935760361 2:106314788-106314810 GGACCTATGTTAGCTGCTAACGG - Intergenic
936489793 2:112960399-112960421 GAGACTATGGATGATGCTAATGG + Intergenic
939971277 2:148664017-148664039 GGAACTAAGAAAGATCCTAAAGG + Intronic
941436576 2:165480440-165480462 TGTACTAGGTAGGATTCTAAAGG - Intronic
942022607 2:171881742-171881764 GGTACTGTGCAAGGTGCTAGAGG - Intronic
944381816 2:199119211-199119233 GGTATTGAGTAAGATGCCAATGG - Intergenic
944846269 2:203671365-203671387 GGTACTATGAAAGAAGCCAAGGG - Intergenic
946899617 2:224359549-224359571 GGCCCTATGACAGATGCTAAAGG - Intergenic
1171443930 20:25190086-25190108 TATACAATGTAAAATGCTAAAGG + Intergenic
1173929389 20:46806180-46806202 TGTACTATGTTAGATGGCAATGG - Intergenic
1173929882 20:46809745-46809767 TGTACTATGTTAGATGGGAATGG + Intergenic
1178328138 21:31661747-31661769 GGAACTATGCAAGCTGCTCAGGG - Intronic
1179620779 21:42614426-42614448 GCTACTATATAAGAAGGTAAAGG + Intergenic
952087721 3:29846975-29846997 GGTACTATATCAGATGGTCATGG - Intronic
952785431 3:37150112-37150134 GGTACTATAGGAGGTGCTAAAGG + Intronic
953866021 3:46584207-46584229 GATACTATGTCAGGTGTTAAAGG + Intronic
961077834 3:123998204-123998226 GGGTGAATGTAAGATGCTAAGGG - Intergenic
961306735 3:125963131-125963153 GGGTGAATGTAAGATGCTAAGGG + Intergenic
962358358 3:134714327-134714349 GTTACTATGGAAGATGCAAGAGG + Intronic
966976697 3:185091048-185091070 GCTACTAAGTCAGATGCTATGGG + Intronic
967500278 3:190189456-190189478 AGTACTATGTAATATGCTGATGG + Intergenic
970893083 4:21069808-21069830 AGTACTATGTAAGATGGAAATGG - Intronic
971139615 4:23909885-23909907 GGTCCAATGTTAGCTGCTAAGGG + Intergenic
972863946 4:43206883-43206905 GGTACCATCTAAGATCCTAACGG - Intergenic
975015140 4:69405914-69405936 GGTCATATGTAAGACTCTAAAGG - Intronic
975365277 4:73521566-73521588 TGTCCTACGTAAAATGCTAAAGG - Intergenic
978283402 4:107044765-107044787 GGTAGTAAGTAAGATGAAAAAGG - Intronic
980244871 4:130225860-130225882 AGTAGTGTGGAAGATGCTAAAGG + Intergenic
982063257 4:151625488-151625510 GGTACTAATTTAGATGCAAATGG + Intronic
983268910 4:165538264-165538286 GGCACTATGCAAGTTGCTAGGGG + Intergenic
985259709 4:188103785-188103807 GGGACTATGCAAGGTGCTAGGGG - Intronic
990082782 5:51937219-51937241 AGAACTATGAAAGATGATAAAGG + Intergenic
990464171 5:56056585-56056607 GGTACTGTGTATGATGCTGGGGG + Intergenic
994913638 5:105944895-105944917 GGTACTAAGACAGATTCTAAGGG + Intergenic
995892528 5:116971094-116971116 AGTACTGTGCAAGGTGCTAATGG + Intergenic
995987507 5:118196887-118196909 GGCTCTATGCAGGATGCTAAGGG - Intergenic
1000217096 5:159170291-159170313 AGTAGTATGTAAGATACTGATGG - Intronic
1000408977 5:160918160-160918182 GACACTATGTTAGGTGCTAAGGG + Intergenic
1000691238 5:164323960-164323982 AGTACTTTGTAAAATGCAAAGGG + Intergenic
1000991983 5:167920572-167920594 GGTACTATTGTAGATGCTGAGGG + Intronic
1001371751 5:171211051-171211073 TGTGCTATGTACTATGCTAAGGG - Intronic
1005702426 6:28415342-28415364 AGTACAATGTAAGCTGCTACAGG - Intergenic
1013146483 6:107399230-107399252 GGTACCTTGTTAGAGGCTAAGGG - Intronic
1014270295 6:119328860-119328882 GGAACAATATAAAATGCTAAAGG + Intronic
1014741216 6:125149538-125149560 GGGACTGTGCTAGATGCTAAGGG - Intronic
1019502534 7:1371580-1371602 GGCACTAAGAAAGATGCCAATGG + Intergenic
1030741276 7:113112989-113113011 GGTACTATAATAGAGGCTAAGGG - Intergenic
1032594925 7:133229864-133229886 AGTACTTTGTAAGATGTTAAAGG - Intergenic
1034202388 7:149290523-149290545 GGCACTGTGTAAGGTGCTAGAGG - Intronic
1037020443 8:13963720-13963742 TGTGCTAAGTAAAATGCTAAAGG - Intergenic
1037874531 8:22534478-22534500 AGTACTAGGTATGTTGCTAAAGG + Intronic
1038007708 8:23447438-23447460 GGCACTATTTAAAATGCTATGGG + Intronic
1038987806 8:32832354-32832376 GGAACTATGTCAAATGTTAATGG - Intergenic
1046350376 8:113001868-113001890 TGTACTATGTACTTTGCTAAGGG - Intronic
1047344218 8:124011328-124011350 GGTGTTATGTAAGAAGATAAGGG - Intronic
1050691141 9:8227652-8227674 GGTACAATTTAAGATCTTAAAGG - Intergenic
1055898333 9:81206121-81206143 GTTACTATGTAACATTCTGAGGG - Intergenic
1059687976 9:116656140-116656162 GGTACTGTGTAAGATGGATATGG - Intronic
1060442004 9:123649121-123649143 GGTACTATGTAAAACCCTATGGG + Intronic
1186880324 X:13858891-13858913 GGTACAATGGATGATGCCAAAGG - Intronic
1187690585 X:21862477-21862499 GATAGGATATAAGATGCTAAGGG + Intronic
1195279650 X:103318591-103318613 GTTCATATGTAAGATGATAAGGG + Intergenic
1197259833 X:124306056-124306078 GGTACTATGCTAGGTGCTAGGGG + Intronic
1198729695 X:139716178-139716200 GGAAATATGTAAGATAATAAAGG + Intergenic
1199467630 X:148157065-148157087 GGTACTGTGTAAGATTCAGAGGG + Intergenic
1199800192 X:151242973-151242995 GGCACTATGCAAGATGCTGACGG - Intergenic
1200325574 X:155234908-155234930 GGCACTGTATAAGATGCTCAAGG - Intronic